chapter 16: control of gene expression

313

16Control of Gene

Expression

Concept Outline

16.1 Gene expression is controlled by regulatingtranscription.

An Overview of Transcriptional Control. In bacteriatranscription is regulated by controlling access of RNApolymerase to the promoter in a flexible and reversible way;eukaryotes by contrast regulate many of their genes byturning them on and off in a more permanent fashion.

16.2 Regulatory proteins read DNA withoutunwinding it.

How to Read a Helix without Unwinding It.Regulatory proteins slide special segments called DNA-binding motifs along the major groove of the DNA helix,reading the sides of the bases.Four Important DNA-Binding Motifs. DNA-bindingproteins contain structural motifs such as the helix-turn-helix which fit into the major groove of the DNA helix.

16.3 Bacteria limit transcription by blocking RNApolymerase.

Controlling Transcription Initiation. Repressorproteins inhibit RNA polymerase’s access to the promoter,while activators facilitate its binding.

16.4 Transcriptional control in eukaryotes operates ata distance.

Designing a Complex Gene Control System.Eukaryotic genes use a complex collection of transcriptionfactors and enhancers to aid the polymerase intranscription.The Effect of Chromosome Structure on GeneRegulation. The tight packaging of eukaryotic DNA intonucleosomes does not interfere with gene expression.Posttranscriptional Control in Eukaryotes. Geneexpression can be controlled at a variety of levels aftertranscription.

In an orchestra, all of the instruments do not play all thetime; if they did, all they would produce is noise. In-

stead, a musical score determines which instruments in theorchestra play when. Similarly, all of the genes in an organ-ism are not expressed at the same time, each gene produc-ing the protein it encodes full tilt. Instead, different genesare expressed at different times, with a genetic score writ-ten in regulatory regions of the DNA determining whichgenes are active when (figure 16.1).

FIGURE 16.1Chromosome puffs. In this chromosome of the fly Drosophilamelanogaster, individual active genes can be visualized as “puffs”on the chromosomes. The RNA being transcribed from the DNAtemplate has been radioactively labeled, and the dark specksindicate its position on the chromosome.

the maintenance of a constant internal environment—isconsidered by many to be the hallmark of multicellular or-ganisms. Although cells in such organisms still respond tosignals in their immediate environment (such as growthfactors and hormones) by altering gene expression, indoing so they participate in regulating the body as awhole. In multicellular organisms with relatively constantinternal environments, the primary function of gene con-trol in a cell is not to respond to that cell’s immediate en-vironment, but rather to participate in regulating the bodyas a whole.

Some of these changes in gene expression compensatefor changes in the physiological condition of the body.Others mediate the decisions that produce the body, en-suring that the right genes are expressed in the right cellsat the right time during development. The growth anddevelopment of multicellular organisms entail a long se-ries of biochemical reactions, each catalyzed by a specificenzyme. Once a particular developmental change has oc-curred, these enzymes cease to be active, lest they disruptthe events that must follow. To produce these enzymes,genes are transcribed in a carefully prescribed order, eachfor a specified period of time. In fact, many genes are ac-tivated only once, producing irreversible effects. In manyanimals, for example, stem cells develop into differenti-ated tissues like skin cells or red blood cells, following afixed genetic program that often leads to programmedcell death. The one-time expression of the genes thatguide this program is fundamentally different from thereversible metabolic adjustments bacterial cells make tothe environment. In all multicellular organisms, changesin gene expression within particular cells serve the needsof the whole organism, rather than the survival of indi-vidual cells.

Posttranscriptional Control

Gene expression can be regulated at many levels. By farthe most common form of regulation in both bacteria andeukaryotes is transcriptional control, that is, control ofthe transcription of particular genes by RNA polymerase.Other less common forms of control occur after transcrip-tion, influencing the mRNA that is produced from thegenes or the activity of the proteins encoded by themRNA. These controls, collectively referred to as post-transcriptional controls, will be discussed briefly later inthis chapter.

Gene expression is controlled at the transcriptional andposttranscriptional levels. Transcriptional control,more common, is effected by the binding of proteins toregulatory sequences within the DNA.

314 Part V Molecular Genetics

An Overview of Transcriptional ControlControl of gene expression is essential to all organisms.In bacteria, it allows the cell to take advantage of chang-ing environmental conditions. In multicellular organisms,it is critical for directing development and maintaininghomeostasis.

Regulating Promoter Access

One way to control transcription is to regulate the initia-tion of transcription. In order for a gene to be tran-scribed, RNA polymerase must have access to the DNAhelix and must be capable of binding to the gene’s pro-moter, a specific sequence of nucleotides at one end ofthe gene that tells the polymerase where to begin tran-scribing. How is the initiation of transcription regulated?Protein-binding nucleotide sequences on the DNA regu-late the initiation of transcription by modulating the abil-ity of RNA polymerase to bind to the promoter. Theseprotein-binding sites are usually only 10 to 15 nucleotidesin length (even a large regulatory protein has a “foot-print,” or binding area, of only about 20 nucleotides).Hundreds of these regulatory sequences have been char-acterized, and each provides a binding site for a specificprotein able to recognize the sequence. Binding the pro-tein to the regulatory sequence either blocks transcriptionby getting in the way of RNA polymerase, or stimulatestranscription by facilitating the binding of RNA poly-merase to the promoter.

Transcriptional Control in Prokaryotes

Control of gene expression is accomplished very differentlyin bacteria than in the cells of complex multicellular organ-isms. Bacterial cells have been shaped by evolution to growand divide as rapidly as possible, enabling them to exploittransient resources. In bacteria, the primary function ofgene control is to adjust the cell’s activities to its immediateenvironment. Changes in gene expression alter which en-zymes are present in the cell in response to the quantityand type of available nutrients and the amount of oxygenpresent. Almost all of these changes are fully reversible, al-lowing the cell to adjust its enzyme levels up or down as theenvironment changes.

