cell death copyright © 2018 ca2+-dependent demethylation ... · cium into the cytoplasm leads to...

Lee et al., Sci. Signal. 11, eaam7893 (2018) 9 January 2018

S C I E N C E S I G N A L I N G | R E S E A R C H A R T I C L E

1 of 18

C E L L D E A T H

Ca2+-dependent demethylation of phosphatase PP2Ac promotes glucose deprivation–induced cell death independently of inhibiting glycolysisHa Yin Lee,1 Yoko Itahana,1 Stefan Schuechner,2 Masahiro Fukuda,3 H. Shawn Je,3 Egon Ogris,2 David M. Virshup,1,4,5 Koji Itahana1*

Cancer cells increase glucose metabolism to support aerobic glycolysis. However, only some cancer cells are acutely sensitive to glucose withdrawal, and the underlying mechanism of this selective sensitivity is unclear. We showed that glucose deprivation initiates a cell death pathway in cancer cells that is dependent on the kinase RIPK1. Glucose withdrawal triggered rapid plasma membrane depolarization and an influx of extracellular calcium into the cell through the L-type calcium channel Cav1.3 (CACNA1D), followed by activation of the kinase CAMK1. CAMK1 and the demethylase PPME1 were required for the subsequent demethylation and inactivation of the catalytic subunit of the phosphatase PP2A (PP2Ac) and the phosphorylation of RIPK1. Plasma membrane depolarization, PP2Ac demethylation, and cell death were prevented by glucose and, unexpectedly, by its nonmetabolizable analog 2-deoxy-d-glucose (2-DG), a glycolytic inhibitor. These findings reveal a previously unknown function of glucose as a signaling molecule that protects cells from death induced by plasma membrane depolarization, independently of its role in glycolysis. Components of this cancer cell death pathway represent potential thera-peutic targets against cancer.

INTRODUCTIONOne of the hallmarks of cancer is an increase in cellular glucose uptake and dependence (1), which is thought, in part, to support aerobic gly-colysis (2). Rapidly dividing cancer cells use aerobic glycolysis for the production of metabolic intermediates, amino acids, nucleic acids, and energy (3). This phenomenon is known as the Warburg effect (2, 4). This addiction to glucose distinguishes cancer cells from normal cells and often increases their sensitivity to glucose deprivation (5, 6). Fol-lowing this logic, glucose deprivation would be predicted to selectively target cancer cells, without adversely affecting normal cells. Thus, tar-geting glucose metabolism and uptake in cancer cells, for example, by blocking glucose metabolism with nonmetabolizable analogs of glucose, such as 2-deoxy-d-glucose (2-DG) (7), or by blocking glucose uptake through inhibition of glucose transporters such as GLUT1 (SLC2A1) (8), could be therapeutic. However, not all cancer cell types are sensitive to glucose deprivation–induced cell death (9). Identifying the pathways that sensitize cancer cells to glucose depletion will facilitate the devel-opment of new therapies.

Protein phosphatase 2 (PP2A) is a serine/threonine phosphatase that exists as a heterotrimer composed of a core heterodimer of the scaffolding “A” subunit (PP2Aa) and the catalytic “C” subunit (PP2Ac), as well as one of various regulatory “B” subunits (10). The interaction between the regulatory subunits and the core heterodimer determines the subcellular localization, substrate specificity, and downstream signaling of the PP2A complex (10–12). A critical posttranslational modification of PP2Ac is the methylation/demethylation of its last

amino acid, leucine 309 (Leu309). Leu309 is methylated by leucine carboxyl methyltransferase 1 (LCMT1) (13), which promotes PP2A holoenzyme assembly (14–17) and PP2A activation (18, 19). PP2Ac is demethylated by PPME1 (protein phosphatase methylesterase 1) (20, 21), which is associated with the accumulation of inactive PP2A (19, 21).

The PP2Ac demethylase PPME1 can be regulated by calcium/calmodulin-dependent protein kinase I (CAMK1) (22), a kinase that is activated in response to increased cytosolic calcium concentration (23). Cytosolic calcium can increase because of an influx either of ex-tracellular calcium after opening the membrane calcium channels or of intracellular calcium released from endoplasmic reticulum/sarcoplasmic reticulum stores (24). An increase in the cytosolic calcium concen-tration triggers diverse signaling pathways and biological processes, including cell death (25, 26).

There are various calcium channels that are regulated by different pathways. Voltage-sensitive L-type calcium channels open rapidly upon plasma membrane depolarization (27, 28). The resultant influx of cal-cium into the cytoplasm leads to the activation of multiple calcium- dependent pathways, including the activation of CAMK1 (23). Here, we aimed to identify the pathways that sensitize cancer cells to glucose depletion. Identifying the cell death pathways and revealing molecular targets led us to investigate a potential strategy to develop new thera-peutic applications.

RESULTSCancer cell lines display different sensitivities toward glucose deprivation–induced cell deathGlucose deprivation is known to induce cell death in some cancer cell lines (9). We characterized a panel of cancer cell lines based on their sensitivity to glucose starvation. Standard culture media contain 25 mM glucose, and 10% fetal bovine serum (FBS) contains about 0.2 to 0.6 mM glucose. We incubated cells in media with or without both glucose and serum and evaluated cell death by propidium iodide (PI)

1Programme in Cancer and Stem Cell Biology, Duke-NUS Medical School, 8 College Road, 169857, Singapore. 2Department of Medical Biochemistry, Max F. Perutz Lab-oratories, Medical University of Vienna, Dr. Bohr-Gasse 9, 1030 Vienna, Austria. 3Programme in Neuroscience and Behavioural Disorders, Duke-NUS Medical School, 8 College Road, 169857, Singapore. 4Department of Biochemistry, National University of Singapore, 8 Medical Drive, 117596, Singapore. 5Department of Pediatrics, Duke University School of Medicine, Durham, NC 27710, USA.*Corresponding author. Email: [email protected]

Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works

on October 20, 2020

http://stke.sciencemag.org/

Dow

nloaded from




2 of 18

exclusion, which was detected by flow cytometry. Five of the seven cancer lines tested displayed substantial cell death in less than 10 hours of glucose- and serum-starvation (SW480, U2OS, U251MG, SaOS2, and U87MG; collectively referred to as “sensitive cell lines” hereafter in this manuscript) (Fig. 1A and fig. S1A). By contrast, two cancer cell lines (A549 and H1299), two normal primary fibroblasts (WI-38 and IMR-90), and a normal immortalized breast epithelial cell line (MCF-10A) remained impermeable to PI in serum- and glucose-free media (referred to as “insensitive cell lines” hereafter) (Fig. 1A and fig. S1A). Readdition of as little as 0.025 mM glucose was sufficient to prevent glucose- and serum starvation–induced cell death in U2OS cells (fig. S1B), suggesting that the lack of glucose triggers cell death. However, it is known that the absence of serum has effects on cell viability (29, 30). To rule out the potential effects of serum removal on cell death, we cultured cells in media with DFBS (dialyzed fetal bovine serum), which should retain the necessary growth factors but have undetectable levels of glucose. The glucose concentration in the media was also lowered to 1 mM to mimic the physiological tumor environment. Glucose concentra-tions in human blood are around 5 to 7 mM, and concentrations in cancers are frequently 3- to 10-fold lower than in normal tissues (9, 31–33). SW480, U2OS, and U251MG cells grown in DFBS-containing media remained sensitive to glucose deprivation, whereas A549, H1299, IMR-90, WI-38, and MCF-10A cells remained insensitive (Fig. 1B). We found that glucose deprivation of U2OS cells grown in the presence or absence of DFBS triggered similar cell death with similar kinetics (Fig. 1C). On the basis of these data, we concluded that the lack of glucose triggers cell death in a subset of cancer cells. We focused our subsequent analyzes on U2OS cells because they displayed the most rapid cell death after glucose removal.

We performed phase-contrast microscopy to evaluate the mor-phology of the cells after 10 hours of glucose deprivation. Under glu-cose deprivation, more of the cells were round and loosely attached to the plates in the five sensitive cell lines, whereas the morphology of the insensitive cell lines was not affected (Fig. 1D and fig. S1C). We also evaluated the kinetics of U2OS cell death upon glucose depriva-tion with PI staining using the IncuCyte ZOOM System (movies S1 and S2), which revealed that the cells exhibited the typical rounded morphology starting 3 hours after glucose removal and that most cells died within 16 hours.

Glucose deprivation–induced cell death is independent of ATP depletionCancer cells use glucose to generate adenosine 5′-triphosphate (ATP), and ATP depletion can affect cell survival (34). To determine whether ATP depletion was the cause of cell death induced by glucose depriva-tion, we blocked the ATP production by inhibiting glycolysis with the glucose analog 2-DG. If cell death was triggered by ATP depletion as a consequence of glucose removal, then we predicted that the addition of 2-DG to the cells would accelerate ATP depletion and hence cell death. As we expected, glucose deprivation reduced the amount of ATP in U2OS cells (Fig. 2A). Supplementing the media with 1 mM 2-DG in the presence of 1 mM glucose was not sufficient to reduce ATP, but 1 mM 2-DG significantly reduced intracellular ATP amounts in cells grown without glucose (Fig. 2A). Unexpectedly, 2-DG prevented cell death induced by glucose deprivation in sensitive cancer cell lines, as determined by PI exclusion assay (Fig. 2B) and analysis of cell mor-phology (Fig. 2C). Even the addition of as little as 0.025 mM 2-DG attenuated cell death in U2OS cells (fig. S2A). Because pyruvate is the end product of glycolysis and the initiator of ATP synthesis in the tri-

carboxylic acid cycle, we investigated whether increasing ATP by pyr-uvate supplementation can prevent cell death by glucose removal. Al-though the addition of pyruvate increased ATP amounts in cells grown in the absence of glucose (Fig. 2A), it failed to rescue cell viability upon glucose depletion (Fig. 2C). Together, these data suggest that cell death induced by glucose depletion is not due to ATP depletion.

