cell metabolism article - unifr.ch · pdf filetary cues were controlled in humans, nitrogen...
TRANSCRIPT
![Page 1: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/1.jpg)
Cell Metabolism
Article
Klf15 Orchestrates Circadian Nitrogen HomeostasisDarwin Jeyaraj,1,4 Frank A.J.L. Scheer,5,10 Jurgen A. Ripperger,6,10 Saptarsi M. Haldar,1 Yuan Lu,1
Domenick A. Prosdocimo,1 Sam J. Eapen,1 Betty L. Eapen,1 Yingjie Cui,1 Ganapathi H. Mahabeleshwar,1
Hyoung-gon Lee,2Mark A. Smith,2 GemmaCasadesus,3 EricM.Mintz,7 Haipeng Sun,8 YibinWang,8 KathrynM. Ramsey,9
Joseph Bass,9 Steven A. Shea,5 Urs Albrecht,6 and Mukesh K. Jain1,*1Case Cardiovascular Research Institute, Harrington Heart and Vascular Institute, Department of Medicine2Department of Pathology3Department of Neurosciences4Heart and Vascular Research Center, MetroHealth Campus CaseWestern Reserve University, Cleveland, OH 44106, USA5Division of Sleep Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA6Department of Medicine, Division of Biochemistry, University of Fribourg, 1700 Fribourg, Switzerland7Department of Biological Sciences, Kent State University, Kent, OH 44242, USA8Department of Anesthesia, UCLA, Los Angeles, CA 90095, USA9Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA10These authors contributed equally to this work.*Correspondence: [email protected] 10.1016/j.cmet.2012.01.020
SUMMARY
Diurnal variation in nitrogen homeostasis is observedacross phylogeny. But whether these are endoge-nous rhythms, and if so, molecular mechanismsthat link nitrogen homeostasis to the circadian clockremain unknown. Here, we provide evidence that aclock-dependent peripheral oscillator, Kruppel-likefactor 15 transcriptionally coordinates rhythmic ex-pression of multiple enzymes involved in mammaliannitrogen homeostasis. In particular, Kruppel-likefactor 15-deficientmice exhibit no discernable aminoacid rhythm, and the rhythmicity of ammonia to ureadetoxification is impaired. Of the external cues,feeding plays a dominant role in modulating Krup-pel-like factor 15 rhythm and nitrogen homeostasis.Further, when all behavioral, environmental and die-tary cues were controlled in humans, nitrogenhomeostasis exhibited an endogenous circadianrhythmicity. Thus, in mammals, nitrogen homeo-stasis exhibits circadian rhythmicity, and is orches-trated by Kruppel-like factor 15.
INTRODUCTION
Despite its abundance in the earth’s atmosphere, mammalscannot freely assimilate nitrogen and are dependent on ingestionof amino acids (AAs). Nitrogen fixation is an elementary biolog-ical process through which microorganisms that exist in theroots of leguminous plants convert atmospheric nitrogen toammonia. Thus, plants serve as the major source of AAs formammalian organisms. Accordingly, AAs in organisms aretermed essential (diet-dependent) or nonessential (synthesizedfrom other essential AAs in vivo). In addition to serving asbuilding blocks of proteins, AAs are critical for diverse biological
functions, including gluconeogenesis, hormone synthesis,nutrient signaling, neurotransmission, and embryonic stem-cellgrowth (Wang et al., 2009; Wu, 2009). Following utilization ofAAs, organisms also face the burden of detoxifying the by-prod-ucts (i.e., converting ammonia to urea) (Morris, 2002). The impor-tance of this homeostatic process is perhaps best demonstratedin congenital disorders of AA metabolism/ammonia detoxifica-tion that often present with dysfunction of multiple organsystems, particularly cognitive impairment (Gropman et al.,2007). Recent studies have also shed light on a potentially directpathogenic role for AAs. Interestingly, supplementation ofessential AAs significantly reduced survival in Drosophila (Gran-dison et al., 2009), whereas supplementation of branched chainAAs (BCAA) enhanced survival in mice (D’Antona et al., 2010).Thus, organisms face a delicate task of imbibing and metabo-lizing AAs, and imbalance alters survival.The behavior, activity, and survival of organisms are influ-
enced by the 24-hr rotation of the earth on its axis (Foster andRoenneberg, 2008). Studies over the last two decades haveidentified components of the endogenous core clock machinery(CCM) that govern 24-hr rhythms even in the absence of externalcues (e.g., light) (Reppert and Weaver, 2002). The CCM exists inthe central circadian pacemaker in the hypothalamus and thesuprachiasmatic nucleus, as well as in most peripheral cells,and consists of a series of positive and negative feedback loopsgenerated by the basic helix-loop-helix family of transcriptionfactors Clock and Bmal1, the Period and Cryptochrome families,and the nuclear receptors Reverba and Rora (Ko and Takahashi,2006). The CCM in the suprachiasmatic nucleus is entrained bycues, such as light exposure, and acts via neural and endrocrinesignals to appropriately synchronize the CCM in peripheraltissues (Dibner et al., 2010). However, circadian timing in periph-eral tissues many also be affected by other factors, such asrhythmic feeding and temperature (Dibner et al., 2010). Multiplelines of evidence identify the CCM as centrally involved in regu-lating metabolic homeostasis, particularly with respect toglucose and lipid levels (Duez and Staels, 2008; Green et al.,2008; Lamia et al., 2008; Le Martelot et al., 2009; Marcheva
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 311
![Page 2: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/2.jpg)
et al., 2010; Rudic et al., 2004; Turek et al., 2005; Yin et al., 2007).A relationship of the CCM to AA utilization and excretion (i.e.,nitrogen homeostasis) remains unknown.
Interestingly, several aspects of nitrogen flux acrossphylogeny occur in a diurnal fashion. The first process of nitrogenfixation in diazotrophs is highly diurnal due to the oscillatorypattern of nitrogenase activity (Balandreau et al., 1974; Wheeler,1969). As a consequence, AA concentration in the leaves ofplants exhibit diurnal variation (Bauer et al., 1977). Intriguingly,studies from humans and rodents more than five decades agoreported diurnal variation in plasma levels of AAs that is modu-lated by changes in diet (Feigin et al., 1967, 1969; Fernstromet al., 1979). Further, recent unbiased metabolite analyses inyeast and mice determined that AAs and urea-cycle inter-mediates exhibit oscillatory behavior (Minami et al., 2009; Tuet al., 2007). In addition, screening of the hepatic proteomerevealed rhythmicity of AA metabolic enzymes and urea cycleenzymes (Reddy et al., 2006). However, the molecular mecha-nisms that control these diurnal rhythms and determine whethernitrogen homeostasis exhibits true endogenous circadian rhyth-micity (i.e., oscillation in the absence of external cues) remainunknown.
Kruppel-like factors belong to the zinc-finger family of tran-scription factors and are implicated in coordinating numerousbiological processes from pluripotency to carcinogenesis(McConnell and Yang, 2010). Our laboratory previously demon-strated that Kruppel-like factor 15 (Klf15) regulates glucosehomeostasis through effects on AA metabolism (Gray et al.,2007). Subsequent genome-wide microarray analyses of muscleand liver tissues identified additional targets of Klf15 as beinginvolved in AA metabolism. Thus, we hypothesized that Klf15may be involved in regulating the rhythmic utilization of AAs. Inthe present study we demonstrate that nitrogen homeostasisexhibits 24-hr periodicity in mice and humans. Further, we iden-tify Klf15 as a clock-dependent peripheral regulator of rhythmicAA utilization and excretion of AAs.
RESULTS
Klf15 Expression Exhibits 24-Hour PeriodicityAs a first step, we examined whether Klf15 expression itselfwas rhythmic. Wild-type (WT) mice were sacrificed every 4 hrunder light/dark (L/D) or constant dark (D/D) conditions for24 hr. Klf15 expression exhibits rhythmic oscillation in severalperipheral organs, including liver and skeletal muscle, underboth conditions (Figures 1A, 1B, 1C, S1A, available on line,and S1B), confirming the notion that Klf15 expression isrhythmic. As next steps, we examined whether the CCM medi-ates Klf15 rhythmicity in peripheral organs and also, how thisoccurs. Examination of the regulatory region of Klf15 identifiedfour E-box binding motifs (Figure 1D, inset), and CLOCK/BMAL1 induced Klf15 in a dose-dependent manner in hepato-cyte cell lines (Figure 1D). Consistent with this observation,Klf15 rhythmic variation was abrogated in Bmal1 null livers (Fig-ure 1E). Further, Klf15 rhythmicity was also abrogated in liversof several CCM mutant mouse lines, including Per2/Cry1 KO,Per1/2 KO, and Reverba KO (Figures S1C and S1D). Finally,chromatin immunoprecipitation (ChIP) revealed rhythmic occu-pancy of Bmal1 on the Klf15 promoter (Figure 1F). These data
support a direct role for the CCM in orchestrating the 24-hrperiodicity of Klf15.
Nitrogen Homeostasis Exhibits 24-Hour Periodicityin MiceIn addition to daily rhythms in Klf15, we next examined whetherAA utilization and excretion also oscillate. WT mice were placedin constant darkness for 38 hr (D/D), after which plasma wascollected every 4 hr for the following 24 hr. Interestingly, the totalAA pool, as well as major circulatory AAs (e.g., alanine andBCAAs exhibited 24-hr rhythms in constant darkness) (Figures2A, 2B, and 2C). Further, the detoxified excretory product ofnitrogeneous waste (i.e., urea) also oscillates with similar 24-hrperiodicity) (Figure 2D). Of the 20 AAs, 14 were rhythmic underD/D, as detailed in Table S1. Thus, nitrogen homeostasis inmice exists with a 24-hr periodicity even under constant en-vironmental conditions.