Transcriptional Control in Eukaryotes

The cells of multicellular organisms, on the other hand, havebeen shaped by evolution to be protected from transientchanges in their immediate environment. Most of them ex-perience fairly constant conditions. Indeed, homeostasis—

16.1 Gene expression is controlled by regulating transcription.

How to Read a Helix withoutUnwinding ItIt is the ability of certain proteins to bind to specific DNAregulatory sequences that provides the basic tool of generegulation, the key ability that makes transcriptional con-trol possible. To understand how cells control gene expres-sion, it is first necessary to gain a clear picture of this mole-cular recognition process.

Looking into the Major Groove

Molecular biologists used to think that the DNA helix hadto unwind before proteins could distinguish one DNA se-quence from another; only in this way, they reasoned,could regulatory proteins gain access to the hydrogenbonds between base-pairs. We now know it is unnecessaryfor the helix to unwind because proteins can bind to itsoutside surface, where the edges of the base-pairs are ex-posed. Careful inspection of a DNA molecule reveals twohelical grooves winding round the molecule, one deeperthan the other. Within the deeper groove, called the major

groove, the nucleotides’ hydrophobic methyl groups, hy-drogen atoms, and hydrogen bond donors and acceptorsprotrude. The pattern created by these chemical groups isunique for each of the four possible base-pair arrange-ments, providing a ready way for a protein nestled in thegroove to read the sequence of bases (figure 16.2).

DNA-Binding Motifs

Protein-DNA recognition is an area of active research; sofar, the structures of over 30 regulatory proteins have beenanalyzed. Although each protein is unique in its fine details,the part of the protein that actually binds to the DNA ismuch less variable. Almost all of these proteins employ oneof a small set of structural, or DNA-binding, motifs, par-ticular bends of the protein chain that permit it to interlockwith the major groove of the DNA helix.

Regulatory proteins identify specific sequences on theDNA double helix, without unwinding it, by insertingDNA-binding motifs into the major groove of thedouble helix where the edges of the bases protrude.

Chapter 16 Control of Gene Expression 315

16.2 Regulatory proteins read DNA without unwinding it.

N

G

H

H

H

N

N N H

O H

H

H N

N

N

C

OH

N

Minor groove

Major groove

N

A

H

H

N

N N H

Sugar

Phosphate

O

H

CH3H

H

N

N

T

O

N

Minor groove

Major groove

Key:

= Hydrogen bond donors

= Hydrogen bond acceptors

= Hydrophobic methyl group

= Hydrogen atoms unable to form hydrogen bonds

FIGURE 16.2Reading the major groove of DNA. Looking down into the major groove of a DNA helix, we can see the edges of the bases protrudinginto the groove. Each of the four possible base-pair arrangements (two are shown here) extends a unique set of chemical groups into thegroove, indicated in this diagram by differently colored balls. A regulatory protein can identify the base-pair arrangement by thischaracteristic signature.

Four Important DNA-BindingMotifsThe Helix-Turn-Helix Motif

The most common DNA-binding motif is the helix-turn-helix, constructed from two α-helical segments of the pro-tein linked by a short nonhelical segment, the “turn” (fig-ure 16.3). The first DNA-binding motif recognized, thehelix-turn-helix motif has since been identified in hundredsof DNA-binding proteins.

A close look at the structure of a helix-turn-helix motifreveals how proteins containing such motifs are able to in-teract with the major groove of DNA. Interactions betweenthe helical segments of the motif hold them at roughly rightangles to each other. When this motif is pressed againstDNA, one of the helical segments (called the recognitionhelix) fits snugly in the major groove of the DNA molecule,while the other butts up against the outside of the DNAmolecule, helping to ensure the proper positioning of therecognition helix. Most DNA regulatory sequences recog-nized by helix-turn-helix motifs occur in symmetrical pairs.Such sequences are bound by proteins containing two helix-turn-helix motifs separated by 3.4 nm, the distance requiredfor one turn of the DNA helix (figure 16.4). Having twoprotein/DNA-binding sites doubles the zone of contact be-tween protein and DNA and so greatly strengthens thebond that forms between them.


Recognition helix

FIGURE 16.3The helix-turn-helix motif. One helical region, called therecognition helix, actually fits into the major groove of DNA.There it contacts the edges of base-pairs, enabling it to recognizespecific sequences of DNA bases.

CAP fragment

3.4 nm

Tryptophan repressor Lambda (�) repressorfragment

3.4 nm 3.4 nm

FIGURE 16.4How the helix-turn-helix binding motif works. The three regulatory proteins illustrated here all bind to DNA using a pair of helix-turn-helix binding motifs. In each case, the two copies of the motif (red ) are separated by 3.4 nm, precisely the spacing of one turn of theDNA helix. This allows the regulatory proteins to slip into two adjacent portions of the major groove in DNA, providing a strongattachment.

The Homeodomain Motif

A special class of helix-turn-helix motifs plays a critical rolein development in a wide variety of eukaryotic organisms,including humans. These motifs were discovered when re-searchers began to characterize a set of homeotic mutationsin Drosophila (mutations that alter how the parts of thebody are assembled). They found that the mutant genes en-coded regulatory proteins whose normal function was toinitiate key stages of development by binding to develop-mental switch-point genes. More than 50 of these regula-tory proteins have been analyzed, and they all contain anearly identical sequence of 60 amino acids, the homeo-domain (figure 16.5b). The center of the homeodomain isoccupied by a helix-turn-helix motif that binds to theDNA. Surrounding this motif within the homeodomain is aregion that always presents the motif to the DNA in thesame way.

The Zinc Finger Motif

A different kind of DNA-binding motif uses one or morezinc atoms to coordinate its binding to DNA. Called zincfingers (figure 16.5c), these motifs exist in several forms. Inone form, a zinc atom links an α-helical segment to aβ sheet segment so that the helical segment fits into themajor groove of DNA. This sort of motif often occurs inclusters, the β sheets spacing the helical segments so thateach helix contacts the major groove. The more zinc fin-gers in the cluster, the stronger the protein binds to theDNA. In other forms of the zinc finger motif, the β sheet’splace is taken by another helical segment.