Reactive oxygen species (ROS) contributes to glucose depletion–induced cell death (35). Although ROS was slightly induced after 4 hours of glucose depletion in U2OS cells (fig. S2B), the inhibition of ROS induction by catalase (fig. S2B) did not prevent cell death in-duced by glucose depletion in U2OS cells (fig. S2C), suggesting that ROS unlikely contributed to the cell death induced by the 4-hour glu-cose depletion, at least in our cell culture conditions.

To analyze the shared property of glucose and 2-DG that con-tributes to protecting cells from cell death, we examined the effect of O- glycosylation. Both glucose and 2-DG are known to increase O- glycosylation (36). We speculated that glucose and 2-DG may protect cells from cell death by enhancing O-glycosylation. However, we did not observe obvious changes in O-glycosylation with or without 1 mM glucose or 2-DG for 4 hours in U2OS cells (fig. S3A), indicating that such a low concentration of glucose or 2-DG does not affect O-glycosylation in a shorter incubation period (4 hours). To further examine the in-volvement of O-glycosylation in cell survival, we treated the cells with PUGNac that enhances O-glycosylation by inhibiting O-GlcNac--N- acetylglucosaminidase that is responsible for removing O-GlcNac from O-linked glycosylated proteins. Although we observed the marked increase in O-glycosylation by adding PUGNac in the presence or ab-sence of 1 mM glucose (fig. S3A), unlike 2-DG, PUGNac could not prevent cell death induced by glucose deprivation (fig. S3B). These results suggest that glucose and 2-DG prevent cell death independently from O-glycosylation.

2-DG is a glucose analog in which only the 2-hydroxyl group is replaced by hydrogen (fig. S3C). After conversion to 2-deoxyglucose- 6-phosphate by hexokinase, it cannot undergo isomerization and fur-ther glycolysis. To understand whether this structural similarity to glucose is important for preventing cell death, we treated the cells with 6-DG, a glucose analog in which the 6-hydroxyl group is replaced by hydrogen (fig. S3C). Because of the lack of a hydroxyl group at the sixth carbon position, 6-DG cannot be phosphorylated by hexokinase and therefore cannot be metabolized in glycolysis. Notably, 6-DG did not prevent U2OS cell death, unlike glucose and 2-DG (fig. S3D), sug-gesting that the hydroxyl group on the sixth carbon position is im-portant to protect cells from cell death.

Glucose deprivation–induced cell death is neither apoptosis nor related to autophagyTo gain insight into the mechanism of cell death induced by glucose deprivation, we evaluated markers of apoptosis. In contrast to ultra-violet (UV) light exposure, glucose withdrawal of U2OS cells did not induce apoptotic markers, such as cleaved poly(ADP–ribose) poly-merase 1 (PARP1) or cleaved caspase 3 (CASP3) (Fig. 3A). In addition, Z-VAD-FMK (a general caspase inhibitor) could not prevent glucose deprivation–induced cell death in U2OS cells, as indicated by phase- contrast images at 4 hours of glucose deprivation, a time point when most of the cells were rounded and loosely attached to the plates (fig. S4A), and by fluorescent images of PI staining at 16 hours of glucose deprivation, a time point when most of the cells were permeable to PI (Fig. 3B). We also did not detect changes in mitochondrial membrane potential (fig. S4B) and cytochrome c release (fig. S4C) after glucose deprivation.

on October 20, 2020


Dow

nloaded from




3 of 18

These data suggest that cell death induced by glucose deprivation does not occur through apoptosis.

Glucose depletion affected neither the abundance of autophagy marker LC3-II nor the LC3-II/LC3-I ratio (fig. S5A), sug-gesting that autophagy was not induced, at least by the time when the cells started to undergo rapid death after glucose depriva-tion. To further confirm this, we inhibited autophagy by knocking down ATG5, ATG7, ATG12, and BECN1 (fig. S5, B to E). Glu-cose deprivation–induced cell death was not affected by knockdown of these pro-teins, which are essential for autophago-some formation (Fig. 3C) (37). In addition, we inhibited the late stages of autophagy by adding chloroquine, an agent that prevents the acidification of lysosomes and inhibits autophagic flux by prevent-ing lysosomal protein degradation (38). Addition of chloroquine did not prevent glucose deprivation– induced cell death (Fig. 3D). Adenos-ine 5′-monophosphate–activated protein kinase (AMPK) is an energy sensor activated in response to nutrient stress, and its activation in-duces autophagy in a cell type–dependent manner (39). We knocked down AMPK (fig. S6A) or inhibited AMPK activity by adding compound C to observe its effects on cell death. Consistent with our aforementioned autophagy-independent cell death data (Fig. 3, C and D), attenuat-ing AMPK function through small interfering RNA (siRNA) or in-hibitor did not affect glucose deprivation–induced cell death (fig. S6, B and C). Together, these data suggest that cell death induced by glu-cose deprivation is neither through AMPK nor through autophagy.

Glucose deprivation–induced cell death requires RIPK1Necroptosis is a recently described additional form of programmed cell death (40) that occurs rapidly in a receptor-interacting protein kinase (RIPK)–dependent manner (41). We examined RIPK1 phos-phorylation, a marker of necroptosis (42), and found that glucose with-drawal reduced the electrophoretic mobility of RIPK1, possibly due to phosphorylation (Fig. 4A). RIPK1 phosphorylation upon glucose depri-vation was confirmed by Phos-tag Western blotting, which specifically detects phosphorylation as a shift in mobility of the band (Fig. 4B), and by blotting with an antibody, which specifically recognizes one of the known phosphorylation sites in RIPK1, Ser166 (fig. S7A). The intensi-ty of the bands recognized by a RIPK1 Ser166 phosphorylation-specific antibody was reduced by knockdown of RIPK1, confirming that

A

B

H1299

5.3%

A549

*U251MG*SW480

67.2%

PI incorporation

PI incorporation

1.4%

% o

f max

% o

f max

% o

f max 2.8%

33.1%2.1%

6.0%3.6%

2.4%1.0%

34.3%

*U2OS

1.2%

A549 H1299U2OS U251MG WI-38

Sensitive to glucose deprivation–induced cell death Insensitive to glucose deprivation–induced cell death

Normal cell linesCancer cell lines

+ Serum + Glucose

– Serum – Glucose

C

D

– Glucose

+ Glucose

SW480

2.2%1.7%

MCF-10A

100

80

60

40

20

0

+ DFBS + DFBS – DFBS

8 10 12

MCF-10A

MCF-10A

Cel

l dea

th (%

)

Cel

l dea

th (%

)

WI-38

IMR-90

H1299

A549

U251M

G

U2OS

SW480 16 (hours)

+ Glucose– Glucose– Glucose

7.8%4.5%

WI-38

+ DFBS + DFBS – Glucose

+ Glucose

Fig. 1. A subset of cancer cell lines is sensitive to glucose deprivation–induced cell death. (A) Propidium iodide (PI) exclusion assay using the indicated cell lines cultured in the presence or absence of both 10% serum and 25 mM glu-cose for 4 hours (U2OS), 6 hours (U251MG), or 8 to 10 hours (remaining cell lines). A representative analysis from three independent experiments is shown. The percentage of PI-positive dead cells is shown. Asterisk (*) indicates cell lines sensitive to glucose deprivation. (B) PI exclusion assay using the indicated cell lines cultured in media contain-ing 10% dialyzed fetal bovine serum (DFBS) with or without 1 mM glucose for 16 hours. Shown is the mean percentage of dead cells ± SD from three independent experiments. (C) Time course of PI exclusion assay in U2OS cells cultured with or with-out 10% DFBS and 1 mM glucose for the indicated periods. Shown is the mean percentage of dead cells ± SD from three independent experiments. (D) Representative images from phase-contrast microscopy from three independent experiments. Cells were cultured in media containing 10% DFBS with or without 1 mM glucose for 10 hours. Scale bars, 50 m.

on October 20, 2020


Dow

nloaded from




4 of 18

detected bands were RIPK1-specific (fig. S7A). To further confirm phos-phorylation of RIPK1 by glucose deprivation, we treated the protein lysates with phosphatase, a serine/threonine/tyrosine phosphatase. After digesting protein lysates with phosphatase, the RIPK1 mobil-ity shift caused by glucose depletion was attenuated in U2OS cells (Fig. 4C), indicating that the RIPK1 mobility shift was due to phos-phorylation. Glucose deprivation–induced RIPK1 mobility shift was also observed in other glucose deprivation–sensitive cancer cell lines (U251MG and SW480), and these shifts were attenuated by phos-phatase treatment (fig. S7, B and C). These results show that the phos-phorylation of RIPK1 by glucose deprivation is conserved in multiple glucose deprivation–sensitive cancer cells.

Treatment with 2-DG ablated the detection of phosphorylated RIPK1 in glucose-deprived conditions (Fig. 4A), consistent with our aforementioned observation that 2-DG prevented cell death induced by the lack of glucose (Fig. 2B). To test whether RIPK1 is required for glucose deprivation–induced cell death, we knocked down RIPK1 ex-pression in U2OS cells using each of two independent siRNAs (fig. S7A). RIPK1 knockdown significantly restored U2OS cell viability at 4 hours of glucose withdrawal (Fig. 4D) and delayed the U2OS cell death in-duced by glucose deprivation, as indicated by a delay in the induction of morphological changes associated with cell death monitored up to 12 hours of glucose withdrawal (fig. S8A). Similarly, we knocked down RIPK1 in U251MG and SW480 cells (fig. S8, B and C) and ob-served that knockdown of RIPK1 expression significantly restored cell viability at 6 hours of glucose withdrawal (fig. S8, D and E). These re-sults suggest that glucose deprivation–induced cell death is RIPK1-

dependent in multiple glucose depriva-tion–sensitive cancer cell lines.