Klf15 Regulates Rhythmic Amino Acid UtilizationNext, the effect of Klf15 proficiency and deficiency on nitrogenhomeostasis was assessed under L/D over a 24-hr period.Because mammals are dependent on diet for essential AAs,we first assessed the cumulative and total food intake over24 hr. The cumulative food intake (measured every 5 min, Fig-ure 2E) and aggregate food consumed over 24 hr (Figure S2A)were nearly identical in WT and Klf15 null mice. Consistentwith this observation, the total body weights of Klf15 null micewere similar to their WT counterparts (Figure 2F). Further, thefree running period under constant-dark and constant-lightconditions were similar between WT and Klf15 null mice (FiguresS2B and S2C). Interestingly, the hepatic expression of oscillationof several components of the CCM was preserved in the Klf15-deficient state (Figure S2D). However, a marked alteration inboth the absolute levels and rhythmicity of the total AA pooland urea were observed in Klf15 null mice (Figures 3G and 3H).A detailed analysis of each individual AA is provided in TableS1. Collectively, these observations identify Klf15 as an essentialregulator of rhythmic nitrogen homeostasis.We next sought to elucidate the molecular basis for the non-
rhythmic nitrogen homeostasis in the Klf15-deficient state. Inmammals, the liver and skeletal muscles are centrally involvedin coordinating nitrogen homeostasis. During the daily feed/fast rhythms, the glucose-alanine cycle serves two mainpurposes: 1) supplying carbon skeletons to the liver to sustainglucose levels, and 2) facilitating transport and elimination ofnitrogenous waste (Felig, 1975). During the fed state, whenglucose is freely available, skeletal muscle oxidizes glucose togenerate pyruvate, which is transaminated by alanine transami-nase (Alt) to produce alanine (Figure 3 schematic) (Felig, 1975).Further, in the postabsorptive state, carbons generated frombreakdown of muscle AAs are the principal precursors forhepatic gluconeogenesis. Because BCAA comprise 35% of theessential AAs in muscle (Harper et al., 1984), they are majordonors of carbon and dispose their nitrogen through theglucose-alanine cycle. The skeletal muscle mitochondrialbranched-chain transaminase (Bcat2) is the first step in BCAAcatabolism and converts BCAA to glutamate and a-keto acids(Harper et al., 1984). The glutamate is subsequently utilized byAlt in skeletal muscle to synthesize alanine. The alanine spills
Cell Metabolism
Circadian Nitrogen Homeostasis
312 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 3: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/3.jpg)
into the circulation, is absorbed by the liver, and ultimately do-nates its carbons for gluconeogenesis and its nitrogen for ureasynthesis (Figure 3 schematic). Intriguingly, the expressionpatterns of Alt, Bcat2 in skeletal muscle and Alt in liver of WTmice were found to exhibit robust diurnal rhythms, an effectthat was abrogated in both tissues with Klf15-deficiency (Figures
3A, 3B,and S3A). Consistent with this defect, skeletal muscleand liver concentrations of alanine and glutamate were reduced,and BCAA was significantly increased (Figure S3A). Conse-quently, plasma alanine was reduced without rhythmicity (Fig-ure 3C), whereas plasma BCAA was persistently increased withabnormal rhythmicity in Klf15 null mice (Figure 3D). An important
1
1.4
1.8
2.2
2 6 10 14 18 22
Wildtype livers (mRNA)
CT
AKlf15
rela
tive
fold
B
C
FE
KLF15
U2AF65
2 6 10 14 18 22 CT
* p<0.050.5
1
1.5
2
2.5 Wildtype livers (protein)
rela
tive
fold
KLF15
rela
tive
fold
0 1 2 3 4 5 6 7 8
0 4 8 12 16 20 CT Bmal1-null
Bmal1 ChIP on Klf15 promoter
rela
tive
enric
hmen
t
0
1
2
3
4
5 Klf15-luc
pcDNA Clock/Bmal1(0.1 µg each)
Clock/Bmal1(0.3 µg each)
rela
tive
luci
fera
se a
ctiv
ity
*
*
Klf15
0
1
2
3
4
2 6 10 14 18 22 CT 10 22 Wildtype Bmal1-null
* *
* WT vs Bmal1-null, P<0.01
D
2 6 10 14 18 22CT
Bmal1-null livers
ATG
Exon 2Exon 1 Intron 15’ UTR
E-box
Primers for Bmal1 ChIP
Figure 1. Klf15 Exhibits 24-hr Periodicity and Is Driven by the Core Clock Machinery(A) Klf15 mRNA accumulation from WT mice livers (n = 5 per time point).
(B) Representative KLF15 and U2AF65 protein expression from WT and Klf15 null liver nuclei.
(C) KLF15 protein densitometry from three replicates.
(D) Klf15-luciferase is induced in a dose-dependent fashion by CLOCK/BMAL1; inset illustrates four E-Box motifs in the Klf15 promoter (!5 kb).
(E) Klf15 mRNA accumulation in WT and Bmal1 KO livers.
(F) Rhythmic binding of BMAL1 on the Klf15 promoter (n = 3 per time point). Data presented as mean ± SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 313
![Page 4: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/4.jpg)
consequence of impaired alanine availability was persistentlylow glucose in Klf15 null mice (Figure 3E). This occurred despitecompensatory adaptive changes in several hepatic gluconeo-genic enzymes (Glut2, Pepck, Pfkfbp2, and G6PC, Figure S3B),insulin, and glucagon (Figure S3B). Next, to examine whetherAlt and Bcat2 were direct transcriptional targets for Klf15, weutilized gain-of-function studies and ChIP. Adenoviral overex-pression of Klf15 induced Alt in hepatocytes and Alt, Bcat2 inskeletal myotubes (Figure S3C). Further, AA analysis of cell-culture supernatant from Klf15 overexpressing hepatocytes re-
vealed reduced alanine and increased glutamate concentrations(Figure S3C). Examination of the Alt promoter region identifiedconserved consensus DNA-binding sites for Kruppel-like factorsC(A/T)CCC (Miller and Bieker, 1993) (Figure S3D). Finally, ChIPanalysis of WT livers over a circadian period identified rhythmicenrichment of KLF15 on the Alt promoter (Figures 3f and S3D).
Klf15 Regulates Rhythmic Urea SynthesisThe final common pathway in liver for detoxification of nitroge-nous waste occurs through glutamate, the major nitrogen donor
Total amino acids
Urea
µM/L
µM/L
CTD/D 2 6 10 14 18 22 2 6 10 14 18 22
2250
2500
2750
3000
3250
8000
9000
10000
11000
12000
13000
ANOVA p=0.01
ANOVA p=0.02
400
500
600
700
800 200
300
400
500 Alanine
BCAA
µM/L
µM/L
ANOVA p=0.01
ANOVA p=0.01
Cumulative food Intake
0
1
2
3
4
5
WTKlf15-null
gram
s
ZT0-12 ZT12-24
3000
4000
5000
6000
2 6 10 14 18 22 2 6 10 14 18 22
4000
6000
8000
10000
12000
Total amino acids
Urea
2 6 10 14 18 22 2 6 10 14 18 22
µM/L
µM/L
p<0.05 at all time points
WT vs. Klf15-null p<0.05 at all time points except * p=0.06
Klf15-null ANOVA p=NS
WT ANOVA p<0.05
**
0
10
20
30
WT Klf15-null
Total Body Weight
gram
s
p=NS
E F
G
H
WT ANOVA p<0.05Klf15-null ANOVA p<0.05
A
B
C
D
Figure 2. Nitrogen Homeostasis Exhibits 24-Hour Periodicity, Driven by Klf15, in Mice(A–D) Plasma total AA pool, alanine, BCAA, and ureameasured every four hours over a circadian period after placingmice in constant darkness for 38 hr (n = 5 per
time point). The data are double-plotted, and ANOVA was used to determine rhythmicity.
(E) Cumulative food intake measured every 5 min in WT and Klf15 null mice (n = 4 per group).
(F) Total body weights of WT and Klf15 null mice (n = 4 per group).