The Leucine Zipper Motif

In yet another DNA-binding motif, two different proteinsubunits cooperate to create a single DNA-binding site.This motif is created where a region on one of the subunitscontaining several hydrophobic amino acids (usuallyleucines) interacts with a similar region on the other sub-unit. This interaction holds the two subunits together atthose regions, while the rest of the subunits are separated.Called a leucine zipper, this structure has the shape of a“Y,” with the two arms of the Y being helical regions thatfit into the major groove of DNA (figure 16.5d ). Becausethe two subunits can contribute quite different helical re-gions to the motif, leucine zippers allow for great flexibilityin controlling gene expression.

Regulatory proteins bind to the edges of base-pairsexposed in the major groove of DNA. Most containstructural motifs such as the helix-turn-helix,homeodomain, zinc finger, or leucine zipper.


(a) Helix-turn-helix motif

(b) Homeodomain

(c) Zinc finger

ZnZn

(d) Leucine zipper

FIGURE 16.5Major DNA-binding motifs.

Controlling Transcription InitiationHow do organisms use regulatory DNA sequences and theproteins that bind them to control when genes are tran-scribed? The same basic controls are used in bacteria andeukaryotes, but eukaryotes employ several additional ele-ments that reflect their more elaborate chromosomal struc-ture. We will begin by discussing the relatively simple con-trols found in bacteria.

Repressors Are OFF Switches

A typical bacterium possesses genes encoding several thou-sand proteins, but only some are transcribed at any onetime; the others are held in reserve until needed. When thecell encounters a potential food source, for example, it be-gins to manufacture the enzymes necessary to metabolizethat food. Perhaps the best-understood example of thistype of transcriptional control is the regulation oftryptophan-producing genes (trp genes), which was investi-gated in the pioneering work of Charles Yanofsky and hisstudents at Stanford University.

Operons. The bacterium Escherichia coli uses proteins en-coded by a cluster of five genes to manufacture the aminoacid tryptophan. All five genes are transcribed together as a

unit called an operon, producing a single, long piece ofmRNA. RNA polymerase binds to a promoter located atthe beginning of the first gene, and then proceeds downthe DNA, transcribing the genes one after another. Regu-latory proteins shut off transcription by binding to an oper-ator site immediately in front of the promoter and oftenoverlapping it.

When tryptophan is present in the medium surround-ing the bacterium, the cell shuts off transcription of thetrp genes by means of a tryptophan repressor, a helix-turn-helix regulatory protein that binds to the operatorsite located within the trp promoter (figure 16.6). Bindingof the repressor to the operator prevents RNA polymerasefrom binding to the promoter. The key to the functioningof this control mechanism is that the tryptophan repressorcannot bind to DNA unless it has first bound to two mol-ecules of tryptophan. The binding of tryptophan to therepressor alters the orientation of a pair of helix-turn-helix motifs in the repressor, causing their recognitionhelices to fit into adjacent major grooves of the DNA(figure 16.7).

Thus, the bacterial cell’s synthesis of tryptophan de-pends upon the absence of tryptophan in the environment.When the environment lacks tryptophan, there is nothingto activate the repressor, so the repressor cannot prevent


16.3 Bacteria limit transcription by blocking RNA polymerase.

Tryptophan

Promoter

Start oftranscription

OperatorTryptophanpresent

Tryptophanabsent

mRNA synthesis

RNA polymerase

RNA polymerase cannot bind

Inactiverepressor

Activerepressor

Genes are ON

Genes are OFF

Tryptophan issynthesized

Tryptophan isnot synthesized

FIGURE 16.6How the trp operon is controlled. The tryptophan repressor cannot bind the operator (which is located within the promoter) unlesstryptophan first binds to the repressor. Therefore, in the absence of tryptophan, the promoter is free to function and RNA polymerasetranscribes the operon. In the presence of tryptophan, the tryptophan-repressor complex binds tightly to the operator, preventing RNApolymerase from initiating transcription.

RNA polymerase from binding to the trp promoter. Thetrp genes are transcribed, and the cell proceeds to manufac-ture tryptophan from other molecules. On the other hand,when tryptophan is present in the environment, it binds tothe repressor, which is then able to bind to the trp pro-moter. This blocks transcription of the trp genes, and thecell’s synthesis of tryptophan halts.

Activators Are ON Switches

Not all regulatory switches shut genes off—some turnthem on. In these instances, bacterial promoters are delib-erately constructed to be poor binding sites for RNA poly-merase, and the genes these promoters govern are thusrarely transcribed—unless something happens to improvethe promoter’s ability to bind RNA polymerase. This canhappen if a regulatory protein called a transcriptional ac-tivator binds to the DNA nearby. By contacting the poly-merase protein itself, the activator protein helps hold thepolymerase against the DNA promoter site so that tran-scription can begin.

A well-understood transcriptional activator is thecatabolite activator protein (CAP) of E. coli, which initiatesthe transcription of genes that allow E. coli to use othermolecules as food when glucose is not present. Falling lev-els of glucose lead to higher intracellular levels of the sig-naling molecule, cyclic AMP (cAMP), which binds to the

CAP protein. When cAMP binds to it, the CAP proteinchanges shape, enabling its helix-turn-helix motif to bindto the DNA near any of several promoters. Consequently,those promoters are activated and their genes can be tran-scribed (figure 16.8).


Tryptophan

3.4 nm

FIGURE 16.7How the tryptophan repressor works. The binding of tryptophan to the repressor increases the distance between the two recognitionhelices in the repressor, allowing the repressor to fit snugly into two adjacent portions of the major groove in DNA.

CAP

cAMP

FIGURE 16.8How CAP works. Binding of the catabolite activator protein(CAP) to DNA causes the DNA to bend around it. This increasesthe activity of RNA polymerase.