RIPK1 is one of the key components for necroptosis. One of the inhibitors for necroptosis is necrostatin-1, which inhib-its RIPK1 kinase activity (43). Although the cell death we observed is RIPK1- dependent, the addition of necrostatin-1 did not prevent glucose deprivation– induced cell death, as shown by phase- contrast images at 4 hours (fig. S9A) and by fluorescent images of cells stained with PI at 16 hours (Fig. 4E). These results sug-gest that this cell death is not necroptosis. Subsequently, we found that the presence of RIPK3, which is an important compo-nent in the necroptosis pathway down-stream of RIPK1, was undetectable in U2OS cells compared to HT29 cells (Fig. 4F). HT29 cells are known to undergo necro-ptosis after treatment with a combination of tumor necrosis factor– (TNF-), cy-cloheximide (CHX), and Z-VAD-FMK (Fig. 4G) (44). Undetectable abundance of RIPK3 in U2OS cells suggests that necroptosis may not have been induced in U2OS cells. The combination treatment of TNF-, CHX, and Z-VAD-FMK was not able to trigger cell death in U2OS cells (Fig. 4G), although it induced RIPK1 phos-phorylation (Fig. 4H). The same treatment induced necroptosis in HT29 cells, and

HT29 cell death was prevented by a necroptosis inhibitor, necrostatin-1 (Fig. 4G).

Notably, the pattern of phosphorylated RIPK1 upon glucose depri-vation was different from the one induced by the combination treat-ment with TNF-, CHX, and Z-VAD-FMK (fig. S9B), suggesting that upon glucose deprivation, RIPK1 may undergo different posttransla-tional modifications, for example, phosphorylation at different sites or a combination of phosphorylation and other modifications. Whereas RIPK1 phosphorylation by a combination treatment of TNF-, CHX, and Z-VAD-FMK in U2OS cells was prevented by necrostatin-1 (Fig. 4H), RIPK1 phosphorylation by glucose removal was not blocked by necrostatin-1 (fig. S9C). The inability of necrostatin-1 to prevent glucose deprivation–induced RIPK1 phosphorylation and cell death suggests that the glucose deprivation–induced RIPK1 phosphoryla-tion is not due to RIPK1 autophosphorylation and that RIPK1 kinase activity is not required for glucose deprivation–induced cell death. Together, these data suggest that glucose deprivation induces RIPK1- dependent cell death that is not necroptosis.

Glucose deprivation induces PP2Ac demethylationNext, we investigated the upstream regulation of RIPK1 phosphoryl-ation upon glucose deprivation. We noticed that the RIPK1 electro-phoretic mobility shift after glucose deprivation was similar to that of cells treated with an inhibitor of serine/threonine phosphatases calyculin A in the presence of glucose (fig. S10A). We assessed the phosphorylation of other intracellular proteins that have rapid intra-cellular phosphorylation/dephosphorylation cycles by Phos-tag Western

B

+ 2-DG

C

A

(1 mM)

Glucose+ –

+2-DG (1 mM) –

++

––

–+

Glucose (1 mM)

***

***

Sodiumpyruvate (1 mM)

+–

––

– – + +– –

Cel

l dea

th (%

)

– Glucose

– Glucose + 2-DG

Glucose (1 mM)

+ Sodium pyruvate(1 mM)

***

Rel

ativ

eAT

P le

vel

MCF-10A

WI-38

IMR-90

H1299

A549

U251M

G

U2OS

SW480

0.5

1.0

1.5

0

Fig. 2. Glucose deprivation–induced cell death is independent of ATP depletion. (A) Intracellular adenosine 5′-triphosphate (ATP) amount in U2OS cells treated as indicated for 4 hours. Bars represent the mean (±SD) amount of ATP in each sample relative to the control condition (first bar), quantified from more than three independent experiments. ***P < 0.001, unpaired two-tailed Student’s t test. (B) PI exclusion assay with the indicated cell lines cultured with or without 1 mM 2-deoxy- d-glucose (2-DG) in the absence of glucose for 16 hours. Bars represent the mean percentage of cell death ± SD of three independent experi-ments. (C) Representative phase-contrast images of U2OS cells from three independent experiments. U2OS cells were treated as indicated for 4 hours. Scale bar, 50 m.

on October 20, 2020


Dow

nloaded from




5 of 18

blotting and found that the PP2A substrates casein kinase 1 (CSNK1D) and dishevelled segment polarity protein 2 (DVL2) (45–47) were also phosphorylated after glucose deprivation in U2OS cells (fig. S10B). On the basis of these results, we speculated that there was reduced activity of PP2A (serine/threonine phosphatase) upon glucose depri-vation. Because PP2A activity can be reduced by demethylation of its catalytic subunit, PP2Ac (18, 19), we examined the effect of glucose deprivation on PP2Ac demethylation. We observed induction of PP2Ac demethylation after glucose withdrawal (Fig. 5A). NaOH-treated ex-tracts, which contain fully demethylated PP2Ac (48), was used as a positive control (Fig. 5A). These data suggest a role for demethylation of PP2Ac in the accumulation of phosphorylated RIPK1 and cell death. PP2Ac demethylation is downstream of 2-DG, because the addition of 2-DG blocked PP2Ac demethylation caused by glucose deprivation (Fig. 5B). In addition to U2OS cells, the other sensitive cancer cell lines U251MG and SW480 also had PP2Ac demethylation upon glu-cose withdrawal, which was attenuated by addition of 2-DG (Fig. 5C and fig. S10C). On the other hand, the amounts of demethylated PP2Ac remained low in the cancer cell lines A549 and H1299 and the normal cell lines WI-38, IMR-90, and MCF-10A that were resistant to glucose deprivation–induced cell death (Fig. 5C and fig. S10C). As we expected, supplementation with pyruvate did not inhibit PP2Ac demethylation (Fig. 5D), consistent with our aforementioned findings that glucose deprivation–induced cell death was independent of ATP amount

(Fig. 2C). Finally, concentrations of glu-cose as low as 0.025 mM prevented PP2Ac demethylation (Fig. 5E), consistent with the ability of glucose to prevent cell death (fig. S1B). The prevention of PP2Ac de-methylation with this extremely low glucose concentration suggests that the PP2A- related cell death pathway may be distinct from well-known nutrient stress pathways, such as AMPK-mTOR (mechanistic target of rapamycin kinase) signaling, which is triggered by low (~1 mM) glucose (49), as in the physiological tumor environment. Consistent with a previous report (49), shifting from high glucose (25 mM) to low glucose (1 mM) in the culture media induced AMPK activation, as evidenced by Thr172 phosphorylation (Fig. 5F) (50, 51). However, shifting from low glucose (1 mM) to no glucose (0 mM) did not further in-duce, but rather diminished, AMPK phos-phorylation (Fig. 5F). Only the absence of glucose condition could induce PP2Ac demethylation and RIPK1 phosphoryl-ation, whereas the low glucose (1 mM) condition did not (Fig. 5F), suggesting that AMPK activation is not involved in triggering PP2Ac demethylation and RIPK1 phosphorylation. AMPK knockdown also did not affect PP2Ac demethylation and RIPK1 phosphorylation after glucose dep-rivation (fig. S6A), consistent with an in-ability to prevent cell death by AMPK knockdown (fig. S6B). Furthermore, we evaluated mTOR kinase pathway activity,

which is inhibited by AMPK activation (52). A marker of mTOR activation, namely, phosphorylation of the mTOR substrate S6 did not change regardless of the presence or absence of glucose (fig. S11). In addition, knockdown of ATG5, ATG7, ATG12, and BECN1 did not affect PP2Ac demethylation and RIPK1 phospho rylation after glucose deprivation (fig. S5, B to E). Together, these results indicate that PP2Ac demethylation and RIPK1 phosphoryl ation induced by glucose deprivation are independent of the AMPK-mTOR-autophagy– regulated nutrient stress pathway.

PP2Ac demethylation is required for cell death induced by glucose withdrawalTime course experiments after glucose withdrawal revealed that de-methylated PP2Ac was reproducibly detectable as a spike in abun-dance 15 min after glucose deprivation and then increased steadily from 1 hour onward (Fig. 6A). RIPK1 phosphorylation was observed after PP2Ac demethylation (Fig. 6A). These data suggest that PP2Ac demethylation precedes RIPK1 phosphorylation and cell death. To test this, we knocked down RIPK1 and monitored PP2Ac de-methylation. Although knockdown of RIPK1 restored cancer cell viability (Fig. 4D), it did not substantially affect the induction of PP2Ac demethylation by glucose deprivation (Fig. 6B), confirming that PP2Ac demethylation precedes RIPK1 phosphorylation and cell death.

B

C

A+ Glucose (1 mM) – Glucose

Z-VAD -FMK

PI staining PI staining

D

Glucose UV

Z-VAD -FMK

Z-VAD -FMK

Cleaved PARP1Cleaved CASP3

Actin

ctrl

ATG7

+ Glucose – Glucose

Cel

l dea

th (%

)

ctrl 1 2 1 2 3 1 2

ATG12 BECN1ATG5

ATG5

ATG7 ATG12 BECN11 2 1 2 3 1 2

(1 mM)– Glucose+ Glucose

0 10 25 0 10 25Chloroquine (µM)

Cel

l dea

th (%

)

(1 mM)siRNA

UV+ –

Fig. 3. Glucose deprivation does not induce apoptosis or autophagy. (A) Representative Western blotting from three independent experiments of U2OS cells cultured with or without 1 mM glucose for 4 hours. Lysate from ultra-violet (UV)–irradiated U2OS cells serves as a positive control for apoptosis. Z-VAD-FMK was used to inhibit caspase activation. (B) Representative phase-contrast and fluorescent images of three independent experiments. U2OS cells were cultured as indicated for 16 hours and stained with PI before imaging. Z-VAD-FMK was used to inhibit apoptosis. Scale bars, 50 m. (C) PI exclusion assay with U2OS cells transfected small interfering RNA (siRNA) against the indicat-ed autophagy-associated mRNAs or a control (ctrl) and cultured with or without 1 mM glucose for 4 hours. Shown is the mean percentage of dead cells ± SD from more than three independent experiments. (D) PI exclusion assay with U2OS cells pretreated with or without chloroquine for 12 hours followed by the indicated treatments for 4 hours. Shown is the mean percentage of dead cells ± SD from three independent experiments. on O

ctober 20, 2020http://stke.sciencem

ag.org/D

ownloaded from




6 of 18

We reasoned that glucose deprivation could promote PP2Ac de-methylation either by inhibiting the methylation of newly synthesized, unmethylated PP2Ac or by demethylating the existing, methylated PP2Ac. To distinguish between these possibilities, we treated the cells with CHX to inhibit new protein synthesis. Glucose withdrawal effi-ciently induced PP2Ac demethylation, even in the presence of CHX (Fig. 6C). This is consistent with active demethylation of the exist-ing, methylated PP2Ac after glucose removal.