(G and H) Plasma total AA pool, urea fromWT and Klf15 null mice measured every 4 hr under L/D and double-plotted to illustrate rhythmicity (n = 5 per group per
time point). Data presented as mean ± SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
314 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 5: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/5.jpg)
for ammonia (Brosnan and Brosnan, 2009). Surprisingly, despitereduced plasma glutamate in Klf15 null mice (Figure 4A), theplasma ammonia levels were increased (Figure 4B). This led
us to examine expression of the hepatic urea-cycle enzymes.The urea cycle (Figure 4 schematic) is responsible for detoxifica-tion of ammonia to urea and occurs predominantly in the
100
120
140
160
**
*
*
Glucose
mg/
dl
2 6 10 14 18 22
AA utilization and nitrogen transport “glucose-alanine cycle”
500
750
1000
1250
1500 BCAA
µM/L
A
Alanine
300
400
500
600
*
*
**
2 6 10 14 18 22 2 6 10 14 18 22
µM/L
BWTKLF15-null
0.4
0.8
1.2
1.6
2 Bcat2re
lativ
e fo
ld
*
0.4
0.8
1.2
1.6
* *
2 6 10 14 18 22 ZT
rela
tive
fold
AltSkeletalmuscle
E
C D
F
ZT
2 6 10 14 18 22 ZT
ZT
ZT 0.75
1
1.25
1.5
KLF15 ChIP on Alt promoter
fold
enr
ichm
ent
2 6 10 14 18 22 CT
1.75
ANOVA p<0.05
Skeletalmuscle
BCAA
Alt
alanine
pyruvate glutamate
! ketoglutarate
glucoseX
pyruvate
alanine
glucose
Bcat2
glutamateAlt
! ketoacid
XX
NH3
NH3
NH3
NH3
NH3
XKlf15-null
WT vs. Klf15-null p"0.05 at all time points* WT vs. Klf15-null p"0.05
WT vs. Klf15-null p"0.05 at all time points
* WT vs. Klf15-null p"0.05
* WT vs. Klf15-null p"0.05
Figure 3. Klf15 Regulates Rhythmic Amino Acid UtilizationSchematic illustrates the interorgan transport and utilization of AAs (i.e., the glucose-alanine cycle).
(A and B) Skeletal muscle Alt and Bcat2 expression in WT and KLF15 null mice (n = 4 per group per time point).
(C and D) Plasma alanine and BCAA in WT and Klf15 null mice (n = 5 per group per time point).
(E) Plasma glucose in WT and Klf15 null mice (n = 5 per group per time point).
(F) ChIP for KLF15 on Alt promoter (n = 3 per time point). (# p < 0.05 at all time points between WT and Klf15 null). Data presented as mean ± SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 315
![Page 6: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/6.jpg)
mammalian liver (Morris, 2002). Interestingly, the expression ofornithine transcarbamylase (Otc), a hepatic mitochondrial urea-cycle enzyme was markedly reduced and devoid of rhythmicityin Klf15 null mice (Figure 4C). In contrast, the 24-hr periodicityof expression of other urea-cycle enzymes (Cps1, Asl, Ass, and
Arg1) was either unchanged or increased with Klf15 deficiency(Figure S4A). Importantly, OTC enzymatic activity from KLF15null hepatic mitochondrial extracts was reduced to" 6% of theirWT counterparts (Figure 4E). Consistent with this defect,plasma/tissue concentrations of ornithine were markedly
Alt
alanine
pyruvate glutamate
! ketoglutarate
glucose
NH3
Cps1
carbamoyl phosphate
HCO3-
ornithine
citrulline
arginosuccinate
arginine
Otc Ass
AslArg1
urea
Urea Cycle
X
X
OC NH2NH2
NH3
NH3
Disposal of nitrogen “urea cycle”
0
0.5
1
1.5
rela
tive
fold
2 6 10 14 18 22 25
50
75
100 Plasma ornithine
µM/L *
* *
*
2 6 10 14 18 22
0.5
0.75
1
1.25
1.5
1.75 KLF15 ChIP on Otc promoter
2 6 10 14 18 22
Otc (liver)
fold
enr
ichm
ent
C D
ZT ZT
CT
ANOVA p<0.01
100
200
300
400
10
15
20
25
30
35
µM/L
Plasma glutamate
*
*
**
*
A
2 6 10 14 18 22 ZT
WT Klf15-null
2 6 10 14 18 22 ZT
0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0
5
10
15
20
25 Urine ureaUrine ammonia
M/L
p=0.008p=0.04
mM
/L
0 2 4 6 8
10 12 14 16 18
Citr
ullin
e sy
nthe
sis
µM/m
in p
er m
g OTC activity
p<0.001
µM/L
Plasma ammoniaB
E F G H
WT Klf15
-null WT Klf15
-null WT Klf15
-null
** *
* *
XKlf15-null
0
10
20
30
40
50
60
70
80
WT Klf15-null
p<0.05
% A
ltern
atio
n be
havi
or
Y - Maze
cognitive dysfunction
I
0
10
20
30
40
50
60
Day 1 Day 2 Day 3 Day 4
Dur
atio
n to
pla
tform
(sec
onds
) WT Klf15-null
Morris Water Maze
p<0.05 p=0.06
K
0
10
20
30
40
50
WT WT WT
Context Altered Context Cued
% F
reez
e p<0.05
Fear conditioningJ
Klf15-null Klf15-null Klf15-null
WT vs. Klf15-null p"0.05 * WT vs. Klf15-null p"0.05
* WT vs. Klf15-null p"0.05
WT vs. Klf15-null p"0.05 at all time points
Neuro-behavioral testing
Figure 4. Klf15 Regulates Rhythmic Nitrogeneous Waste ExcretionSchematic illustrates the excretion of nitrogenous waste products (i.e., the urea cycle).
(A and B) Plasma glutamate, ammonia in WT and Klf15 null mice (n = 5 per group per time point).
(C) Otc expression in WT and Klf15 null livers (n = 4 per group per time point).
(D) Plasma ornithine in WT and Klf15 null mice (n = 5 per group per time point).
(E) OTC enzymatic activity measured from liver mitochondrial extracts from WT and KLF15 null mice (n = 4 per group).
(F and G) Urinary levels of urea and ammonia in WT and KLF15 null mice (n = 5 per group).
(H) ChIP for KLF15 on the Otc promoter (n = 3 per time point). (# p < 0.05 at all time points between WT and Klf15 null).
(I–K)Results of neurobehavioral testing for (i) Y-maze, a test of working memory (n = 3 per group).
(J and K) Fear conditioning during contextual changes (hippocampal function) and altered cues (amygdalar function) (n = 8 per group) (J), and Morris water maze
test, a test of hippocampal function (n = 8 per group) (K). Data presented as mean ±SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
316 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 7: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/7.jpg)
increased (Figures 4D and S4B). Further, urine analysis revealedelevated levels of ammonia and reduced urea, supportive ofimpaired hepatic ureagenesis (Figures 4F and 4G). Next, toexamine whether Otc is a transcriptional target for Klf15, weperformed adenoviral overexpression in hepatocytes andChIP. Klf15 overexpression induced Otc expression, and anal-ysis of hepatocyte cell culture supernatant revealed reducedornithine concentration (Figure S4C). Further, ChIP identifiedrhythmic enrichment of KLF15 on a conserved region of theOtc promoter (Figures 4H and S4C). Next, to determinewhether the observed hyperammonemia was associated withcognitive dysfunction, we performed extensive neurocogni-tive behavioral testing. Klf15 null mice exhibited significantdysfunction of short-term memory, as evidenced by reducedpercentage of alternation behavior in the Y-maze test (Figure 4I).To test for memory more specifically, we determined contextual(hippocampal) and cued (amygdala) fear-based memory. Klf15null mice exhibit reduced freezing in the context in which theyhad previously received an aversive stimulus suggestive ofimpaired hippocampal-based memory (Figure 4J). However,no significant difference was noted for cued fear conditioning(Figure 4J). Finally, in the Morris water maze, a selective testfor hippocampal function, Klf15 null mice exhibit an initialsignificant impairment in learning but no differences in reten-tion, suggesting that Klf15 null mice exhibit delay in learningbut ability to ultimately acquire and retain the task (Figure 4K).In summary, these data suggest that impaired detoxification ofammonia impairs selective aspects of cognitive function inKlf15 null mice.
Feeding Regulates Nitrogen Homeostasis and thePeripheral Core Clock MachineryPrevious studies determined that rhythmic feeding is a domi-nant input that modulates CCM expression in peripheral organs(Damiola et al., 2000). Thus, we reasoned that rhythmic feedingcould alter Klf15 diurnal expression pattern and nitrogenhomeostasis. To test this hypothesis, mice were fed for a6-hour period during the light phase (ZT3-ZT9) or ad libitumfor a period of 1 month under L/D conditions. Animals werethen harvested at two time points corresponding to the zenithand nadir of the total AA pool under L/D (Figure 2G). Consistentwith previous studies (Damiola et al., 2000), restricting foodintake to the light phase altered expression of several com-ponents of the CCM in liver, including Clock, Per2, Cry1,Reverba, and Dbp (Figures 5A, 5B, 5C, and S5A). Interestingly,restricted feeding also altered expression of Klf15 in liver andskeletal muscle, the total AA pool (including alanine andBCAA), ammonia, and urea (Figures 5D, 5E, 5F, 5G, and 5H).Of the 15 AAs that exhibit rhythmic oscillation in LD, the zenithand nadir of 13 were shifted significantly by daytime feeding(Table S1). Further, examination of enzymes in AA metabolismrevealed alteration of Alt and Bcat2 in skeletal muscle but not inthe liver (Figures 5I, 5J, and S5B). Of the nitrogen-disposalmachinery in the liver, Otc expression was reversed, and cor-roborated by changes in plasma ornithine (Figures 5K, 5L,and S5B). In an additional set of experiments, mice wereharvested at all time points of a 24-hr period followingrestricted feeding. Consistent with our aforementioned experi-ments, we identified a full reversal in gene expression of
Bmal1, Klf15, and Otc in the liver (Figure S5C). Thus, feedingrhythms play a key role in modulating Klf15 and rhythmic nitro-gen homeostasis.