Combinations of Switches

By combining ON and OFF switches,bacteria can create sophisticated transcrip-tional control systems. A particularly well-studied example is the lac operon of E.coli (figure 16.9). This operon is responsi-ble for producing three proteins that im-port the disaccharide lactose into the celland break it down into two monosaccha-rides: glucose and galactose.

The Activator Switch. The lac operonpossesses two regulatory sites. One is aCAP site located adjacent to the lac pro-moter. It ensures that the lac genes are nottranscribed effectively when ampleamounts of glucose are already present. Inthe absence of glucose, a high level ofcAMP builds up in the cell. Consequently,cAMP is available to bind to CAP andallow it to change shape, bind to theDNA, and activate the lac promoter (figure 16.10). In thepresence of glucose, cAMP levels are low, CAP is unable tobind to the DNA, and the lac promoter is not activated.

The Repressor Switch. Whether the lac genes are actu-ally transcribed in the absence of glucose is determined bythe second regulatory site, the operator, which is locatedadjacent to the promoter. A protein called the lac repressoris capable of binding to the operator, but only when lactoseis absent. Because the operator and the promoter are closetogether, the repressor covers part of the promoter when itbinds to the operator, preventing RNA polymerase fromproceeding and so blocking transcription of the lac genes.These genes are then said to be “repressed” (figure 16.11).As a result, the cell does not transcribe genes whose prod-ucts it has no use for. However, when lactose is present, alactose isomer binds to the repressor, twisting its bindingmotif away from the major groove of the DNA. This pre-vents the repressor from binding to the operator and so al-lows RNA polymerase to bind to the promoter and tran-scribe the lac genes. Transcription of the lac operon is saidto have been “induced” by lactose.

This two-switch control mechanism thus causes the cellto produce lactose-utilizing proteins whenever lactose ispresent but glucose is not, enabling it to make a metabolicdecision to produce only what the cell needs, conserving itsresources (figure 16.12).

Bacteria regulate gene expression transcriptionallythrough the use of repressor and activator “switches,”such as the trp repressor and the CAP activator. Thetranscription of some clusters of genes, such as the lacoperon, is regulated by both repressors and activators.


Promoterfor I gene

Gene forrepressor protein

Regulatory region Coding region

CAP bindingsite

Gene forpermease

Operator

Promoter forlac operon

Gene for�-galactosidase

Gene fortransacetylase

PI CAP O

ZY A

PlacI

lac control system

FIGURE 16.9The lac region of the Escherichia coli chromosome. The lac operon consists of apromoter, an operator, and three genes that code for proteins required for themetabolism of lactose. In addition, there is a binding site for the catabolite activatorprotein (CAP), which affects whether or not RNA polymerase will bind to thepromoter. Gene I codes for a repressor protein, which will bind to the operator andblock transcription of the lac genes. The genes Z, Y, and A encode the two enzymes andthe permease involved in the metabolism of lactose.

RNA polymerase

RNA polymerase

cAMP CAP

CAP

CAP

CAP

Promoter for lac operon

Plac

Plac

(a) Glucose low, promoter activated

(b) Glucose high, promoter not activated

Promoter for lac operon

O

O

CAP bindingsite

FIGURE 16.10How the CAP site works. The CAP molecule can attach to theCAP binding site only when the molecule is bound to cAMP.(a) When glucose levels are low, cAMP is abundant and binds toCAP. The cAMP-CAP complex binds to the CAP site, bends inthe DNA, and gives RNA polymerase access to the promoter.(b) When glucose levels are high, cAMP is scarce, and CAP isunable to activate the promoter.


RNApolymerase

Repressor

Promoter forlac operon

PlacO

DNAhelix

(a)

RNA polymerase cannot transcribe lac genes

Repressor

CAP

CAP

CAP

CAP

Promoter

Promoter

Operator

Operator

Lactose (inducer)

cAMP

cAMP

Plac

Plac

RNApolymerase

RNApolymerase

O

O

Y

Y

A

A

I

I

Z

Z

(b) lac operon is "repressed"

(c) lac operon is "induced"

FIGURE 16.11How the lac repressor works. (a) The lac repressor. Because the repressor fills the major groove of the DNA helix, RNA polymerasecannot fully attach to the promoter, and transcription is blocked. (b) The lac operon is shut down (“repressed”) when the repressor proteinis bound to the operator site. Because promoter and operator sites overlap, RNA polymerase and the repressor cannot functionally bind atthe same time, any more than two people can sit in the same chair at once. (c) The lac operon is transcribed (“induced”) when CAP isbound and when lactose binding to the repressor changes its shape so that it can no longer sit on the operator site and block RNApolymerase activity.

mRNA synthesis

CAPbinding

site

RNA-polymerasebinding site(promoter)

OperatorlacZ gene

Operon OFFbecause CAPis not bound

Operon OFFboth because lacrepressor isbound and CAPis not

Operon OFFbecause lacrepressor isbound

Operon ONbecause CAPis bound and lac repressoris not

RNA polymerase

Repressor

RNA polymerase

CAP

CAP

Glu

cose

Lact

ose

+

+

+

+

FIGURE 16.12Two regulatory proteins control the lacoperon. Together, the lac repressor and CAPprovide a very sensitive response to the cell’s needto utilize lactose-metabolizing enzymes.


Designing a Complex Gene Control SystemAs we have seen, combinations of ON and OFF controlswitches allow bacteria to regulate the transcription of par-ticular genes in response to the immediate metabolic de-mands of their environment. All of these switches work byinteracting directly with RNA polymerase, either blockingor enhancing its binding to specific promoters. There is alimit to the complexity of this sort of regulation, however,because only a small number of switches can be squeezedinto and around one promoter. In a eukaryotic organismthat undergoes a complex development, many genes mustinteract with one another, requiring many more interactingelements than can fit around a single promoter (table 16.1).

In eukaryotes, this physical limitation is overcome byhaving distant sites on the chromosome exert control overthe transcription of a gene (figure 16.13). In this way, manyregulatory sequences scattered around the chromosomescan influence a particular gene’s transcription. This“control-at-a-distance” mechanism includes two features: aset of proteins that help bind RNA polymerase to the pro-moter, and modular regulatory proteins that bind to distantsites. These two features produce a truly flexible controlsystem.