PPME1 is the only known enzyme that demethylates PP2Ac, and no other substrate of PPME1 is known (19, 20). To determine whether

demethylation of PP2Ac by PPME1 is required for cell death, we knocked down PPME1 using two independent siRNAs and moni-tored PP2Ac demethylation and cell death after glucose withdrawal. PPME1 knockdown inhibited PP2Ac demethylation and RIPK1 phosphorylation (Fig. 6D) and significantly prevented cell death at 4 hours of glucose withdrawal in U2OS cells (Fig. 6, E and F). This effect was not cell type–specific, because PPME1 knockdown in-hibited PP2Ac demethylation and protected the cells from death in other glucose depletion–sensitive cell lines SW480 and U251MG (fig. S12, A and B). Time-lapse microscopy showed that PPME1 knockdown

+ Necrostatin-1

+ Glucose (1 mM) – Glucose

PI staining PI staining

A B

F

D

HT29

Nec

U2OS

U2OS HT29

+ –

RIPK3

Actin

CHXZ-VAD-FMK

TNF-αCHX

Z-VAD-FMK

TNF-α

Nec

+ –

sictrl siRIPK1 #1

siRIPK1 #2

Cel

l dea

th (%

)

***

***

+ Glucose

C

E

RIPK1

Actin


+ 2-DG (1 mM)

RIPK1

+ –

Actin

Phos-tag

75

75

Mr(K)Mr(K)

+ – + –

λ phosphatase

75 RIPK1

Actin

G

CHXZ-VAD-FMK

TNF-α

Nec

U2OSHT29

+++–

–––+

++++

+++–

–––+

++++

––––

––––

pRIPK1S166

RIPK1

Actin

150

100

75

Mr(K)

H

(1 mM)Glucose (1 mM)

– Glucose

Mr(K) Glucose (1 mM)

Glucose (1 mM)

(10 µM)

Fig. 4. Glucose deprivation induces RIPK1- dependent cell death. (A to C) Representative Western blotting of U2OS cells cultured as indi-cated for 4 hours. Western blotting analysis were performed by regular SDS–polyacrylamide gel electrophoresis (PAGE) (A), Phos-tag SDS-PAGE (B), or regular SDS-PAGE using phosphatase–digested lysates (C). All blots are representative of three independent experiments. (D) PI exclusion assay of siRNA-transfected U2OS cells cultured with or without 1 mM glucose for 4 hours. The mean percentage of dead cells ± SD from more than three independent experiments is shown. ***P < 0.001, unpaired two-tailed Student’s t test. (E) Repre-sentative phase- contrast and fluorescent images from three independent experiments of U2OS cells cultured as indicated for 16 hours and stained with PI before imaging. Scale bars, 50 m. (F) Western blotting analysis for RIPK3 in cells cultured with or without 1 mM glucose for 4 hours. Blots are representative of three independent experiments. (G and H) Cells were treated with tumor necrosis factor– (TNF-), cycloheximide (CHX), Z-VAD-FMK, and necrostatin-1 (Nec) as indicated for 14 hours. Phase-contrast images are shown (G), and protein lysates were analyzed by Western blotting (H). Data are representative of three in-dependent experiments. Scale bars, 50 m.

on October 20, 2020


Dow

nloaded from




7 of 18

delayed U2OS cell death after glucose deprivation (movies S3 to S6). Delay, but not complete prevention, of cell death could be due to incom-plete knockdown of PPME1 (Fig. 6D). Together, these data sug gest that PP2Ac demethylation by PPME1 is necessary for glucose depriva-tion–induced cell death.

Glucose deprivation triggers a cytosolic influx of calciumWe next investigated the mechanism by which glucose deprivation in-duced PP2Ac demethylation and cancer cell death. Glucose deprivation activates calmodulin-dependent protein kinases in Schizosaccharomyces pombe (53, 54), and PPME1 is phosphorylated by CAMK1 (22). There-fore, we tested whether CAMK1 is necessary for glucose deprivation–

induced PP2Ac demethylation and cell death. We used two independent siRNAs to knock down CAMK1 in U2OS cells (Fig. 7A). Each of these CAMK1 siRNAs attenuated PP2Ac demethylation and RIPK1 phos-phorylation (Fig. 7A) and significantly reduced cell death at 4 hours of glucose deprivation (Fig. 7B). CAMK1 knockdown delayed U2OS cell death after glucose deprivation, as shown by delayed morphological changes monitored up to 12 hours (fig. S13A). These results indicate that CAMK1 critically mediates these phenotypes.

Because CAMK1 is regulated by intracellular calcium concentra-tion (23), we investigated whether glucose deprivation affects the amount of calcium in cells. U2OS cells were incubated with the flu-orescent calcium indicator Fluo-4AM. We found that U2OS cells

A B

E

U251MG

RIPK1

De-Me PP2Ac

Actin

RIPK1

A549

De-Me PP2Ac

Actin

RIPK1

WI-38

De-Me PP2Ac

Actin

C

GlucoseSodiumpyruvate (1 mM)

De-Me PP2Ac

Actin

025

–1

+ –

1

+ +

0 (mM)

De-Me PP2Ac

Actin

+ Glucose – Glucose+ 2-DG (1 mM)


+ 2-DG (1 mM)+ Glucose – Glucose

+ 2-DG (1 mM)


+ 2-DG (1 mM)

U2OSGlucoseSerum

De-Me PP2Ac

++ –

–NaOH+––

++

Me PP2Ac

PP2Aa

Total PP2Ac

Actin

25 0 0.025 0.05

De-Me PP2Ac

Actin

0.1 0.5

D

(mM)Glucose

75 75

75

Mr(K) Mr(K)

Mr(K)

Total PP2Ac

Total PP2Ac

Total PP2Ac

Total PP2Ac

Total PP2Ac

Total PP2Ac

De-Me PP2Ac

p-AMPK(T172)

25 1 0 Glucose (mM)

RIPK1

AMPK

Actin

F

Total PP2Ac

75

Mr(K)

(1 mM)

(1 mM)

(1 mM)

(1 mM)

Fig. 5. Glucose deprivation induces PP2Ac de-methylation. (A) Western blotting analysis for PP2Ac in U2OS cells cultured as indicated for 4 hours. NaOH-treated protein extract was used as a positive control for fully demethylated PP2Ac. Blots are representative of three independent experiments. (B and C) Western blotting analysis for PP2Ac in the indicated cell lines treated as indicated for 4 hours. Biological duplicates are shown for each condition. Blots are representative of three independent experiments. (D) Western blotting analysis for PP2Ac in U2OS cells treated as indicated for 4 hours. Blots are representative of three independent experiments. (E) Western blotting analysis for PP2Ac in U2OS cells cultured with various doses of glucose as indicated for 4 hours in the absence of serum. Blots are rep-resentative of three independent experiments. (F) Western blotting analysis in U2OS cells cultured with a different dose of glucose as indicated for 4 hours. Blots are representative of three indepen-dent experiments.

on October 20, 2020


Dow

nloaded from




8 of 18

cultured in the absence, but not in the presence, of glucose displayed green fluorescence (Fig. 7, C and D), indicating that glucose with-drawal increased the intracellular calcium concentration significantly. In addition, we found that the other glucose depletion–sensitive cell lines U251MG and SW480 displayed cytosolic calcium staining in the absence of glucose but that the insensitive cancer cell lines A549 and H1299 and the normal cell lines IMR-90 and MCF-10A did not (fig. S13B). Furthermore, 2-DG blocked the increase in intracellular calcium induced by glucose deprivation (Fig. 7, C and D). Thus, a cytosolic calcium influx correlates with the PP2Ac demethylation and cell death phenotypes regulated by glucose and 2-DG. Next, we characterized the calcium signaling induced by glucose deprivation. Time-lapse microscopy was used to evaluate the kinetics of changes

in intracellular calcium upon glucose withdrawal. Cytosolic calcium staining became pronounced within 10 min of glucose deprivation (movies S7 and S8), which is earlier than the PP2Ac demethylation (Fig. 6A). Consistent with these data, knockdown of CAMK1, PPME1, or RIPK1 did not affect the calcium influx induced by glucose dep-rivation (fig. S13C), suggesting that calcium influx precedes CAMK1 activation, PP2Ac demethylation, and RIPK1-dependent cell death.