Adaptation to High-Protein Diet in Wild-Type and Klf15Null MiceOur study suggests an important role for Klf15 in regulatingrhythmic flow of nitrogen by orchestrating rhythmic variation inexpression of AA utilization and excretion enzymes acrossmultiple organs. To further substantiate the importance of theseregulatory effects in vivo, we challenged WT and Klf15 null miceto a high-protein diet (70%protein as casein) or normal diet (18%protein) for 1 week. In WT mice, despite the low levels of carbo-hydrate in the high-protein diet (18.7% compared to 62.3%carbohydrate in normal diet), the mice were able to maintain eu-glycemia (Figure 6A) by extracting carbon skeletons from AAs(i.e., gluconeogenesis through greater Klf15 and Alt expression)(Figures 6B and 6C). In addition, ammonia levels were also main-tained at physiological levels by increasing ureagenesis (Figures6E and 6F) accompanied by a significant increase in hepatic Otcexpression (Figure 6D). In sharp contrast, Klf15 null mice exhibitnear-fatal hypoglycemia on high-protein diet (1 of 5 mice died at1 week of high-protein diet due to severe hypoglycemia), anddemonstrated significant accumulation of AAs in plasma, indi-cating impaired utilization of AAs (Figures 6A, 6B, and 6C). Inaddition, and consistent with a significant defect in hepatic Otcfunction (Figure 6D), Klf15 null mice exhibited marked hyperam-monemia with impaired ureagenesis (Figures 6E and 6F). Thisglobal failure of nitrogen flux and inability to adapt to high-proteindiet further illustrates the role ofKlf15 in controlling utilization andexcretion of nitrogen in mammalian organisms.
Nitrogen Homeostasis Is Circadian in HumansStudies from the 1960s, conducted for 6 continuous days, clearlyestablished that AAs exhibit diurnal rhythm in humans (Feiginet al., 1967). Our studies in mice suggested that such rhythmscould occur in the absence of external cues. However, becausefood intake exhibits endogenous circadian rhythmicity in mice,we cannot determine whether nitrogen homeostasis is drivensimply by the feeding/fasting cycle or by an endogenous circa-dian rhythm that is independent of dietary cues. Thus, to deter-mine whether the circadian system per se influences nitrogenhomeostasis in humans independent of environmental, behav-ioral and dietary influences, we scheduled individuals to live on28-hr ‘‘days’’ for 7 cycles across 196 hr in persistent dim lightas previously described (Scheer et al., 2009). This forced desyn-chrony protocol dissociates the behavioral sleep/wake and fast-ing/feeding cycle (imposed 28-hr cycle) from the circadiansystem (endogenous " 24-hr cycle), thus allowing the determi-nation of circadian-system influences not confounded by theinfluence of changes in behavior (including food intake) and envi-ronment (including light). In this way, blood samples were ob-tained in the fasted state ("12 hr after the last meal) at differentinternal circadian phases. Using this gold-standard method inhuman circadian research, we discovered that several AAs,including alanine and BCAA, exhibit robust endogenous circa-dian rhythms (Figures 7B and 7C). Of the 20 AAs, 6 exhibitedendogenous circadian rhythmicity in humans (Figures 7 andS6), and the total AA pool demonstrated a trend toward
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 317
![Page 8: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/8.jpg)
rhythmicity (Figure 7A). Finally, plasma urea and ornithine alsooscillated with endogenous " 24-hr periodicity (Figures 7Dand S6).
DISCUSSION
Using complementary approaches in mice and humans, wedemonstrate that nitrogen homeostasis is a conserved endoge-
nous circadian process in mammals. Our initial studies in micewere done under the classical conditions to ascertain rhythmicity(i.e., constant darkness). In D/D we observed that 24-hr rhyth-micity existed for total AA pool, ammonia, and urea (Figures2A, 2B, 2C, and 2D). Furthermore, in our human study, we disso-ciated the influence of the circadian timing system from that of allenvironmental, behavioral, and dietary influences on nitrogenhomeostasis by placing humans in persistent dim light for
0
0.4
0.8
1.2
1.6
2
ZT 6 ZT 18
rela
tive
fold
Klf15 (Liver) *
*
0
2000
4000
6000
8000
10000
12000
ZT6 ZT18 150
175
200
225
250
2000
3000
4000
5000
ZT6 ZT18
Total amino acids
Ammonia Urea
µM/L
µM/L
µM/L
*
*
*
*
*
*
0
0.2
0.4
0.6
0.8
1
1.2 Otc (Liver)
*
*
ZT6 ZT18
BCAA
µM/L
*
*
ZT18
rela
tive
fold
A C
E
LJ
H
K
0.0
20.0
40.0
60.0
80.0
ZT6 ZT18
Ornithine
*
*
µM/L
ZT 6
Ad libitumRestricted feeding
N
0
0.5
1
1.5
2
2.5
ZT6 ZT18
Clock (Liver)
0
1
2
3
4
ZT6 ZT18
Per2 (Liver)*
*
*
*
rela
tive
fold
0
1
2
3
4
5
ZT6 ZT18
Cry1 (Liver)*
*
0
1
2
3
4
ZT6 ZT18
ZT6 ZT18
ZT6 ZT18
0.0
250.0
500.0
750.0
1000.0
ZT6 ZT18
Klf15 (Skeletal muscle)
Alt (Skeletal muscle)
Bcat2 (Skeletal muscle)
Alanine
rela
tive
fold
rela
tive
fold
rela
tive
fold
rela
tive
fold
rela
tive
fold
µM/L
B
D F
G I
M
*
*
*
*
****
** p<0.05 compared to all other groups (ANOVA)* p<0.05 compared to ZT6
0
1
2
3
4
5
6
0
1
2
3
4
5
*
*
*
*
0
2
4
6
8
10
12 Insulin
*
*
**
p<0.05*
ng/d
l
O
**
0
200
400
600
800
1000
1200
ZT6 ZT18
Figure 5. Feeding Alters Klf15 Expression and Nitrogen Homeostatsis(A–O) Following ad libitum feeding or feeding restricted to the light-phase (ZT3-ZT9) for one month: liver expression of Clock, Per2, and Cry1 (A–C); liver and
skeletal muscle expression ofKlf15 (D and E); total plasma AA, ammonia, and urea concentrations (F, G andH); skeletal muscle Alt andBcat2 expression (I and J);
liver expression of Otc (K); and plasma ornithine, alanine, BCAA, and insulin (L, M, N, and O) (n = 5 per group per time point). Data presented as mean ± SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
318 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 9: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/9.jpg)
196 hr and altering the habitual feed/fasting and sleepingrhythms to 28-hr cycles. Despite these alterations, nitrogenhomeostasis proceeded with a 24-hr rhythmicity (Figure 7),which is convincing of an endogenous circadian driving forcebehind these rhythms.The teleological role of circadian rhythms is postulated to
coordinate behavioral rhythms (activity, feeding, sleeping) tothe anticipated energetic needs of an organism (Green et al.,2008). Of these functions, glucose homeostasis is paramountdue to the obligate use of glucose by the brain and limited abilityof the mammalian liver to store glycogen. Therefore, within a fewhours after a meal, AAs derived from skeletal muscle provide thecarbon skeleton for hepatic gluconeogenesis (Felig, 1975).
However, as a consequence of utilizing carbons from AAs,mammalian organisms face the burden of eliminating the toxicnitrogenous waste. Our study identifies Klf15 as a clock-driven,peripheral circadian factor essential for coordinating delivery ofthe carbon skeletons required for glucose production and elimi-nation of ammonia to urea. The importance of this regulation isunderscored by the fact that failure to faithfully coordinaterhythmic utilization and excretion of AAs can lead to severe path-ophysiological consequences. Indeed, failure of rhythmic AAutilization leads to persistently low glucose with impaired circa-dian glucose homeostasis (Figure 3), whereas failure of rhythmicexcretion causes hyperammonemia and attendant cognitivedysfunction (Figure 4).
0
1
2
3
0
1
2
3 Klf15
rela
tive
fold
0
50
100
150
200
WT Klf15-null
Blood Glucose (mgms/dL)
*
0
2000
6000
10000
14000
18000 Plasma total amino acids (µM/L)
*
*
*
0
100
200
300
400 *
*
0
5000
10000
15000
20000
*
*
Plasma ammonia (µM/L)
WT Klf15-null
WT Klf15-null WT Klf15-null
Plasma urea (µM/L)
rela
tive
fold
Alt (liver)
* *
WT Klf15-null WT Klf15-null
* *
0
1
2
rela
tive
fold
Otc (liver)
#
C
A B
D
E F
* p<0.05 when compared to similar diet WT group
#
#
# p<0.05 when compared to WT Normal Diet
WT
ND HP ND HP ND HP ND HP
ND HP ND HP ND HP
ND HP
ND HP ND HP ND HP ND HP
ND HP
Figure 6. Wild-Type and Klf15 Null Adaptation to High-Protein Diet(A–E) Following 1 week of high-protein diet (HP; 70% casein) or normal diet (ND; 18% protein) WT and Klf15 null (n = 5 per group) blood glucose (A), plasma AAs
(B), liver expression of Klf15, Alt, and Otc (C and D), plasma ammonia (D), and plasma urea (E). Data presented as mean ± SEM.