16.4 Transcriptional control in eukaryotes operates at a distance.

Base pairs

GCCAATGC TATA

-60 bp -25 bp-80 bp-100 bp

Thymidine kinasepromoter

Thymidinekinasegene

FIGURE 16.13A eukaryotic promoter. This promoter for the gene encodingthe enzyme thymidine kinase contains the TATA box that theinitiation factor binds to, as well as three other DNA sequencesthat direct the binding of other elements of the transcriptioncomplex.

Table 16.1 Some Gene Regulatory Proteins and the DNA Sequences They Recognize

Regulatory Regulatory Proteins Proteinsof Species DNA Sequence Recognized* of Species DNA Sequence Recognized*

ESCHERICHIA COLI

lac repressor

CAP

� repressor

YEAST

GAL4

MAT �2

GCN4

AATTGTGAGCGGATAACAATTTTAACACTCGCCTATTGTTAATGTGAGTTAGCTCACTACACTCAATCGAGTGATATCACCGCCAGAGGTAATAGTGGCGGTCTCCAT

CGGAGGACTGTCCTCCGGCCTCCTGACAGGAGGCCATGTAATTGTACATTAAATGACTCATTACTGAGTA

AACGGGTTAATTGCCCAATTGGGATTAGACCCTAATCT

GGGCGGCCCGCCATGCAAATTACGTTTATGATAGACTATC

*Each regulatory protein is able to recognize a family of closely related DNA sequences; only one member of each family is listed here.

DROSOPHILAMELANOGASTER

Krüppel

bicoid

HUMAN

Spl

Oct-1

GATA-1

Eukaryotic Transcription Factors

For RNA polymerase to successfully bind to a eukaryoticpromoter and initiate transcription, a set of proteinscalled transcription factors must first assemble on thepromoter, forming a complex that guides and stabilizesthe binding of the polymerase (figure 16.14). The assem-bly process begins some 25 nucleotides upstream from thetranscription start site, where a transcription factor com-posed of many subunits binds to a short TATA sequence(discussed in chapter 15). Other transcription factors thenbind, eventually forming a full transcription factor com-

plex able to capture RNA polymerase. In many instances,the transcription factor complex then phosphorylates thebound polymerase, disengaging it from the complex sothat it is free to begin transcription.

The binding of several different transcription factorsprovides numerous points where control over transcriptionmay be exerted. Anything that reduces the availability of aparticular factor (for example, by regulating the promoterthat governs the expression and synthesis of that factor) orlimits its ease of assembly into the transcription factorcomplex will inhibit transcription.


RepressorSilencer

Enhancer

Enhancer

Enhancer

Activator

ActivatorActivator

DNA

RNA polymerase

TATA-bindingprotein

Core promoter

A

BF

E H

250

110

4030

30

15060

80

ActivatorsThese regulatory proteins bind to DNA at distant sitesknown as enhancers. When DNA folds so that the enhancer is brought into proximity with the transcriptioncomplex, the activator proteins interact with the complexto increase the rate of transcription.

RepressorsThese regulatory proteins bind to "silencer" siteson the DNA, preventing the binding of activatorsto nearby enhancers and so slowing transcription.

Basal factorsThese transcription factors, in response tocoactivators, position RNA polymerase atthe start of a protein-coding sequence, andthen release the polymerase to transcribethe mRNA.

CoactivatorsThese transcription factors transmit signalsfrom activator proteins to the basal factors.

TATA box

Coding region

FIGURE 16.14The structure of a human transcription complex. The transcription complex that positions RNA polymerase at the beginning of ahuman gene consists of four kinds of proteins. Basal factors (the green shapes at bottom of complex with letter names) are transcriptionfactors that are essential for transcription but cannot by themselves increase or decrease its rate. They include the TATA-binding protein,the first of the basal factors to bind to the core promoter sequence. Coactivators (the tan shapes that form the bulk of the transcriptioncomplex, named according to their molecular weights) are transcription factors that link the basal factors with regulatory proteins calledactivators (the red shapes). The activators bind to enhancer sequences at other locations on the DNA. The interaction of individual basalfactors with particular activator proteins is necessary for proper positioning of the polymerase, and the rate of transcription is regulated bythe availability of these activators. When a second kind of regulatory protein called a repressor (the purple shape) binds to a so-called“silencer” sequence located adjacent to or overlapping an enhancer sequence, the corresponding activator that would normally have boundthat enhancer is no longer able to do so. The activator is thus unavailable to interact with the transcription complex and initiatetranscription.

Enhancers

A key advance in the evolution of eukaryotic gene tran-scription was the advent of regulatory proteins composedof two distinct modules, or domains. The DNA-bindingdomain physically attaches the protein to the DNA at aspecific site, using one of the structural motifs discussedearlier, while the regulatory domain interacts with otherregulatory proteins.

The great advantage of this modular design is that it un-couples regulation from DNA binding, allowing a regula-tory protein to bind to a specific DNA sequence at one siteon a chromosome and exert its regulation over a promoterat another site, which may be thousands of nucleotidesaway. The distant sites where these regulatory proteinsbind are called enhancers. Although enhancers also occurin exceptional instances in bacteria (figure 16.15), they arethe rule rather than the exception in eukaryotes.

How can regulatory proteins affect a promoter whenthey bind to the DNA at enhancer sites located far fromthe promoter? Apparently the DNA loops around so thatthe enhancer is positioned near the promoter. This bringsthe regulatory domain of the protein attached to the en-hancer into direct contact with the transcription factorcomplex attached to the promoter (figure 16.16).

The enhancer mode of transcriptional control that hasevolved in eukaryotes adds a great deal of flexibility to thecontrol process. The positioning of regulatory sites at adistance permits a large number of different regulatorysequences scattered about the DNA to influence a partic-ular gene.

Transcription factors and enhancers confer greatflexibility on the control of gene expression ineukaryotes.