The increase in cytosolic calcium could be due to an influx of calcium from outside of the cell or from calcium storage organelles within the cells. To determine the source of calcium, we compared the effects of nifedipine, an antagonist of L-type voltage-sensitive cal-cium channels on the plasma membrane (55), and ruthenium red (RR),

A

C

F

D

PPME1

Actin

sictrlsiPPME1

#1

E

siPPME1#2

#1 #2

– Glucose+ Glucose

ctrl #1 #2


ctrl #1 #2 ctrl #1 #2

De-Me PP2Ac

RIPK1

Actin

ctrl

RIPK1

De-Me PP2Ac

Actin

0 30 180 0 30 180

+ Cycloheximide

– Glucose

TP53

B

sictrl siPPME1 #1

siPPME1 #2

– Glucose

+ Glucose

(1 mM)

0 5 15 30 60 120 180150

– Glucose

90

RIPK1

Actin

(min)

(min)

De-Me PP2Ac

De-Me PP2Ac

+ Glucose–

(1 mM)

(1 mM)

75

7575

Total PP2Ac

Total PP2Ac

Total PP2Ac

Total PP2Ac

**

*

siRNAPPME1 PPME1

siRNARIPK1 RIPK1

Mr(K)

Mr(K)

Mr(K)

Cel

l dea

th (%

)

Glucose

Fig. 6. PP2Ac demethylation is required for glu-cose deprivation–induced cell death. (A) Time course of Western blotting analysis in U2OS cells cultured in the absence of both serum and glucose for the indicated time. Blots are repre-sentative of three independent experiments. (B) Western blotting analysis in siRNA-transfected U2OS cells cultured with or without 1 mM glucose for 4 hours. Blots are representative of three in-dependent experiments. (C) Western blotting analysis. U2OS cells were grown with or without cycloheximide in the absence of glucose and serum, for the indicated time. TP53 was used as a positive control for the effect of CHX. Blots are representative of three independent experiments. (D) Western blotting analysis in siRNA-transfected U2OS cells cultured with or without 1 mM glu-cose for 4 hours. Blots are representative of three independent experiments. (E) Representative phase-contrast images of siRNA-transfected U2OS cells cultured as in (D). Results are representative of three independent experiments. Images were taken by IncuCyte ZOOM System. Scale bar, 50 m. (F) PI exclusion assay using siRNA-transfected U2OS cells treated as in (D). Shown is the mean percentage of dead cells ± SD from more than three independent experiments. **P < 0.01, *P < 0.05, unpaired two-tailed Student’s t test.

on October 20, 2020


Dow

nloaded from




9 of 18

an inhibitor of calcium release from the intracellular stores, on the increased calcium after glucose deprivation. We found that nifedipine but not RR prevented the glucose deprivation–induced calcium influx (Fig. 7, E to H), PP2Ac demethylation (Fig. 7, I and J), and cell death

(Fig. 7K). These data support a model in which glucose deprivation induces an influx of calcium from outside the cell, which in turn trig-gers CAMK1 activation, PPME1-mediated PP2Ac demethylation/inactivation, and RIPK1-dependent cell death.

Fig. 7. Glucose deprivation induces calcium signaling. (A and B) siRNA- transfected U2OS cells were cultured with or without glucose for 4 hours. Protein lysates were analyzed by Western blotting (A). The mean percentage of dead cells ± SD an-alyzed by PI exclusion assay is shown in (B). **P < 0.01, unpaired two-tailed Student’s t test. Data are from three independent experiments. (C to H) U2OS cells were cultured as indicated for 4 hours and stained with Fluo-4AM for intracellular calcium before imaging. Representative phase-contrast and fluorescent images of cells are shown (C, E, and G; scale bars, 50 m), and intracellular calci-um amounts were quantified (D, F, and H) relative to the control condition (first bar). Data are means ± SD from three independent experiments. ***P < 0.001, unpaired two-tailed Student’s t test. (I to J) Western blotting analysis. U2OS cells were treated as indicated for 4 hours. Blots are representative of three independent experiments. (K) PI exclusion assay of U2OS cells treated as indicated for 4 hours. Bars are mean percentage of dead cells ± SD from three independent experiments.

DC

A+ Glucose

Actin

– Glucose

CAMK1

ctrl ctrl

CAMK1

#1 #1

CAMK1

#2 #2

– Glucose

+ 2-DG

+ Glucose (1 mM)

E F

+ Nifedipine

sictrl siCAMK1 #1

siCAMK1 #2

Nifedipine – – + +


Nifedipine (µM)0

Actin

De-Me PP2Ac

1 2.5 0 1 2.5

(1 mM)

(1 mM)

(1 µM)

(1 µM)

– Glucose

G H

RIPK1

(1 mM)

Cel

l dea

th (%

)

Cel

l dea

th (%

)

B

De-Me PP2Ac

Actin

Ruthenium red (µM)


0 1010 0

+ Ruthenium red (10 µM)

+ Glucose – Glucose(1 mM)

(1 mM)

75

Mr(K)

****

Total PP2AcTotal PP2Ac

Total PP2Ac

+2-DG (1 mM) –

––

+ +

–+

*** ***

(1 mM)R

elat

ive

mea

n flu

ores

cenc

e

Glucose

I J

K

+ Glucose R

elat

ive

mea

n flu

ores

cenc

e

+Ruthenium red (10 µM) –

––

+ +

–+

(1 mM) Glucose

+Nifedipine (1 µM) –

––

+ +

–+

(1 mM) Glucose

Rel

ativ

e m

ean

fluor

esce

nce(1 mM)

De-Me PP2Ac

+ Glucose– Glucose

+ Glucose– Glucose

siRNA

on October 20, 2020


Dow

nloaded from




10 of 18

Voltage-sensitive calcium channel Cav1.3 (CACNA1D) is required for glucose depletion–induced cell deathBecause nifedipine inhibited calcium influx and cell death induced by glucose deprivation, we investigated the calcium channels that were potentially involved in this pathway. Nifedipine affects L-type calcium channels. There are four L-type calcium channels that differ in their -1 subunits: CACNA1S (also known as Cav1.1), CACNA1C (also known as Cav1.2), CACNA1D (also known as Cav1.3), and CACNA1F (also known as Cav1.4). We examined the mRNA expression of these chan-

nels in U2OS cells and found that only CACNA1C and CACNA1D were expressed (Fig. 8A). We depleted CACNA1C and CACNA1D by RNA interference (fig. S14) and found that knockdown of CACNA1D but not CACNA1C prevented calcium influx, PP2Ac demethylation, and morphological changes associated with cell death after glucose deprivation (Fig. 8, B and C), suggesting that CACNA1D is required to trigger this cell death pathway.

L-type calcium channels are voltage sensitive and open in response to plasma membrane depolarization (27, 28). We therefore investigated whether depolarization occurred after glucose deprivation. We stained

C

A

Actin

De-Me PP2Ac

CACNA1D#1 #2 ctrlctrl #1 #2

CACNA1CCACNA1C

+ Glucose (1 mM) – Glucose + Glucose (1 mM) – Glucose

#1 #2 ctrl CACNA1D

ctrl #1 #2

D

cDNA + +– + – + – + ––TBP CACNA1D CACNA1F CACNA1SCACNA1C

100 bp200 bp

100 bp200 bp

B

E

*** ***

0

1

2

3

+ + 2-DG

– – – – – + KCl

U2OS

0

1

2

3

+ ++ Nifedipine

U2OS

Rel

ativ

e flu

ores

cenc

e in

tens

ity

Rel

ativ

e flu

ores

cenc

e in

tens

ity ***

Actin

De-Me PP2Ac

F

(1 µM)+ Nifedipine

+ Glucose – Glucose+ 2-DG– Glucose + Glucose

+ KCl (120 mM)

H1299

+ + 2-DG

+ + KCl

0

1

2

3

Rel

ativ

e flu

ores

cenc

e in

tens

ity

G

Total PP2Ac Total PP2Ac

Glucose(1 mM)

esoculGesoculGesoculG

)Mm 1()Mm 1(

Marker

(1 mM)

siRNAsictrl

D1ANCAC C1ANCAC

#1 #2 #1 #2+ – + –+ – + – + –

siRNA siRNA

– +

Fig. 8. Glucose deprivation induces plasma membrane depolarization. (A) Representative reverse transcription polymerase chain reaction (RT-PCR) for the expression of L-type calcium chan-nel -1 subunits in U2OS cells from three indepen-dent experiments. PCR products were visualized by agarose gel electrophoresis. PCRs without a cDNA were included as negative controls. Expression of TATA box-binding protein (TBP) is shown as a pos-itive control for amplification. (B and C) siRNA- transfected U2OS cells were cultured with or without 1 mM glucose for 4 hours. Cells were stained with Fluo-4AM for intracellular calcium before imaging. Representative phase-contrast and fluorescent images of cells are shown in (B). Scale bars, 50 m. Protein lysates were analyzed by West-ern blotting analysis (C). Data are representative of three independent experiments. (D) Represen-tative fluorescent images of DiBAC4-stained U2OS cells for membrane depolarization from three independent experiments. Cells were placed in media as indicated. KCl serves as a positive control. Scale bar, 50 m. (E to G) Quantification of mem-brane depolarization from more than three inde-pendent experiments. DiBAC4- stained cells were placed in media as indicated, and fluorescent in-tensity was measured by a plate reader. Bars rep-resent mean (±SD) DiBAC4 fluorescence in each sample relative to the control (first bar). *** P < 0.001, unpaired two-tailed Student’s t test.

on October 20, 2020


Dow

nloaded from




11 of 18

Fig. 9. Therapeutic intervention targeting calcium signaling and glucose transport. (A) Intracellu-lar glucose amounts in cells cul-tured with or without 25 mM glucose for 4 hours in the absence of serum. Intracellular glucose amounts were normalized against the total protein amount. Shown are means ± SD from three inde-pendent replicates. Asterisk (*) in-dicates cell lines that are sensitive to glucose deprivation. (B) West-ern blotting analysis for PP2Ac in cells cultured as indicated with 1 mM glucose without serum for 1 day. Blots are representative of three independent experiments. (C) Representative fluorescent images of Fluo-4AM–stained cells for intracellular calcium amounts. Cells were cultured with or with-out STF-31 in the presence of 1 mM glucose and absence of se-rum for 1 day. Cells were stained with Fluo-4AM before imaging. Images were representative of three independent experiments. Scale bars, 50 m. (D) A represent-ative analysis of PI exclusion assay in cells cultured as described in (B). Shown is the percentage of PI-positive dead cells from three independent experiments. (E) Schematic model of glucose deprivation–induced cell death. A, B, and C are PP2A complex subunits; Me, methylation; P, phosphorylation.