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 319
![Page 10: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/10.jpg)
Our study also links the circadian clock to nitrogen homeo-stasis through a Klf15-dependent mechanism (see GraphicalAbstract). Klf15 rhythm was disrupted in several circadianclock-mutant mouse lines, and our data supports a directclock-dependent transcriptional basis for this regulation (Figures1E, S1C, and S1D). This was also confirmed in an independentgenome-wide ChIP-sequencing study that identified rhythmicBMAL1 binding to the Klf15 promoter (Rey et al., 2011). Feedingrhythms have been identified to play an important role in entrain-ing the peripheral clock (Damiola et al., 2000). Further, depletingfood intake led to failure of rhythmic variation of transcripts in theliver, whereas, restricted feeding in a Clock mutant-inducedoscillation of several transcripts in the liver (Vollmers et al.,2009). Because nitrogen utilization and disposal largely occursin peripheral organs, we examined the role of restricted feedingand identified that feeding plays an important role in rhythmicnitrogen homeostasis by altering expression of Klf15 and otherAA utilization enzymes (Figure 5). The essential role of Klf15 inmediating AA rhythms was also evident from the observationthat normal feeding/activity rhythms and near-normal hepaticclock gene expression rhythms (Figures 2 and S2) in Klf15 nullmice were not sufficient to maintain AA rhythms. Further, admin-istration of high-protein diet was not sufficient to overcome theenzymatic deficiencies causedby the absenceofKlf15 (Figure 6).Thus, our studies suggest a central role for Klf15 in transcription-ally coupling rhythmic variation in AA metabolic enzymes to thecircadian clock and feeding rhythms. There are several impor-tant limitations to our work. First, because Klf15 is controlledby Bmal1 (Figure 1), our observations suggest that the circadianclock may also control nitrogen homeostasis. However, studiesassessing nitrogen homeostasis in Clock mutant or Bmal1 nullmice are likely to be confounded by abnormal feeding rhythms,altered food intake, and body composition (Turek et al., 2005;Shi et al., 2010). Further, because nitrogen homeostasis occursacross multiple organs, compound tissue-specific deletionmodels in Clock mutants will be needed to investigate this issue.Although such studies are decidedly nontrivial, they are clearly ofinterest andwill provide amore comprehensive understanding ofthe link between the circadian clock and rhythmic nitrogenhomeostasis in mammalian organisms.Finally, because AAs can activate many signaling pathways
and are precursors for hormones/nitrogenous substances (Wu,2009), dysregulation of rhythmic utilization and excretion mayplay a pathogenic role in the onset of common disease states.For example, restricted feeding also resulted in a marked eleva-tion of the total AA pool, BCAA, and alanine (Figures 5F, 5M, and5N. Interestingly, this was associated with a significant increase
Figure 7. Human Endogeneous Circadian Nitrogen HomeostasisFasting total plasma AA pool, alanine, BCAA, and urea exhibit endogenous
circadian rhythmicity in humans during the forced desynchrony protocol. The
cosine models (black lines) and 95% confidence intervals (gray areas) are
based on mixed-model analyses and use precise circadian phase data. To
show that these models adequately fit the actual data, we also plot the
proportional changes across 60 circadian degree windows per individual,
multiplied by the group average with SEM error bars (open circles with error
bars). Data are double-plotted to aid visualization of rhythmicity. Lower x axis
shows the circadian phase in degrees, with fitted core body temperature
minimum assigned 0# and 360# equal to the individual circadian period (group
average = 24.09 hr); top x axis shows corresponding average clock time for
these individuals; vertical dotted lines show core body temperature minimum;
horizontal gray bars show corresponding average habitual-sleep episode in
the 2 weeks prior to admission.
Cell Metabolism
Circadian Nitrogen Homeostasis
320 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 11: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/11.jpg)
in plasma insulin (Figures 5O and S7). It is also consistent withthe well-known relationship between shift work and insulin resis-tance (Scheer et al., 2009). Indeed, studies have identified apath-ogenic role for altered BCAA levels in the development of insulinresistance (Newgard et al., 2009). More recently, Shah et al.identified a significant relationship between BCAA levels andurea-cycle metabolites in patients with coronary artery disease(Shah et al., 2010). Finally, Klf15 null mice develop cardiac andvascular myopathy, characterized by heart failure and aneuris-mal aortic dilatation, following exposure to angiotensin II infusion(Haldar et al., 2010). These findings support a potential linkbetween impaired nitrogen homeostasis and susceptibility tocommon disease states. Thus, examination of rhythmic changesin nitrogen homeostasis may have wide clinical implications fordiagnosis, prognosis, and therapy.
EXPERIMENTAL PROCEDURES
Mice and Dietary PerturbationsAll animal studies were performed in accordancewith guidelines from the Insti-
tutional Animal Care Use Committee (IACUC) at Case Western Reserve
University, Cleveland, OH, and at collaborating facilities. WT male mice on
C57BL6/J background were purchased from The Jackson Laboratory (Bar
Harbor, ME), and acclimatized to our facility for 3–4 weeks. Generation of
systemic Klf15 null mice was previously described (Fisch et al., 2007), and
Klf15 null mice have been backcrossed into the C57BL6/J background for
over 10 generations. WT and Klf15 null mice were housed under strict light/
dark conditions (6:00 a.m. lights on and 6:00 p.m. lights off), and had free
access to standard chow/water. For L/D experiments, mice were euthanized
with C02 inhalation or isoflurane every 4 hr for 24 hr. For D/D experiments,
mice were placed in complete darkness for 38 hr (starting at the end of light
phase ZT12), followed by harvest every 4 hr over a 24-hr period. Studies on
the Bmal1 null, Per1/2 double-KO, Per2/Cry1 KO, and Reverba were as previ-
ously described (Hogenesch et al., 2000; Oster et al., 2002; Preitner et al.,
2002; Zheng et al., 2001). For restricted feeding studies, mice had free access
to food (ad libitum group) or access only during the light phase ZT3-ZT9 for
1 month. High-protein diet feeding was conducted for 1 week. The control
diet for this study consisted of 18.1% protein, 62.3% carbohydrate, and
6.2% fat (TD110483, Harlan Laboratories), and high-protein diet was 70%
casein, 18.7% carbohydrate, and 6.2% fat (TD 03367, Harlan Laboratories).
Physiological StudiesWheel-running behavior was monitored in mice using Clocklab software (Acti-
metrics). Animals were housed in L/D until stably entrained, then wheel running
was recorded for 3 weeks in L/D, 3 weeks in D/D, and 17 days in L/L. Food
intake analysis was measured using the DietMax system (Accuscan Instru-
ments, Columbus, OH) every 5 min at the Cincinnati Mouse Metabolic Pheno-
typing core (MMPC).
Tissue Harvest and Biochemical AnalysisPrior to euthanasia, glucose was measured from tail blood using glucometer
(Accu-Check, Roche Diagnostics). Following this, mice were euthanized and
blood was collected from the inferior vena cava with a heparin-coated syringe.
For constant-dark experiments, the optic nerves were severed following
euthanasia and before proceeding to organ harvest. Organs were washed in
cold phosphate-buffered saline and flash-frozen in liquid nitrogen. Plasma
was separated by centrifugation and frozen in aliquots for analysis. Plasma
insulin and glucagon were measured using radio-immuno assay, and AAs,
ammonia, urea, and ornithine were measured using high-performance liquid
chromatography at the Vanderbilt MMPC. Tissue AAs, ammonia, urea, and
ornithine were extracted by homogenizing weighed tissue pieces in 10%
5-sulphosalicylic acid dissolved in distilled water. Briefly, AA analysis was per-
formed using a Biochrom 30 analyzer, a PC-controlled automatic liquid chro-
matograph with a post-column detection system. Prepared samples are
injected into a column of cation exchange resin and separated by buffers of
varying pH and ionic strength. They are then reacted with ninhydrin at
1,350#C and the absorbance maxima is read at 440 and 570 nm. The retention
time of the peak identifies the AA, and the area under the peak indicates the
quantity present. Samples were prepared by deproteinizing with 10% SSA
(5-sulfosalicylic acid) and centrifugation. The resulting supernatant was then
added to an equal quantity of Lithium citrate loading buffer, which lowers
the pH prior to introduction to the cation exchange column. A known quantity
of Norleucine may also be added to act as an internal standard. The PC pres-
ents both a detailed chromatogram of each sample and the amount of each
AA, based on comparison to a standardmixture of acidic and basic AAs. These
results were confirmed by manual calculations based on the area of each
peak.
OTC Activity AnalysisHepatic mitochondrial extracts were prepared, and OTC activity measured as
previously described (Lee and Nussbaum, 1989; Ye et al., 1996).
Cell Culture StudiesFor adenoviral overexpression studies, Hepa1-6 cells or AML12 mouse hepa-
tocyte cell lines and differentiated C2C12 cells were used. For AA analysis,
adenoviral overexpression was performed for 48 hr in serum-free media. The
media was removed, spun to remove debris, deproteinized, and analyzed
for AA, ornithine concentration. The promoter region of Klf15 (!5 kb before
the translation start site in the second exon) was cloned into PGL3 reporter
vector (Promega, Madison, WI). Transient transfection studies were conduct-
ed in HepG2 cells using Fugene HD (Roche, Indianapolis, IN).
RNA Isolation and Real-Time PCR AnalysisRNA was isolated from frozen liver and skeletal muscle samples by homoge-
nization in Trizol reagent by following manufacturer’s instructions (Invitrogen,
Carlsbad, CA). RNA was reverse transcribed following DNase treatment.
Real-time PCR was performed using standard or LNA-based Taqman
approach with primers/probes designed and validated from the Universal
Probe Library (Roche, Indianapolis, IN). The results were normalized to Beta
actin or Gapdh.