NtrC (Activator) RNA polymerase

Promoter

Bacterial RNA polymerase is loosely bound to the promoter. The activator (NtrC) binds at the enhancer.

ADPDNA loops around sothat the activator comesinto contact with theRNA polymerase.

The activator triggers RNA polymerase activation, and transcription begins.DNA unloops.

mRNA synthesis

ATP

20 nm

Enhancer

FIGURE 16.15An enhancer in action. When the bacterial activator NtrC binds to an enhancer, it causes the DNA to loop over to a distant site whereRNA polymerase is bound, activating transcription. While such enhancers are rare in bacteria, they are common in eukaryotes.

Activator

Enhancersequence

Transcriptionfactor

RNA polymerase

Promoter Codingregionof gene

mRNA synthesis

FIGURE 16.16How enhancers work. The enhancer site is located far awayfrom the gene being regulated. Binding of an activator (red ) to theenhancer allows the activator to interact with the transcriptionfactors (green) associated with RNA polymerase, activatingtranscription.

The Effect of ChromosomeStructure on Gene RegulationThe way DNA is packaged into chromosomes can have aprofound effect on gene expression. As we saw in chapter 11,the DNA of eukaryotes is packaged in a highly compactform that enables it to fit into the cell nucleus. DNA iswrapped tightly around histone proteins to form nucleo-somes (figure 16.17) and then the strand of nucleosomes istwisted into 30-nm filaments.

Promoter Blocking by Nucleosomes

Intensive study of eukaryotic chromosomes has shownthat histones positioned over promoters block the assem-bly of transcription factor complexes. Therefore, tran-scription factors appear unable to bind to a promoterpackaged in a nucleosome. In this way, nucleosomes mayprevent continuous transcription initiation. On the otherhand, nucleosomes do not inhibit activators and RNApolymerase. The regulatory domains of activators at-tached to enhancers apparently are able to displace thehistones that block a promoter. In fact, this displacementof histones and the binding of activator to promoter arerequired for the assembly of the transcription factor com-plex. Once transcription has begun, RNA polymeraseseems to push the histones aside as it traverses the nucle-osome.

DNA Methylation

Chemical methylation of the DNA was once thought toplay a major role in gene regulation in vertebrate cells.The addition of a methyl group to cytosine creates 5-methylcytosine but has no effect on base-pairing withguanine (figure 16.18), just as the addition of a methylgroup to uracil produces thymine without affecting base-pairing with adenine. Many inactive mammalian genesare methylated, and it was tempting to conclude thatmethylation caused the inactivation. However, methyla-tion is now viewed as having a less direct role, blockingaccidental transcription of “turned-off ” genes. Verte-brate cells apparently possess a protein that binds to clus-ters of 5-methylcytosine, preventing transcriptional acti-vators from gaining access to the DNA. DNAmethylation in vertebrates thus ensures that once a geneis turned off, it stays off.

Transcriptional control of gene expression occurs ineukaryotes despite the tight packaging of DNA intonucleosomes.


(a)

Core complexof histones

DNA

Exterior histone

(b)

FIGURE 16.17Nucleosomes. (a) In the electron micrograph, the individualnucleosomes have diameters of about 10 nm. (b) In the diagram ofa nucleosome, the DNA double helix is wound around a corecomplex of eight histones; one additional histone binds to theoutside of the nucleosome, exterior to the DNA.

H

C

Cytosine 5-methylcytosine

MethylationC

N

C H H

C H

1 6

5

2

4

O

NH2 NH2

N

H

C

C

N

C

CH3C

O N

3

FIGURE 16.18DNA methylation. Cytosine is methylated, creating 5-methylcytosine. Because the methyl group is positioned to theside, it does not interfere with the hydrogen bonds of a GC base-pair.

Posttranscriptional Control inEukaryotesThus far we have discussed gene regulation entirely interms of transcription initiation, that is, when and howoften RNA polymerase starts “reading” a particular gene.Most gene regulation appears to occur at this point. How-ever, there are many other points after transcription wheregene expression could be regulated in principle, and all ofthem serve as control points for at least some eukaryoticgenes. In general, these posttranscriptional controlprocesses involve the recognition of specific sequences onthe primary RNA transcript by regulatory proteins or otherRNA molecules.

Processing of the Primary Transcript

As we learned in chapter 15, most eukaryotic genes have apatchwork structure, being composed of numerous short

coding sequences (exons) embedded within long stretchesof noncoding sequences (introns). The initial mRNA mole-cule copied from a gene by RNA polymerase, the primarytranscript, is a faithful copy of the entire gene, includingintrons as well as exons. Before the primary transcript istranslated, the introns, which comprise on average 90% ofthe transcript, are removed in a process called RNA pro-cessing, or RNA splicing. Particles called small nuclear ri-bonucleoproteins, or snRNPs (more informally, snurps), arethought to play a role in RNA splicing. These particles re-side in the nucleus of a cell and are composed of proteinsand a special type of RNA called small nuclear RNA, orsnRNA. One kind of snRNP contains snRNA that can bindto the 5´ end of an intron by forming base-pairs with com-plementary sequences on the intron. When multiplesnRNPs combine to form a larger complex called a spliceosome, the intron loops out and is excised (figure 16.19).

RNA splicing provides a potential point where the ex-pression of a gene can be controlled, because exons can be


snRNPs

ExonExon Intron

snRNA

Spliceosome

Exon Exon

Excisedintron

snRNA formsbase-pairs with5� end of intron.

Spliceosome andlooped intron form.

Exons are spliced;spliceosome disassembles.

Mature mRNA

5� end of intron is cut and attached near 3� end of intron, forming a lariat. The 3� end of the intron is then cut.