D

BA

18.3%4.4% 11.2% 67.7%

+ STF-31

+ +

De-Me PP2Ac

Actin

E

C

Glucose deprivation

Ca2+

Ca2+

Ca2+

Ca2+

AB

C PRIPK1

PPME1

CAMK1

% o

f max

De-Me PP2Ac

Actin

U2OS

WI-38

U2OS WI-38

+ STF-31

U2OS

WI-385.8%3.0%9.1%3.7%

PI incorporation

% o

f max

STF-31Thapsigargin

+ STF-31 + Thapsigargin + STF-31 + thapsigargin

PP2A

Total PP2Ac

Total PP2Ac

Ca2+

AB

CRIPK1

PPME1

CAMK1

PP2A +

+

+

+

+

+

+

++

CaCa

Ca

2+

2+

2+

++

+

+

++

+

++

++

+

+

+

+

+

––

–

–

–

–

–

–

– –

–

– –

–

–––

–

–

––

–

* * *

(12.5 µM)

(12.5 µM)

(10 nM)

Me

MCF-10A

* *

Glu

cose

( µM

)/pro

tein

(µg)

Cell death

+ Glucose

Glucose–

WI-38

IMR-90

H1299

A549

U251M

G

U2OS

SW480

SaOS2

U87MG

+ +

on October 20, 2020


Dow

nloaded from




12 of 18

U2OS cells with DiBAC4, an oxonol fluorescent dye that detects plasma membrane depolarization (56). U2OS cells displayed depolarization after glucose deprivation (Fig. 8, D and E). KCl (120 mM) was used as a positive control because it is known to induce plasma membrane depolarization (56). As we expected, 2-DG inhibited glucose deprivation– induced depolarization (Fig. 8, D and E), consistent with its ability to prevent PP2Ac demethylation and cell death (Fig. 5B and 2B). We did not observe membrane depolarization of the insensitive cancer cell line H1299 upon glucose deprivation (Fig. 8F).

We also tested whether membrane depolarization was upstream of the induction of calcium influx. We treated U2OS cells with nifedipine in the presence or absence of glucose and stained the cells with DiBAC4. Although nifedipine completely inhibited calcium influx (Fig. 7, E and F), it did not inhibit membrane depolarization, as shown by the DiBAC4 fluorescence (Fig. 8, D and G), suggesting that plasma mem-brane depolarization precedes calcium influx upon glucose deprivation.

Targeting calcium signaling and glucose transport is a potential therapeutic interventionMicromolar concentrations of glucose or 2-DG were sufficient to pre-vent cell death (figs. S1B and S2A). We hypothesized that the cell lines that are resistant to glucose deprivation–induced cell death may have higher intracellular glucose levels that protect cells from death after extracellular glucose withdrawal. We measured intracellular glucose amounts of the cells cultured in the presence or absence of glucose for 4 hours and found that resistant cancer cell lines A549 and H1299, as well as normal primary fibroblasts IMR-90 and WI-38 cells and non-transformed epithelial MCF-10A cells, maintained higher amounts of intracellular glucose compared to sensitive cell lines (SW480, U2OS, U251MG, SaOS2, and U87MG) after glucose withdrawal (Fig. 9A). Thus, intracellular glucose amounts correlated well with the sensitivity to glucose removal.

The inability of these sensitive cancer cell lines to maintain baseline intracellular glucose amounts upon glucose deprivation prompted us to investigate whether this unique metabolic property in cancer cells could be therapeutically targeted without affecting normal cells. Be-cause it is impractical to completely deplete the source of glucose for cancer cells in patients, we evaluated the effects of STF-31, an inhibitor of the glucose transporter GLUT1 (8), on a sensitive cancer cell line U2OS cells and a normal primary cell line WI-38 cells. We reasoned that STF-31 may induce cell death in U2OS cells, whose intracellular glucose was not maintained upon glucose removal, but not in WI-38 cells, which maintained relatively high intracellular glucose upon glucose removal. We found that STF-31 induced slight PP2Ac demethylation and increased intracellular calcium amounts in U2OS cells but not in WI-38 cells (Fig. 9, B and C, and fig. S15). These data suggest that inhibition of glucose transport by STF-31 reduced the intracellular glucose enough to trigger calcium signaling in U2OS cells but not in WI-38 cells.

Given our findings that an influx of calcium promoted PP2Ac demethylation, we enhanced the induction of intracellular calcium by treating cells with a combination of STF-31 and thapsigargin, which increases cytosolic calcium concentrations by inhibiting the sarcoplasmic/endoplasmic reticulum Ca2+–adenosine triphosphatase (SERCA). U2OS cells treated with a combination of STF-31 and thapsigargin had more demethylated PP2Ac than cells treated with either drug alone (Fig. 9B). Treatment with either drug alone or in combination did not increase the amount of demethylated PP2Ac in WI-38 cells (Fig. 9B). We found that a combination of STF-31 and thapsigargin caused enhanced cell death in U2OS cells compared to either drug

alone (Fig. 9D). By contrast, WI-38 cells did not undergo cell death after treatment with STF-31 or thapsigargin alone or in combination (Fig. 9D). Therefore, cancer cells that are sensitive to glucose depriva-tion can potentially be specifically targeted by combining glucose trans-port inhibition with enhanced cytosolic calcium accumulation without affecting normal cells.

DISCUSSIONSome cancer cell types are dependent on glucose and aerobic glycol-ysis and subsequent lactic acid fermentation, rather than oxidative phosphorylation, to fuel cell functions and survival, a phenomenon called the Warburg effect (4). However, in this study, we found that the differential sensitivity of some cancer cell lines to glucose depriva-tion was independent of the Warburg effect and the inhibition of gly-colysis and instead correlated with the intracellular amount of glucose and the demethylation status of PP2Ac. In cells that were sensitive to it, glucose deprivation triggered plasma membrane depolarization, which led to an influx of calcium, CAMK1- and PPME1-dependent PP2Ac demethylation, RIPK1 phosphorylation, and the subsequent induction of RIPK1-dependent cell death (Fig. 9E), a process prevented by the glucose, as well as the glucose analog and glycolytic inhibitor 2-DG.

2-DG has been tested as a potential therapeutic agent because it inhibits glycolysis (57, 58). It also inhibits N-glycosylation (59) to in-duce cell death. However, we found that as little as 0.025 mM 2-DG (or glucose) was protective rather than inhibitory of cell survival in a subset of cancer cell lines. At this low concentration, it is unlikely that glycolysis is fully functional. The Km (Michaelis constant) of glycolytic enzymes for glucose, 2-DG, and glucose metabolites in glycolysis range from 0.1 to 5 mM (60, 61), and thus, lower concentrations are unlikely to be sufficient to generate metabolites for the entire glycolytic pathway. Although our data do not exclude the possibility that metabolites de-rived from glucose or 2-DG may be involved, we think that the role of the glycolytic pathway in cell survival is minimal in the cell culture con-ditions used in this study.

Although both glucose and 2-DG enhance O-glycosylation in some cell types (36, 62), our data suggest that O-glycosylation is not involved in protecting cancer cells against cell death. We hypothesize that low concentrations of glucose, 2-DG, or its phosphorylated counterpart glucose-6-phosphate directly or indirectly regulate the plasma mem-brane potential to limit the influx of Ca2+ to the cytoplasm. Thus, in their absence, Ca2+ influx triggers PP2A-mediated RIPK1-dependent cell death. Notably, these findings also indicate that some glucose ana-logs (including 2-DG) prevent, rather than promote, cancer cell death and could support cancer proliferation in some contexts.

Glucose deprivation induces various types of cell death, including apoptosis (63), necrosis (64–66), necroptosis (67, 68), and autophagic cell death (69, 70). Our data suggest that RIPK1, although known to regulate apoptosis (71) and necroptosis (72), is a key mediator of glu-cose deprivation–induced cell death that is neither necroptosis nor apoptosis but might be a previously unknown type of programmed necrosis. Relative to our understanding of the signaling pathway down-stream of RIPK1, the upstream kinase(s) and phosphatase(s) of RIPK1 are unknown. Although more work is needed to firmly establish mech-anistic links, our findings reveal that PP2A is a possible direct or indirect upstream phosphatase of RIPK1. Upon glucose deprivation, RIPK1 un-derwent posttranslational modifications—namely, phosphorylation— that was apparently mediated differently from that induced by necroptosis inducers, suggesting that there are kinases and phosphatases for RIPK1

on October 20, 2020


Dow

nloaded from




13 of 18

that specifically respond to glucose deprivation. It will be interesting to explore any changes in or effects of other posttranslational modifica-tions of RIPK1, such as ubiquitylation (71, 73), alone or in combination with phosphorylation, in the cellular response to glucose deprivation.

The C-terminal methylation of PP2Ac promotes the function of the phosphatase by facilitating heterotrimer formation (74). Induc-tion of PP2Ac demethylation may therefore inactivate a subset of these PP2A complexes (14, 21, 75), thereby increasing the phosphorylation of targets. Such a mechanism would be distinct from others that in-activate PP2A heterotrimers (76), such as DNA tumor virus small T antigens (77), and mutations in the genes encoding the scaffolding PP2Aa subunit, which are found in lung and colon cancers and alter the formation of the heterotrimer (78–80). These findings suggest that the loss of specific subsets of PP2A promotes tumor formation. In contrast to some studies showing that PP2A activation is associ-ated with the induction of cancer cell death (76, 81), but consistent with others that suggest PP2A inactivation has pro–cell death roles (82–86), our data show that demethylation of a subset of PP2Ac can trigger cell death in some cancer cell lines. Thus, the effect of PP2A on tumor suppression, as well as its role in cell death, is likely influ-enced by cell context and the specific B subunits involved.