Western ImmunoblottingLiver samples were homogenized in buffer containing 50 mM Tris, 150 mM
NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, and 1%
SDS supplemented with protease and phosphatase inhibitors (Roche, Indian-
apolis, IN). Nuclear lysates were prepared using the NE-PER kit following
manufacturer’s instructions (Thermo Scientific, Rockford, IL). A goat poly-
clonal antibody against KLF15 was used (ab2647, Abcam, Cambridge, MA).
Chromatin ImmunoprecipitationChromatin immunoprecipitation was performed from mouse livers as previ-
ously described (Tuteja et al., 2009; Ripperger and Schibler, 2006). Briefly,
WT mouse livers were harvested every 4 hours and fixed with 1.1% formalde-
hyde for 10 min. Following this, chromatin was prepared and sonicated using
Bioruptor (Diagnode, Sparta, NJ). The sonicated chromatin was flash frozen in
liquid nitrogen and stored at !80#F for subsequent analysis. Immunoprecipi-
tation was conducted using Dynabeads (Invitrogen, Carlsbad, CA) bound to
BMAL1 or KLF15 antibody. The promoter regions of putative KLF15 target
genes were manually examined for conserved regions using Kalign (EMBL-
EBI). Real-time PCR analysis was performed using the following primers: Alt
(F-aactagctgtcccgtctcca and R–ctctgatgagccactgcaag), Otc (F- acctgggct
cagttagggtag R-cgtcatgatttgtaatgacctaaga), 28S (F- ctgggtataggggcgaaagac
R- ggccccaagacctctaatcat), nontarget region (F- cctctgtgcctgtgaagga
R- catcagtgtcccctgacaga). The relative abundance was normalized to abun-
dance of 28S between the input and immunoprecipitated samples as previ-
ously described (Tuteja et al., 2009).
Neurobehavioral AnalysisSee Supplemental Information.
Human StudyWe studied 10 adult participants [5 female; mean age 25.5 years (range 19–41
years); mean body mass index 25.1 kg/m2 (20–28 kg/m2)], as previously
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 321
![Page 12: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/12.jpg)
published (Scheer et al., 2009). The forced desynchrony protocol consisted of
7 recurring 28-hr sleep/wake cycles under dim light conditions (±1.8 lux) to
minimize any influence of light on the circadian system. During this period
a fasting plasma sample was collected from each participant every 28 hr
across the full 196 hr of the forced desynchrony, with each sample collected
approximately 12 hr after the last meal (within 1 hr of awakening and prior to
breakfast). By analyzing the plasma samples every 28 hr throughout the forced
desynchrony protocol, samples were distributed across the circadian cycle,
allowing assessment of the effects of the circadian system, independent of
the effects of the behavioral cycles of sleep/fasting and wake/eating (Scheer
et al., 2009). A sufficient number of samples across the entire circadian cycle
was available for analysis in 8 of these 10 participants.
Statistical AnalysisAll data are presented asmean ± SEM. For circadianmouse studies, the statis-
tical significance between time points to assess rhythmicity was performed
using analysis of variance (ANOVA). The statistical difference between two
individual groups was assessed using the Student’s t test; p < 0.05 was
considered significant. For the human forced desynchrony protocol, the effect
of the endogenous circadian rhythm was analyzed using cosinor analyses,
including the circadian (fundamental "24-hr) rhythmicity and a linear compo-
nent (hours since the start of the forced desynchrony protocol) and mixed
model analysis of variance with restricted maximum likelihood (REML) esti-
mates of the variance components (JMP, SAS Institute) (Nelson et al., 1979).
For analytes without significant effect of the linear component, a simple cosine
model was used. Continuously recorded core body temperature was used as
individualized circadian phase marker in the human study (Scheer et al., 2009).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
seven figures, and one table and can be found with this article online at
doi:10.1016/j.cmet.2012.01.020.
ACKNOWLEDGMENTS
We are grateful to Drs. Alfred F. Connors, Jr., David S. Rosenbaum, Jonathan
S. Stamler, Douglas T. Hess, and Satish C. Kalhan for support and sug-
gestions, to Dr. Ueli Schibler for reagents, to Drs. John Le Lay and Klaus H.
Kaestner for providing chromatin immunoprecipitation protocol, to Ken
Grimes andWanda Snead at the Vanderbilt MMPC, to Dana Lee at the Cincin-
nati MMPC, to Jenny Marks at BWH, to Diana Awad Scrocco for proofreading,
to Mike Mustar for artistic illustrations, to the CWRU Rodent Behavior Core,
and to members of the Jain laboratory for their assistance. Funding sources:
NIH grants HL094660 (D.J.), R01-HL09480601 and P30-HL101299
(F.A.J.L.S.); K24-HL76446 (S.A.S.); HL072952 (S.M.H.); HL097023 (G.H.M.);
HL075427, HL076754, HL084154, HL086548, and HL097595 (M.K.J.);
DK059630 (Cincinnati MMPC); DK59637 (Vanderbilt MMPC); SNF grant
31003A/131086 (U.A.); and M01-RR02635 (BWH).
Received: April 8, 2011
Revised: October 10, 2011
Accepted: January 27, 2012
Published online: March 6, 2012
REFERENCES
Balandreau, J.P., Millier, C.R., and Dommergues, Y.R. (1974). Diurnal varia-
tions of nitrogenase activity in the field. Appl. Microbiol. 27, 662–665.
Bauer, A., Urquhart, A.A., and Joy, K.W. (1977). Amino Acid metabolism of pea
leaves: diurnal changes and amino Acid synthesis from N-nitrate. Plant
Physiol. 59, 915–919.
Brosnan, M.E., and Brosnan, J.T. (2009). Hepatic glutamate metabolism: a tale
of 2 hepatocytes. Am. J. Clin. Nutr. 90, 857S–861S.
D’Antona, G., Ragni, M., Cardile, A., Tedesco, L., Dossena, M., Bruttini, F.,
Caliaro, F., Corsetti, G., Bottinelli, R., Carruba, M.O., et al. (2010). Branched-
chain amino acid supplementation promotes survival and supports cardiac
and skeletal muscle mitochondrial biogenesis in middle-aged mice. Cell
Metab. 12, 362–372.
Damiola, F., Le Minh, N., Preitner, N., Kornmann, B., Fleury-Olela, F., and
Schibler, U. (2000). Restricted feeding uncouples circadian oscillators in
peripheral tissues from the central pacemaker in the suprachiasmatic nucleus.
Genes Dev. 14, 2950–2961.
Dibner, C., Schibler, U., and Albrecht, U. (2010). The mammalian circadian
timing system: organization and coordination of central and peripheral clocks.
Annu. Rev. Physiol. 72, 517–549.
Duez, H., and Staels, B. (2008). The nuclear receptors Rev-erbs and RORs
integrate circadian rhythms and metabolism. Diab. Vasc. Dis. Res. 5, 82–88.
Feigin, R.D., Klainer, A.S., and Beisel, W.R. (1967). Circadian periodicity of
bloof amino-acids in adult men. Nature 215, 512–514.
Feigin, R.D., Dangerfield, H.G., and Beisel, W.R. (1969). Circadian periodicity
of blood amino acids in normal and adrenalectomized mice. Nature 221,
94–95.
Felig, P. (1975). Amino acid metabolism in man. Annu. Rev. Biochem. 44,
933–955.
Fernstrom, J.D., Wurtman, R.J., Hammarstrom-Wiklund, B., Rand, W.M.,
Munro, H.N., and Davidson, C.S. (1979). Diurnal variations in plasma neutral
amino acid concentrations among patients with cirrhosis: effect of dietary
protein. Am. J. Clin. Nutr. 32, 1923–1933.
Fisch, S., Gray, S., Heymans, S., Haldar, S.M., Wang, B., Pfister, O., Cui, L.,
Kumar, A., Lin, Z., Sen-Banerjee, S., et al. (2007). Kruppel-like factor 15 is
a regulator of cardiomyocyte hypertrophy. Proc. Natl. Acad. Sci. USA 104,
7074–7079.
Foster, R.G., and Roenneberg, T. (2008). Human responses to the geophysical
daily, annual and lunar cycles. Curr. Biol. 18, R784–R794.
Grandison, R.C., Piper, M.D., and Partridge, L. (2009). Amino-acid imbalance
explains extension of lifespan by dietary restriction in Drosophila. Nature 462,
1061–1064.
Gray, S., Wang, B., Orihuela, Y., Hong, E.G., Fisch, S., Haldar, S., Cline, G.W.,
Kim, J.K., Peroni, O.D., Kahn, B.B., and Jain, M.K. (2007). Regulation of gluco-
neogenesis by Kruppel-like factor 15. Cell Metab. 5, 305–312.
Green, C.B., Takahashi, J.S., and Bass, J. (2008). The meter of metabolism.
Cell 134, 728–742.
Gropman, A.L., Summar, M., and Leonard, J.V. (2007). Neurological implica-
tions of urea cycle disorders. J. Inherit. Metab. Dis. 30, 865–879.
Haldar, S.M., Lu, Y., Jeyaraj, D., Kawanami, D., Cui, Y., Eapen, S.J., Hao, C.,
Li, Y., Doughman, Y.Q., Watanabe, M., et al. (2010). Klf15 deficiency is
a molecular link between heart failure and aortic aneurysm formation. Sci.
Transl. Med. 2. 10.1126/scitranslmed.3000502.
Harper, A.E., Miller, R.H., and Block, K.P. (1984). Branched-chain amino acid
metabolism. Annu. Rev. Nutr. 4, 409–454.