5�

5�

5�

5�

3�

3�

3�

3�

FIGURE 16.19How spliceosomes process RNA. Particles called snRNPs contain snRNA that interacts with the 5´ end of an intron. SeveralsnRNPs come together and form a spliceosome. As the intron forms a loop, the 5´ end is cut and linked to a site near the 3´ end of theintron. The intron forms a lariat that is excised, and the exons are spliced together. The spliceosome then disassembles and releasesthe mature mRNA.

spliced together in different ways, allowing a variety of dif-ferent polypeptides to be assembled from the same gene!Alternative splicing is common in insects and vertebrates,with two or three different proteins produced from onegene. In many cases, gene expression is regulated by chang-ing which splicing event occurs during different stages ofdevelopment or in different tissues.

An excellent example of alternative splicing in action isfound in two different human organs, the thyroid and thehypothalamus. The thyroid gland (see chapter 56) is re-sponsible for producing hormones that control processessuch as metabolic rate. The hypothalamus, located in thebrain, collects information from the body (for example, saltbalance) and releases hormones that in turn regulate the re-lease of hormones from other glands, such as the pituitarygland (see chapter 56). The two organs produce two dis-tinct hormones, calcitonin and CGRP (calcitonin gene-related peptide) as part of their function. Calcitonin is re-sponsible for controlling the amount of calcium we take upfrom our food and the balance of calcium in tissues likebone and teeth. CGRP is involved in a number of neuraland endocrine functions. Although these two hormones areused for very different physiological purposes, the hor-mones are made using the same transcript (figure 16.20).The appearance of one product versus another is deter-mined by tissue-specific factors that regulate the processingof the primary transcript. This ability offers another pow-erful way to control the expression of gene products, rang-ing from proteins with subtle differences to totally unre-lated proteins.

Transport of the Processed Transcript Outof the Nucleus

Processed mRNA transcripts exit the nucleus through thenuclear pores described in chapter 5. The passage of a tran-script across the nuclear membrane is an active process thatrequires that the transcript be recognized by receptors lin-ing the interior of the pores. Specific portions of the tran-script, such as the poly-A tail, appear to play a role in thisrecognition. The transcript cannot move through a pore aslong as any of the splicing enzymes remain associated withthe transcript, ensuring that partially processed transcriptsare not exported into the cytoplasm.

There is little hard evidence that gene expression is reg-ulated at this point, although it could be. On average, about10% of transcribed genes are exon sequences, but onlyabout 5% of the total mRNA produced as primary tran-script ever reaches the cytoplasm. This suggests that abouthalf of the exon primary transcripts never leave the nucleus,but it is not clear whether the disappearance of this mRNAis selective.

Selecting Which mRNAs Are Translated

The translation of a processed mRNA transcript by the ri-bosomes in the cytoplasm involves a complex of proteinscalled translation factors. In at least some cases, gene ex-pression is regulated by modification of one or more ofthese factors. In other instances, translation repressorproteins shut down translation by binding to the begin-ning of the transcript, so that it cannot attach to the ribo-some. In humans, the production of ferritin (an iron-storing protein) is normally shut off by a translationrepressor protein called aconitase. Aconitase binds to a 30-nucleotide sequence at the beginning of the ferritinmRNA, forming a stable loop to which ribosomes cannotbind. When the cell encounters iron, the binding of iron toaconitase causes the aconitase to dissociate from the ferritinmRNA, freeing the mRNA to be translated and increasingferritin production 100-fold.


MaturemRNA

Splicingpathway 2(thyroid)

Splicingpathway 1

(hypothalamus)

CGRPpeptide

CGRP

CGRP

D CB

A B CD Calcitonin

CalcitoninB CD

PrimaryRNA

transcript

MaturemRNA

Calcitoninpeptide

FIGURE 16.20Alternative splicing products. The same transcript made fromone gene can be spliced differently to give rise to two very distinctprotein products, calcitonin and CGRP.

Selectively Degrading mRNA Transcripts

Another aspect that affects gene expression is the stabilityof mRNA transcripts in the cell cytoplasm (figure 16.21).Unlike bacterial mRNA transcripts, which typically have ahalf-life of about 3 minutes, eukaryotic mRNA transcriptsare very stable. For example, β-globin gene transcripts havea half-life of over 10 hours, an eternity in the fast-movingmetabolic life of a cell. The transcripts encoding regulatoryproteins and growth factors, however, are usually much lessstable, with half-lives of less than 1 hour. What makesthese particular transcripts so unstable? In many cases, theycontain specific sequences near their 3′ ends that makethem attractive targets for enzymes that degrade mRNA. Asequence of A and U nucleotides near the 3′ poly-A tail of atranscript promotes removal of the tail, which destabilizesthe mRNA. Histone transcripts, for example, have a half-life of about 1 hour in cells that are actively synthesizingDNA; at other times during the cell cycle, the poly-A tail islost and the transcripts are degraded within minutes. OthermRNA transcripts contain sequences near their 3′ ends thatare recognition sites for endonucleases, which causes thesetranscripts to be digested quickly. The short half-lives ofthe mRNA transcripts of many regulatory genes are criticalto the function of those genes, as they enable the levels ofregulatory proteins in the cell to be altered rapidly.

An Example of a Complex Gene Control System

Sunlight is an important gene-controlling signal for plants,from germination to seed formation. Plants must regulatetheir genes according to the presence of sunlight, the qual-ity of the light source, the time of day, and many other en-vironmental signals. The combination of these responsesculminate in the way the genes are regulated, such as thegenes cab (a chlorophyll-binding photosynthetic protein)and rbcS (a subunit of a carbon-fixing enzyme). For in-stance, photosynthesis-related genes tend to express earlyin the day, to carry out photosynthesis, and begin to shutdown later in the day. Expression levels may also be regu-lated according to lighting conditions, such as cloudy daysversus sunny days. When darkness arrives, the transcriptsmust be degraded in preparation for the next day. This isan example of how complex a gene control system can be,and scientists are just beginning to understand parts of sucha complicated system.