Although we found that glucose depletion induces membrane de-polarization, it is not clear precisely how it does so. Plasma membrane potential is determined by relative ion concentration, mainly of Na+ and K+, across the membrane (87). Upon membrane depolarization (that is, increased positive charge inside cells), voltage-sensitive L-type calcium channels rapidly open to trigger calcium influx to the cytoplasm, which regulates various biological processes, such as cardiac musculoskeletal contraction, neuronal transmission, and nutrient absorption (88–95). Thus, potentially, glucose deprivation–induced depolarization involves an influx of Na+ into the cells (by Na+ channel opening), a rise of intra-cellular K+ (by K+ channel closure), or a combination of both, which trig-gers calcium influx through L-type Ca2+ channels. The identification of the precise mechanism might enable therapeutic development to trig-ger cell death in glucose-dependent tumors. Furthermore, how glucose regulates the plasma membrane potential may be relevant to under-standing the function and survival of other human cell types, partic-ularly those that are highly dependent on glucose, such as neurons.

It will also be important to understand how increased Ca2+ concen-trations and consequently CAMK1 activity regulates PPME1 to de-methylate PP2Ac. Although PPME1 is phosphorylated by CAMK1 (22), it is unclear how this phosphorylation specifically affects its function. Our data and the mechanism we propose for Ca2+-CAMK1-PP2A–mediated cell death in cancer are distinct from, and in some cases are in contrast to, previously published reports related to the interactions between glucose, CAMK kinase (CAMKK), CAMK1, CAMK2, and PP2A in cell survival and cell death (53, 54, 96–98). There is also a report, albeit unrelated to glucose, showing that PP2A can inhibit CAMK1 (22), po-tentially hinting at an unknown feedback or reciprocal mechanism of regulation. These mechanistic differences may be due to differences in the cell type, species of origin, or the extent or nature of nutrient deple-tion. Whether calcium influx– and PP2Ac demethylation–mediated cell death are conserved among other species remains to be elucidated. In-creases in cytoplasmic calcium have been associated with the induction of cell death by TNF (99) or viral infection (100). It would be interesting to know whether PP2A is also involved in these processes.

Although we referred to a subset of cancer cells that undergo cell death by glucose deprivation as “sensitive” and to the others as “in-sensitive,” an exact classification is difficult because cells’ responses

to glucose deprivation vary. Even in cells that are vulnerable to glucose deprivation, the latency to cell death varies. Thus, the classification is relative and can be affected by numerous factors. A cell’s ability to salvage and retain intracellular glucose, such as through breakdown of intracellular glycogen or a reverse reaction of PPP, may enable com-pensation for a low extracellular supply of glucose. Conversely, some cancer cells that are addicted to glycolysis, such as through overexpres-sion of glycolytic enzymes (101), and/or are less efficient at glucone-ogenesis may tend to have lower amounts of intracellular glucose. Because these phenomena are not seen in normal/healthy cells, this inability of some tumors to maintain intracellular glucose levels could be an unappreciated Achilles’ heel that might be therapeutically tar-geted, such as by enhancing the Ca2+-PP2A-RIPK1–cell death path-way, in tumors while sparing healthy tissue. A molecular signature of cancers with reduced ability to maintain intracellular glucose would help develop that strategy for clinical application.

In addition, varied sensitivity to glucose deprivation could also reflect dependency on alternate nutrient sources, such as glutamine (102–105), fatty acids (106, 107), lactate (108), or acetate (109), or reli-ance on other metabolic pathways, such as oxidative phosphorylation (9) and autophagy (103, 110). This metabolic reprogramming can be caused by intrinsic factors, such as the deregulation of the proteins MYC (105), AKT (111), and RAS (104, 112), or by input from the tumor microenvironment, such as a supply of fatty acids from adipocytes (113) or lactate from cancer-associated fibroblasts and neighboring tumors (108, 114). Future investigations will determine how to ma-nipulate these factors to make tumors sensitive to glucose depletion–induced cell death.

Inhibitors of glucose metabolic flux, such as 2-DG, have been de-veloped to treat cancer, but they have had limited success (57, 58). This may be partially because, as our study here suggests, 2-DG may prevent RIPK1-dependent cell death in the context of limited glucose. Another approach is to block glucose uptake with glucose transporter inhibitors. GLUT1 is frequently overexpressed in many types of can-cers (115); however, normal cells also require GLUT1 to function. Thus, identifying the therapeutic window and those patients who are most likely to benefit is critical for the clinical success of GLUT1 in-hibitors. For example, it may be possible to screen patient tumor sam-ples for PP2Ac methylation status and/or cell death after brief culture in the absence of glucose. In addition, a glucose uptake inhibitor may be more efficacious in combination with another drug, as we found with the GLUT1 inhibitor STF-31 and thapsigargin. Both drugs have been tested in preclinical or clinical trials (8, 116), respectively, and their combination may increase the therapeutic window for clinical use. These hypotheses remain to be assessed, but together, our study reveals an avenue to explore for targeting glucose-sensing pathways in cancer.

MATERIALS AND METHODSCell cultures and reagentsU2OS, SaOS2, SW480, U87MG, U251MG, A549, H1299, HT29, IMR-90, WI-38, and MCF-10A were purchased from American Type Cul-ture Collection (ATCC). All cells except U251MG were cultured in high glucose (25 mM) Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Life Technologies) supplemented with 10% FBS (HyClone, GE Healthcare Life Science), penicillin (100 units/ml), and streptomy-cin (100 g/ml; Gibco, Life Technologies) in 5% CO2-humidified at-mosphere at 37°C unless otherwise stated. U251MG was cultured under the same condition supplemented with 1× MEM nonessential amino

on October 20, 2020


Dow

nloaded from




14 of 18

acids (Gibco, Life Technologies) and 1× sodium pyruvate (Gibco, Life Technologies). For the glucose- and serum-deprivation assays, cells were cultured in media without glucose and serum. For the glucose- deprivation assays, cells were cultured in media containing 10% dia-lyzed serum and no glucose unless otherwise stated. For the induction of apoptosis, cells were irradiated with 60 J/m2 of UV, and protein was extracted 20 hours after irradiation. To inhibit apoptosis, cells were pretreated with 50 M Z-VAD-FMK for 12 hours, followed by the indicated treatment in media containing 50 M Z-VAD-FMK. To inhibit caspase activity, we pretreated the cells with 10 M Z-VAD-FMK for 12 hours, followed by the indicated treatment in media con-taining 10 M Z-VAD-FMK. For the induction of necroptosis, cells were treated with a combination of TNF- (100 ng/ml), CHX (10 g/ml), and 20 M Z-VAD-FMK in the presence of glucose and 10% serum. To inhibit necroptosis, we pretreated the cells with 10 M necrostatin-1 for 10 hours, followed by the indicated treatment in media containing 10 M necrostatin-1. To inhibit new protein synthesis, we treated the cells with 100 M CHX. Glucose, 2-DG, 6-DG, PUGNac, sodium pyruvate, CHX, chloroquine, dorsomorphin (compound c), TNF-, rapamycin, nifedipine, RR, calyculin A, thapsigargin, PI, catalase, and hydrogen peroxide were purchased from Sigma-Aldrich. Necrostatin-1 (Abcam), STF-31 (Merck Millipore), and Z-VAD-FMK (Santa Cruz Biotechnology) were also purchased.

Dialyzed serumThe commercial dialyzed serum used (HyClone, GE Healthcare Life Science) contains less than 0.1 mM glucose. To further remove glucose, Slide- A-Lyzer G2 dialysis cassette (MWCO 10,000) (Life Technologies) was used. Dialysis was performed in a cold phosphate-buffered saline (PBS) buffer containing 1 mM phenylmethylsulfonyl fluoride for 24 hours in a cold room. PBS buffer was exchanged once during the dialysis.

siRNA silencing experimentssiRNAs targeting a specific gene were obtained from Ambion, Invitrogen, or Qiagen. Control siRNA (ON-TARGET plus nontargeting pool) was obtained from Dharmacon. The targeted siRNA sequences were: AMPK_1, CCCATCCTGAAAGAGTACCATTCTT; AMPK_2, CCCT-CAATATTTAAATCCTTCTGTG; AMPK_3, ACCATGATTGATGA-TGAAGCCTTA; ATG5, CCUUUGGCCUAAGAAGAAAdTdT; ATG7_1, CCAAAGUUCUUGAUCAAUA; ATG7_2, GAAGAUAACAAUUGGUGUA; ATG12_1, GGGAAGGACUUACGGAUGU; ATG12_2, GCAGUA-GAGCGAACACGAA; BECN1_1, GAUACCGACUUGUU CCUUA; BECN1_2, CUAAGGAGCUGCCGUUAUA; PPME1_1, GAA -GGAAGUGAGUCUAUAAdTdT; PPME1_2, GGAAGAAAGCG-GGACUUUUdTdT; RIPK1_1, GCAAAGACCUUACGAGAAUdTdT; RIPK1_2, CCACUAGUCUGACGGAUAAdTdT; CAMK1_1, AUACAGCUCUAGAUAAGAAdTdT; CAMK1_2, CCAUAGGUGU-CAUCGCCUAdTdT; CACNA1C_1, CTGGTTTGGTTCGGTTATCT-AdTdT; CACNA1C_2, TCCAGGGATGTTAGTCTGTATdTdT; CAC-NA1D_1, CACGCGAACGAGGCAAACTATdTdT; and CACNA1D_2, CCGGAACACGATACTGGGTTAdTdT. Cells were transiently trans-fected with siRNA using RNAiMAX according to the manufacturer’s instructions (Invitrogen, Life Technologies). All siRNAs were used at 20 nM for transfection.