Hogenesch, J.B., Gu, Y.Z., Moran, S.M., Shimomura, K., Radcliffe, L.A.,
Takahashi, J.S., and Bradfield, C.A. (2000). The basic helix-loop-helix-PAS
protein MOP9 is a brain-specific heterodimeric partner of circadian and
hypoxia factors. J. Neurosci. 20, RC83.
Ko, C.H., and Takahashi, J.S. (2006). Molecular components of the mamma-
lian circadian clock. Hum. Mol. Genet. 15 (Spec No 2), R271–R277.
Lamia, K.A., Storch, K.F., and Weitz, C.J. (2008). Physiological significance of
a peripheral tissue circadian clock. Proc. Natl. Acad. Sci. USA 105, 15172–
15177.
Le Martelot, G., Claudel, T., Gatfield, D., Schaad, O., Kornmann, B., Sasso,
G.L., Moschetta, A., and Schibler, U. (2009). REV-ERBalpha participates in
circadian SREBP signaling and bile acid homeostasis. PLoSBiol. 7, e1000181.
Lee, J.T., and Nussbaum, R.L. (1989). An arginine to glutamine mutation in
residue 109 of human ornithine transcarbamylase completely abolishes enzy-
matic activity in Cos1 cells. J. Clin. Invest. 84, 1762–1766.
Marcheva, B., Ramsey, K.M., Buhr, E.D., Kobayashi, Y., Su, H., Ko, C.H.,
Ivanova, G., Omura, C., Mo, S., Vitaterna, M.H., et al. (2010). Disruption of
the clock components CLOCK and BMAL1 leads to hypoinsulinaemia and dia-
betes. Nature 466, 627–631.
Cell Metabolism
Circadian Nitrogen Homeostasis
322 Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc.
![Page 13: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/13.jpg)
McConnell, B.B., and Yang, V.W. (2010). Mammalian Kruppel-like factors in
health and diseases. Physiol. Rev. 90, 1337–1381.
Miller, I.J., and Bieker, J.J. (1993). A novel, erythroid cell-specific murine tran-
scription factor that binds to the CACCC element and is related to the Kruppel
family of nuclear proteins. Mol. Cell. Biol. 13, 2776–2786.
Minami, Y., Kasukawa, T., Kakazu, Y., Iigo, M., Sugimoto, M., Ikeda, S., Yasui,
A., van der Horst, G.T., Soga, T., and Ueda, H.R. (2009). Measurement of
internal body time by blood metabolomics. Proc. Natl. Acad. Sci. USA 106,
9890–9895.
Morris, S.M., Jr. (2002). Regulation of enzymes of the urea cycle and arginine
metabolism. Annu. Rev. Nutr. 22, 87–105.
Nelson, W., Tong, Y.L., Lee, J.K., and Halberg, F. (1979). Methods for cosinor-
rhythmometry. Chronobiologia 6, 305–323.
Newgard, C.B., An, J., Bain, J.R., Muehlbauer, M.J., Stevens, R.D., Lien, L.F.,
Haqq, A.M., Shah, S.H., Arlotto, M., Slentz, C.A., et al. (2009). A branched-
chain amino acid-related metabolic signature that differentiates obese and
lean humans and contributes to insulin resistance. Cell Metab. 9, 311–326.
Oster, H., Yasui, A., van der Horst, G.T., and Albrecht, U. (2002). Disruption of
mCry2 restores circadian rhythmicity in mPer2 mutant mice. Genes Dev. 16,
2633–2638.
Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht,
U., and Schibler, U. (2002). The orphan nuclear receptor REV-ERBalpha
controls circadian transcription within the positive limb of the mammalian
circadian oscillator. Cell 110, 251–260.
Reddy, A.B., Karp, N.A., Maywood, E.S., Sage, E.A., Deery, M., O’Neill, J.S.,
Wong, G.K., Chesham, J., Odell, M., Lilley, K.S., et al. (2006). Circadian
orchestration of the hepatic proteome. Curr. Biol. 16, 1107–1115.
Reppert, S.M., and Weaver, D.R. (2002). Coordination of circadian timing in
mammals. Nature 418, 935–941.
Rey, G., Cesbron, F., Rougemont, J., Reinke, H., Brunner, M., and Naef, F.
(2011). Genome-wide and phase-specific DNA-binding rhythms of BMAL1
control circadian output functions in mouse liver. PLoS Biol. 9, e1000595.
Ripperger, J.A., and Schibler, U. (2006). Rhythmic CLOCK-BMAL1 binding to
multiple E-box motifs drives circadian Dbp transcription and chromatin transi-
tions. Nat. Genet. 38, 369–374.
Rudic, R.D., McNamara, P., Curtis, A.M., Boston, R.C., Panda, S., Hogenesch,
J.B., and Fitzgerald, G.A. (2004). BMAL1 and CLOCK, two essential compo-
nents of the circadian clock, are involved in glucose homeostasis. PLoS
Biol. 2, e377.
Scheer, F.A., Hilton, M.F., Mantzoros, C.S., and Shea, S.A. (2009). Adverse
metabolic and cardiovascular consequences of circadian misalignment.
Proc. Natl. Acad. Sci. USA 106, 4453–4458.
Shah, S.H., Bain, J.R., Muehlbauer, M.J., Stevens, R.D., Crosslin, D.R.,
Haynes, C., Dungan, J., Newby, L.K., Hauser, E.R., Ginsburg, G.S., et al.
(2010). Association of a peripheral blood metabolic profile with coronary artery
disease and risk of subsequent cardiovascular events. Circ Cardiovasc Genet
3, 207–214.
Shi, S., Hida, A., McGuinness, O.P., Wasserman, D.H., Yamazaki, S., and
Johnson, C.H. (2010). Circadian clock gene Bmal1 is not essential; functional
replacement with its paralog, Bmal2. Curr. Biol. 20, 316–321.
Tu, B.P., Mohler, R.E., Liu, J.C., Dombek, K.M., Young, E.T., Synovec, R.E.,
and McKnight, S.L. (2007). Cyclic changes in metabolic state during the life
of a yeast cell. Proc. Natl. Acad. Sci. USA 104, 16886–16891.
Turek, F.W., Joshu, C., Kohsaka, A., Lin, E., Ivanova, G., McDearmon, E.,
Laposky, A., Losee-Olson, S., Easton, A., Jensen, D.R., et al. (2005). Obesity
and metabolic syndrome in circadian Clock mutant mice. Science 308,
1043–1045.
Tuteja, G., White, P., Schug, J., and Kaestner, K.H. (2009). Extracting tran-
scription factor targets from ChIP-Seq data. Nucleic Acids Res. 37, e113.
Vollmers, C., Gill, S., DiTacchio, L., Pulivarthy, S.R., Le, H.D., and Panda, S.
(2009). Time of feeding and the intrinsic circadian clock drive rhythms in
hepatic gene expression. Proc. Natl. Acad. Sci. USA 106, 21453–21458.
Wang, J., Alexander, P., Wu, L., Hammer, R., Cleaver, O., and McKnight, S.L.
(2009). Dependence of mouse embryonic stem cells on threonine catabolism.
Science 325, 435–439.
Wheeler, C.T. (1969). Diurnal Fluctuation in Nitrogen Fixation in Nodules of
Alnus Glutinosa and Myrica Gale. New Phytol. 68, 675.
Wu, G. (2009). Amino acids: metabolism, functions, and nutrition. Amino Acids
37, 1–17.
Ye, X., Robinson, M.B., Batshaw, M.L., Furth, E.E., Smith, I., and Wilson, J.M.
(1996). Prolonged metabolic correction in adult ornithine transcarbamylase-
deficient mice with adenoviral vectors. J. Biol. Chem. 271, 3639–3646.
Yin, L., Wu, N., Curtin, J.C., Qatanani, M., Szwergold, N.R., Reid, R.A., Waitt,
G.M., Parks, D.J., Pearce, K.H., Wisely, G.B., et al. (2007). Rev-erbalpha,
a heme sensor that coordinates metabolic and circadian pathways. Science
318, 1786–1789.
Zheng, B., Albrecht, U., Kaasik, K., Sage, M., Lu, W., Vaishnav, S., Li, Q., Sun,
Z.S., Eichele, G., Bradley, A., et al. (2001). Nonredundant roles of the mPer1
and mPer2 genes in the mammalian circadian clock. Cell 105, 683–694.
Cell Metabolism
Circadian Nitrogen Homeostasis
Cell Metabolism 15, 311–323, March 7, 2012 ª2012 Elsevier Inc. 323
![Page 14: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/14.jpg)
Cell Metabolism, Volume 15
Supplemental Information
Klf15 Orchestrates Circadian Nitrogen Homeostatsis
Darwin Jeyaraj, Frank A.J.L. Scheer, Jürgen A. Ripperger, Saptarsi M. Haldar, Yuan Lu, Domenick A. Prosdocimo, Sam J. Eapen, Betty L. Eapen, Yingjie Cui, Ganapathi H. Mahabeleshwar, Hyoung-gon Lee, Mark A. Smith, Gemma Casadesus, Eric M. Mintz, Haipeng Sun, Yibin Wang, Kathryn M. Ramsey,Joseph Bass, Steven A. Shea, Urs Albrecht, and Mukesh K. Jain
![Page 15: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/15.jpg)
Supplemental Experimental Procedures
Neurobehavioral Analysis
Behavioral Assessment - Y-Maze
Spontaneous alternation behavior and exploratory activity, a hippocampal-associated
task, is measured using a Y-maze (32 cm (long) X 10 cm (wide) with 26-cm walls).