Although less common than transcriptional control,posttranscriptional control of gene expression occurs ineukaryotes via RNA splicing, translation repression, andselective degradation of mRNA transcripts.


operon A cluster of functionally relatedgenes transcribed into a single mRNA mol-ecule. A common mode of gene regulationin prokaryotes, it is rare in eukaryotes otherthan fungi.promoter A site upstream from a gene towhich RNA polymerase attaches to initiatetranscription.repressor A protein that regulates tran-scription by binding to the operator and sopreventing RNA polymerase from initiatingtranscription from the promoter.RNA polymerase The enzyme that tran-scribes DNA into RNA.transcription The RNA polymerase-catalyzed assembly of an RNA moleculecomplementary to a strand of DNA.translation The assembly of a polypep-tide on the ribosomes, using mRNA to di-rect the sequence of amino acids.

exon A segment of eukaryotic DNA thatis both transcribed into mRNA and trans-lated into protein. Exons are typically scat-tered within much longer stretches of non-translated intron sequences.intron A segment of eukaryotic DNA thatis transcribed into mRNA but removed be-fore translation.nonsense codon A codon (UAA, UAG, orUGA) for which there is no tRNA with a complementary andicodon; a chain-terminating codon often called a “stop” codon.operator A site of negative gene regula-tion; a sequence of nucleotides near orwithin the promoter that is recognized by arepressor. Binding of the repressor to theoperator prevents the functional binding ofRNA polymerase to the promoter and soblocks transcription.

activator A regulatory protein that pro-motes gene transcription by binding toDNA sequences upstream of a promoter.Activator binding stimulates RNA poly-merase activity.anticodon The three-nucleotide sequenceon one end of a tRNA molecule that iscomplementary to and base-pairs with anamino acid–specifying codon in mRNA.codon The basic unit of the genetic code;a sequence of three adjacent nucleotides inDNA or mRNA that codes for one aminoacid or for polypeptide termination.

A Vocabulary ofGene Expression


Aminoacid

Completedpolypeptide

Cytoplasm

tRNA

Ribosome movestoward 3� end

Ribosome

Nuclearmembrane

Nuclearpore

Smallribosomalsubunit

Cap

Largeribosomalsubunit

mRNA

mRNA

5�

5�

5�

5�

5�

3�

3�

3�

3�

3�

3�

Poly-Atail

Exons

Introns

RNApolymerase

DNA

Cap

Poly-Atail

Exon splicing. Gene expressioncan be controlled by altering therate of splicing in eukaryotes.

Post-translational modification.

Phosphorylation or otherchemical modificationscan alter the activity of aprotein after it is produced.

6.

Protein synthesis. Many proteins take part in the translation process, and

regulation of the availability ofany of them alters the rate ofgene expression by speedingor slowing protein synthesis.

5.

Initiation of transcription. Most control of gene

expression is achieved byregulating the frequency oftranscription initiation.

1.

2.

Destruction of the transcript.

Many enzymesdegrade mRNA, andgene expression canbe regulated bymodulating the degreeto which the transcriptis protected.

4.

Passage through the nuclear membrane. Gene expression can be regulated

by controlling access to or efficiencyof transport channels.

3.

PrimaryRNA transcript

PO4

PO4

FIGURE 16.21Six levels where gene expression can be controlled in eukaryotes.


Chapter 16Summary Questions Media Resources

16.1 Gene expression is controlled by regulating transcription.

• Regulatory sequences are short stretches of DNA thatfunction in transcriptional control but are nottranscribed themselves.

• Regulatory proteins recognize and bind to specificregulatory sequences on the DNA.

1. How do regulatory proteinsidentify specific nucleotidesequences without unwindingthe DNA?

• Regulatory proteins possess structural motifs thatallow them to fit snugly into the major groove ofDNA, where the sides of the base-pairs are exposed.

• Common structural motifs include the helix-turn-helix, homeodomain, zinc finger, and leucine zipper.

2. What is a helix-turn-helixmotif? What sort ofdevelopmental events arehomeodomain motifs involvedin?

16.2 Regulatory proteins read DNA without unwinding it.

• Many genes are transcriptionally regulated throughrepressors, proteins that bind to the DNA at or nearthe promoter and thereby inhibit transcription of thegene.

• Genes may also be transcriptionally regulatedthrough activators, proteins that bind to the DNAand thereby stimulate the binding of RNApolymerase to the promoter.

• Transcription is often controlled by a combination ofrepressors and activators.

3. Describe the mechanism bywhich the transcription of trpgenes is regulated in Escherichiacoli when tryptophan is presentin the environment.4. Describe the mechanism bywhich the transcription of lacgenes is regulated in E. coli whenglucose is absent but lactose ispresent in the environment.

16.3 Bacteria limit transcription by blocking RNA polymerase.

• In eukaryotes, RNA polymerase cannot bind to thepromoter unless aided by a family of transcriptionfactors.

• Anything that interferes with the activity of thetranscription factors can block or alter geneexpression.

• Eukaryotic DNA is packaged tightly in nucleosomeswithin chromosomes. This packaging appears toprovide some inhibition of transcription, althoughregulatory proteins and RNA polymerase can stillactivate specific genes even when they are sopackaged.

• Gene expression can also be regulated at theposttranscriptional level, through RNA splicing,translation repressor proteins, and the selectivedegradation of mRNA transcripts.

5. How do transcription factorspromote transcription ineukaryotic cells? How do theenhancers of eukaryotic cellsdiffer from most regulatory siteson bacterial DNA?6. What role does themethylation of DNA likely playin transcriptional control?7. How does the primary RNAtranscript of a eukaryotic genediffer from the mRNA transcriptof that gene as it is translated inthe cytoplasm?8. How can a eukaryotic cellcontrol the translation of mRNAtranscripts after they have beentransported from the nucleus tothe cytoplasm?

16.4 Transcriptional control in eukaryotes operates at a distance.

http://www.mhhe.com/raven6e http://www.biocourse.com

• Exploration: Generegulation

• Student Research:Heat Shock Proteins

• Art Activity: The lacoperon

• Regulation of E.coli lacoperon

• Regulation of E.colitrp operon

• Gene Regulation

• Exploration: ReadingDNA

chapter 16: control of gene expression

Documents