Chapter 14 Chapter 14 Huntington’s Disease Huntington’s Disease

Imprinting and Genetic Imprinting and Genetic AnticipationAnticipation

History of Huntington’s DiseaseHistory of Huntington’s Disease 1630, 3 men escaped to 1630, 3 men escaped to

AmericaAmerica Wilke, Nichols, and Jeffers Wilke, Nichols, and Jeffers Families had been Families had been

persecuted for witchcraftpersecuted for witchcraft

One man settled in the One man settled in the Hampton’s(NY)Hampton’s(NY) Offspring were notorious Offspring were notorious

for a strange and for a strange and frightening diseasefrightening disease

Initial SymptomsInitial Symptoms IrritabilityIrritabilityClumsinessClumsinessDepressionDepressionForgetfulnessForgetfulnessMood and personality changesMood and personality changesUncontrollable movementsUncontrollable movementsHard to swallowHard to swallow

George HuntingtonGeorge Huntington

Huntington’s had 3 Huntington’s had 3 generations of doctorsgenerations of doctors

Youngest was George Youngest was George Huntington JrHuntington Jr

Made rounds via Made rounds via horseback with fatherhorseback with father

1872, George Huntington 1872, George Huntington Jr wrote a paper “Jr wrote a paper “ On On Chorea”Chorea”

ChoreaChorea ChoreaChorea means to dancemeans to dance ““dancing disorder”dancing disorder”

Uncontrollable jerking and Uncontrollable jerking and movingmoving

People were thought to be People were thought to be possessed by devilspossessed by devils

One of the “witches” executed One of the “witches” executed in Salem, MA had in Salem, MA had Huntington’s diseaseHuntington’s disease

Ex. Wilke’s ChildrenEx. Wilke’s Children One of the 3 original British One of the 3 original British

men who fled to Americamen who fled to America Professional carpenter w/ 7 Professional carpenter w/ 7

childrenchildren Son marries Elizabeth Warne Son marries Elizabeth Warne

who returns to England, tried who returns to England, tried as a witch as a witch child with strange convulsions) child with strange convulsions) Elizabeth's child is tried as the Elizabeth's child is tried as the

"Groton Witch" "Groton Witch"

http://www.medinfo.ufl.edu/other/histmed/okun/slide27.html

Huntington’s DiseaseHuntington’s DiseaseCaused by a dominant geneCaused by a dominant gene

Diagnosed 35-60 years oldDiagnosed 35-60 years oldAverage age of onset=40 yearsAverage age of onset=40 years

ProgressiveProgressiveContinually getting worseContinually getting worse

No remissionNo remissionNo breaks or getting betterNo breaks or getting better

ALWAYS fatalALWAYS fatalUsually only 20 more years after diagnosisUsually only 20 more years after diagnosis

Interesting WeirdnessInteresting Weirdness Maternal AlleleMaternal Allele

If you inherit huntingtons If you inherit huntingtons allele from momallele from mom

Normal onset(35-50 years)Normal onset(35-50 years) Paternal Allele:Paternal Allele:

If you inherit huntingtons If you inherit huntingtons allele from dadallele from dad

You show symptoms at You show symptoms at earlier ageearlier age

Thanks a lot dad!!!Thanks a lot dad!!!

MOMMOMH hH h

DAD hDAD h Hh hhHh hh hh Hh hhHh hh normal onsetnormal onset

MOMMOMh hh h

DAD HDAD H Hh HhHh Hh hh hh hhhh hh show symptoms earliershow symptoms earlier

Genomic ImprintingGenomic Imprinting In some diseases, it matters which parent In some diseases, it matters which parent

gave you the gene!!!gave you the gene!!!A mysterious phenomenaA mysterious phenomena

We still don’t fully understand itWe still don’t fully understand it

Genomic ImprintingGenomic ImprintingAt least 100 genes are imprintedAt least 100 genes are imprintedYou must re-imprint genes from you You must re-imprint genes from you

parents before you pass them on to your parents before you pass them on to your childrenchildren

Another weird thing about Another weird thing about Huntington’s DiseaseHuntington’s Disease

Example of anticipationExample of anticipationSymptoms start showing up earlier in Symptoms start showing up earlier in

familiesfamiliesGenetic anticipationGenetic anticipation

Genetic Anticipation in Huntington’s Genetic Anticipation in Huntington’s DiseaseDisease

DNA has regions of repeating sequencesDNA has regions of repeating sequencesTrinucleotide repeatsTrinucleotide repeats

Makes gene more and more unstableMakes gene more and more unstableEx. Ex. CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG or or TCGTCGTCGTCGTCGTCGTCGTCGTCGTCTTCGTCGTCGTCGTCGTCGTCGTCGTCGTCT

CAG repeats CAG repeats Huntington’s is caused by tooHuntington’s is caused by too much repeatsmuch repeats End of chromosome 4End of chromosome 4

CAG repeatsCAG repeats Normal gene has 11-34 copies of CAGNormal gene has 11-34 copies of CAG Mutation increases it to more than 37Mutation increases it to more than 37 In HD, Passing on chromosome 4 In HD, Passing on chromosome 4

Increases # of repeatsIncreases # of repeatsSymptoms start showing earlierSymptoms start showing earlier