Briefly, each animal is placed in one of three arms of the Y-maze (alternating arms
across animals in each group) and each arm entry is recorded for duration of 6 minutes.
An alternation is defined as 3 entries in 3 different arms (i.e. 1, 2, 3 or 2, 3, 1 etc). %
number of alternations is calculated as (total alternations/total number of entries –
2)*100. The maze is cleaned with ethanol between each animal to minimize odor cues
(Casadesus et al., 2006).
Delayed/Trace Fear Conditioning
Pavlovian fear conditioning is a paradigm in which an initially neutral stimulus such
as a tone (conditioned stimulus, CS), through the pairing with an aversive unconditioned
stimulus (US) such as a mild foot-shock, acquires aversive properties and comes to
elicit a fear related freezing response. Contextual fear conditioning is generally thought
to be hippocampus-dependent testing for the ability of the animal to associate the US
with the context in which it was presented. On the other hand, cued fear conditioning, in
which the animal responds to the CS presentation in an altered context is thought to be
hippocampus-independent. A two day protocol is designed to first train the animals to
associate the US and CS and subsequently test for post-reactivation long-term memory
24 hours after training.
Day 1 – Training: On the first day animals are allowed to habituate in the chamber
(Med Associates, Burlington, VT) for 2 min and are then presented with a white noise
(80dB) for 30 sec, this stimulus is designated as the conditioned stimulus (CS). After a 2
second interval the animals are administered a 0.5mA shock, this is designated as the
unconditioned stimulus (US). This procedure is repeated 5 times.
Day 2 – Contextual/altered context/cued testing: 24 h after training, animals are
placed back in the original chamber and freezing bouts are scored during 5 min to
determine the associations of the US with the context (contextual). Freezing
![Page 16: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/16.jpg)
measurements are automated using appropriate software (Med Associates, Burlington
VT) designed to gather 30 observations in 5 min. After contextual freezing is measured,
animals are returned to their home cage for 1 h. The chamber environment is modified
(new walls, flooring and odor cues) and the animal is introduced in the “new” chamber
for 6 min. Freezing rate is quantified as described in the contextual test for 3 min in the
absence of the CS (altered context). For the remaining 3 min the animal is presented
with the CS in the altered context and scored for freezing behavior as described
previously, to determine the cued fear conditioning score (Greco et al., 2010).
Morris Water Maze
Animals were trained in a black circular pool (112 cm) in a room containing distal
visual cues. Pool water was whitened with non-toxic white dye and temperature
maintained at 24°C. A white escape platform (10.5 cm in diameter) located
approximately 0.5cm beneath the water level was placed in the center of the NE
quadrant of the pool. Animals were introduced into the pool facing the wall from different
quadrants to control for location bias and were tested on 8 trials per day, subdivided into
2 blocks, 30 minutes apart over 4 days; each trial was 60 seconds long. A pre-training
session in which all animals were allowed to swim in the pool, and were gently guided to
the platform was also performed. During each trial, if the animal did not find the platform
during the allocated task time, it was gently guided towards the platform where it
remained for 15 seconds and then immediately placed back into the water from the next
start position for the next trial. Swim time, path length, and swim speed was recorded
using a video tracking system and software (Ethovision, Noldus Information
Technology, Wageningen, The Netherlands). On day 4, trial 8 was designated as probe
trial in which the platform was lowered to measure spatial strategy and short-term
retention. During probe trials animals were allowed to swim for 60 seconds without the
possibility to escape; percent time spent in the quadrant where the platform was
previously located, and platform crossings and latency were measured. After the
completion of this trial the platform was rendered visible and all animals underwent a
session to test for visual acuity (Bryan et al., 2010).
![Page 17: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/17.jpg)
SUPPLEMENTAL REFERENCES
Bryan, K.J., Mudd, J.C., Richardson, S.L., Chang, J., Lee, H.G., Zhu, X., Smith, M.A., and Casadesus, G. (2010) Down-regulation of serum gonadotropins is as effective as estrogen replacement at improving menopause-associated cognitive deficits. J Neurochem 112, 870-881. Casadesus, G., Webber, K.M., Atwood, C.S., Pappolla, M.A., Perry, G., Bowen, R.L., and Smith, M.A. (2006). Luteinizing hormone modulates cognition and amyloid-beta deposition in Alzheimer APP transgenic mice. Biochim Biophys Acta 1762, 447-452. Greco, S.J., Bryan, K.J., Sarkar, S., Zhu, X., Smith, M.A., Ashford, J.W., Johnston, J.M., Tezapsidis, N., and Casadesus, G. (2010) Leptin reduces pathology and improves memory in a transgenic mouse model of Alzheimer's disease. J Alzheimers Dis 19, 1155-1167.
�
![Page 18: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/18.jpg)
![Page 19: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/19.jpg)
Figure S1. Klf15 Expression in Wild-Type and Clock Mutant Livers and Skeletal Muscles, Related to Figure 1 (a and b) Klf15 mRNA expression in (a) WT liver and (b) skeletal muscle under L/D conditions (n=4 per time point, ANOVA p<0.05). Klf15 mRNA accumulation in (c) Per1/2 KO, Per2/Cry1 KO and (d) Reverba-null livers. Data presented as mean r SEM.
![Page 20: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/20.jpg)
![Page 21: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/21.jpg)
Figure S2. The Feeding and Activity of Klf15-Null Mice Are Similar to Their Controls and They Have Similar Clock Gene Expression, Related to Figure 2 (A) Aggregate food intake in WT and Klf15-null mice (n=4 per group (B and C) WT and Klf15-null mice in a light-dark cycle (LD), constant dark (DD), or constant light (LL). The period of lights on and lights off is shown in the bars at the top of the figure. Each line represents a 48-hour period, with the dark bars indicated periods of wheel-running activity (n=14 per group). (D) Clock gene expression in WT and Klf15-null livers (n=4 per group per group). Data presented as mean r SEM.
![Page 22: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/22.jpg)
![Page 23: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/23.jpg)
Figure S3. A Role for Klf15 in Amino Acid Metabolism, Related to Figure 3 (A) Alt expression in WT and Klf15-null livers (n=4 per group per time point), and skeletal muscle/liver concentration of BCAA, glutamate and alanine in WT and Klf15-null mice measured at ZT7 (n=4 per group). (B) Liver expression of gluconeogenic enzymes in WT, Klf15-null mice (n=4 per group per time point) and plasma insulin/glucagon in WT and Klf15-null mice (n=5 per group per time point). (C) Adenoviral overexpression of Klf15 compared to empty virus (EV) in skeletal myotubes and hepatocytes for Alt and Bcat2 (n=3 per group) and AA analysis of cell culture supernatant from hepatocytes over expressing Klf15 (n=3 per group). (D) Conserved Krüppel-binding region, i.e., C(A/T)CCC on the Alt promoter, and ChIP for KLF15 on a non-target region (n=3 per time point). Data presented as mean r SEM.
![Page 24: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/24.jpg)
![Page 25: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/25.jpg)
Figure S4. A Role for Klf15I in Ureagenesis, Related to Figure 4 (A) Expression of urea cycle enzymes (Cps1, Ass, Asl and Arg1) in WT and Klf15-null mice (n=4 per group per time point). (B) Liver ornithine and ammonia from WT and Klf15-null at ZT7 (n=4 per group). (C) Adenoviral overexpression of Klf15 in hepatocytes compared to EV, and analysis of cell culture supernatant (n=3 per group) and conserved Krüppel-binding region on the Otc promoter. Data presented as mean r SEM.
![Page 26: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/26.jpg)
![Page 27: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/27.jpg)
Figure S5. Restricted Feeding, Related to Figure 5 (A) Liver expression of core clock machinery components following ad libitum or restricted feeding (n=5 per group per time point). (B) Liver expression of AA metabolic enzymes (Alt), and urea cycle enzymes (Cps1, Asl, Ass and Arg1) following ad libitum or restricted feeding (n=5 per group per time point). (C) Following restricted feeding for one month, liver gene expression for Bmal1, Klf15 and Otc was compared to mice fed ad libitum (n=4 per time point per group). Data is double plotted to illustrate rhythmicity. Data presented as mean r SEM.
![Page 28: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/28.jpg)
![Page 29: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/29.jpg)
Figure S6. Human Amino Acid and Urea Cycle Intermediates, Related to Figure 6 Summary data of all human amino acids from the forced desynchrony study not included in Figure 9 of the manuscript, and plasma ornithine, taurine. Axes and symbols as in Fig. 7 in main text.
![Page 30: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/30.jpg)
![Page 31: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/31.jpg)
Figure S7. Glucose with Restricted Feeding Glucose following ad libitum or restricted feeding (n=5 per group per time point). Data presented as mean r SEM.
![Page 32: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/32.jpg)
![Page 33: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/33.jpg)
![Page 34: Cell Metabolism Article - unifr.ch · PDF filetary cues were controlled in humans, nitrogen homeostasis exhibited an ... roots of leguminous plants convert atmospheric ... * WT vs](https://reader031.vdocuments.mx/reader031/viewer/2022022423/5a9e308c7f8b9a6a218bef56/html5/thumbnails/34.jpg)
Supplemental Table 1. Summary of Mouse Amino Acid Data.