RT-PCR experiments and analysisTotal RNA was extracted using RNeasy kit (Qiagen). cDNA was syn-thesized using iScript cDNA Synthesis kit (Bio-Rad). Reverse tran-scription polymerase chain reaction (RT-PCR) was performed with

KAPA SYBR fast qPCR kit (KAPA Biosystems) using the CFX96 Sys-tem (Bio-Rad). For assessing gene expression (Fig. 8A), the following primers were used: CACNA1C, TGATTCCAACGCCACCAATTC (forward) and GAGGAGTCCATAGGCGATTACT (reverse); CAC-NA1D, CGCGAACGAGGCAAACTATG (forward) and TTGGAG-CTATTCGGCTGAGAA (reverse); CACNA1F, GATCCAGGAG-TATGCCAACAA (forward) and GAAGGAAGACACATAGGCAGAG (reverse); CACNA1S, TTGCCTACGGCTTCTTATTCCA (forward) and GTTCCAGAATCACGGTGAAGAC (reverse); and TBP (TATA- binding box), CGCCGAATATAATCCCAAGC (forward) and TCCT-GTGCACACCATTTTCC (reverse). PCR products were visualized by DNA agarose gel electrophoresis. The expected sizes of PCR products were 103 bp (base pair) (CACNA1C), 81 bp (CACNA1D), 100 bp (CACNA1F), 105 bp (CACNA1S), and 103 bp (TBP). For quan-titative RT-PCR (fig. S14), these primers were used, corresponding to the respective siRNA: CACNA1C_#1, CCATTGTGTATGCCCAATA-ATTTGT (forward) and CAAACCCACCTGTACACCCA (reverse); CACNA1C_#2, ATGGGATCATGGCTTATGGCG (forward) and CCA GGTTGTCCACAGCAATG (reverse); CACNA1D_#1, GCAG-CATCAACGGCAGC (forward) and CGGCTGAGAAGTTGGTCCTT (reverse); and CACNA1D_#2, AGAGGACCCCATCCGCA (forward) and GGCCCCTTTGTGGAGGAAA (reverse). Relative expression was calculated with Bio-Rad CFX manager software using the expression of TBP as an internal control. PCR products were verified by sequencing.

Protein analysisFor Western blotting analysis, all cells (including attached cells and floating cells) were lysed with 2% SDS lysis buffer (50 mM tris-HCl, pH 6.8, 10% glycerol, and 2% SDS). Lysates were separated by 8% SDS–polyacrylamide gel electrophoresis (PAGE) to detect phospho-rylated RIPK1 (except in Figs. 4H and 6A, which were 11% SDS-PAGE), where 11% SDS-PAGE was performed for other protein detections. Detection was done by incubation with horseradish peroxidase–conjugated anti-mouse, anti-rabbit, or anti-goat immunoglobulin G (IgG) (Jackson ImmunoResearch), or anti-mouse IgM (Santa Cruz Biotechnology) secondary antibody followed by the reaction for chemiluminescence (SuperSignal, Pierce). Infrared fluorescence–conjugated anti-mouse, anti-rabbit, or anti-goat IgG secondary anti-body (DyLight, Jackson ImmunoResearch) was also used for infrared fluorescence detection (LI-COR Odyssey). The following antibodies were used: anti-AMPK (Santa Cruz Biotechnology, clone 71.54, cat-alog no. sc-130394), anti-phospho-AMPK T172 (Cell Signaling, cat-alog no. 2531), anti-ATG5 (Cell Signaling, clone D5F5U, catalog no. 12994), anti-ATG7 (Cell Signaling, clone D12B11, catalog no. 8558), anti-ATG12 (Cell Signaling, clone D88H11, catalog no. 4180), anti- BECN1 (Cell Signaling, clone D40C5, catalog no. 3495), anti-CAMK1 (Santa Cruz Biotechnology, clone H-125, catalog no. sc-33165), anti- CASP3 (Cell Signaling, catalog no. 9661), anti-Dvl2 (Cell Signaling, clone 30D2, catalog no. 3224), anti-LC3 (Cell Signaling catalog no. 2775), anti-total mTOR (Cell Signaling, clone 7C10, catalog no. 2983), anti-RIPK3 (Cell Signaling, clone E1Z1D catalog no. 13526), anti- HSPA9 (Santa Cruz Biotechnology, clone H-155, catalog no. sc-13967), anti-C1QBP (Santa Cruz Biotechnology, D-19, catalog no. sc-10258), anti-TP53 (Santa Cruz Biotechnology, clone DO1, catalog no. sc-126), anti- demethylated PP2Ac (Santa Cruz Biotechnology, clone 4B7, cata-log no. sc-13601), anti–cytochrome c (Thermo Fisher Scientific, clone 7H8.2C12), anti-RIPK1 (BD Biosciences, clone 38/RIP), anti–phospho- RIPK1 Ser166 (Cell Signaling, clone D1L3S, catalog no. 65746), anti- PARP (BD Biosciences, clone C2-10, catalog no. 556362), anti-actin

on October 20, 2020


Dow

nloaded from




15 of 18

(Merck Millipore, clone C4, catalog no. MAB1501), anti-PPME1 (Mer-ck Millipore, catalog no. 07-095), anti-total PP2Ac (Merck Millipore, catalog no. 07–324), anti-S6 (Cell Signaling, clone 54D2, catalog no. 2317), anti–phospho-S6 Ser235/236 (Cell Signaling, clone D57.2.2E XP, catalog no. 4858), anti-methylated PP2Ac (custom-made antibody from Egon Ogris, Max F. Perutz Laboratories), anti-PP2Aa (custom- made antibody from D.M.V., Duke-NUS), anti-CSNK1D (custom- made antibody from Eli Lilly Laboratories), and anti-tubulin (Abcam, clone no. DM1A+DM1B). The alkaline demethylation assay was per-formed as previously described (48). Briefly, cells were lysed with 2% SDS lysis buffer and incubated with NaOH at 1 mM final concentra-tion for 30 min at room temperature. Extracts were then neutralized with HCl for SDS-PAGE.

Phos-tag Western blottingThe preparation of the Phos-tag acrylamide gels (Wako Pure Chem-ical Industries Ltd.) and gel electrophoresis were done according to the manufacturer’s instructions. Proteins were transferred to poly-vinylidene difluoride (PVDF) membranes, and Western blotting was performed by the standard procedure.

Phosphatase assayCells were lysed with 0.5% NP-40 lysis buffer (0.5% NP-40, 50 mM Hepes, pH 7.5, 100 mM NaCl, 1× protease inhibitor cocktail without EDTA from WAKO), and endogenous phosphatase activity was heat- inactivated at 75°C for 5 min. A total of 400 units of phosphatase (New England Biolabs) was added to each lysate and incubated at 30°C for 1 hour. Enzyme activity was heat-inactivated at 95°C for 5 min before analyzing by Western blotting.

ATP measurement assayCells were lysed with 0.5% NP-40 lysis buffer (50 mM tris-HCl, pH 7.5, 100 mM NaCl, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride, 1× protease inhibitor cocktail). Lysates were used for measuring ATP by CellTiter-Glo luminescent cell viability assay (Promega).

Glucose measurement assayCells were lysed with 0.5% NP-40 lysis buffer, and lysates were used for measuring glucose amount by Amplex Red Glucose/Glucose Ox-idase Assay kit (Life Technologies). A glucose concentration of each lysate was calculated by comparing to the glucose standard curve as recommended by the manufacturer. Glucose concentration was fur-ther normalized against the protein amount of the lysate loaded and plotted in the graph.

PI exclusion assayCells were stained with PI to determine the percentage of cell death. Media containing floating cells were collected, combined with tryp-sinized cells, and centrifuged. The cell pellet was washed once with PBS. After centrifugation, cells were resuspended in PBS containing PI (10 g/ml) and stained for 15 min. Data were collected with MACSQuant analyzer (Miltenyi Biotec). Quantification and analy-sis of the data were done with FlowJo software.

TMRE measurement assayCells were deprived of glucose for 4 hours. During the last 30 min of glucose deprivation, tetramethylrhodamine, ethyl ester (TMRE) (Life Technologies) was added to media for staining for 30 min at 37°C. Media containing floating cells were collected, combined with

trypsinized cells, and centrifuged. Cells were washed once with PBS. TMRE signals were detected by flow cytometry using MACSQuant analyzer (Miltenyi Biotec) and analyzed with FlowJo software.

Calcium flux measurement assayCells were placed in phenol-free DMEM containing 10% dialyzed serum and 5 M Fluo-4AM (Life Technologies) and incubated at 37°C for 15 min in the presence or absence of glucose. Phase-contrast and fluorescent images of cells were taken by Olympus Model IX71 inverted microscope. Quantification of fluorescence intensity was done with ImageJ software. The changes in intracellular calcium amounts were also monitored by IncuCyte ZOOM (Essen BioScience). After cells were placed in phenol-free DMEM containing 10% dialyzed serum and 5 M Fluo-4AM in the presence or absence of glucose, images were taken every 10 min for 30 min.

Membrane potential depolarization measurement assayBriefly, cells were stained with 5 M DiBAC4 for 5 min and washed once with media containing the indicated reagents without DiBAC4 (Enzo Life Science), followed by the indicated treatment with DiBAC4. Images were immediately taken using a Leica fluorescence microscope (within 5 min). For quantification, fluorescence intensity of DiBAC4 was measured by the plate reader (Infinite M200, TECAN) (excitation, 490 nm; emission, 522 nm).

ROS measurement assayAfter 3 hours of glucose deprivation, cells were trypsinized and washed once with PBS. Cells were then stained with 10 M H2DCFDA (Thermo Fisher Scientific) in phenol red–free DMEM without glucose for 1 hour and analyzed by MACSQuant (Miltenyi Biotec) analyzer. FlowJo soft-ware was used for data analysis.

Time-lapse microscopyCells were placed in DMEM containing the indicated reagents and 10% dialyzed serum with or without glucose, and images were taken by IncuCyte ZOOM (Essen Bioscience). Phase-contrast or fluores-cent images were taken every 10 or 30 min for the indicated hours depending on the experiments. We noticed that IncuCyte ZOOM has a tendency to give a slight delay in morphological changes and cell death compared to the condition in the regular 5% CO2 cell culture incubator.

Cytoplasmic fractionationCytoplasmic fractionation was performed as previously described (117), with a change in the concentration of the digitonin. Cytoplasmic- enriched fractions were prepared using digitonin solution (75 g/ml).

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/11/512/eaam7893/DC1Fig. S1. Glucose deprivation induces cell death in a subset of cancer cells.Fig. S2. 2-DG rescues glucose deprivation–induced cell death that is independent from ROS induction.Fig. S3. 2-DG rescues glucose deprivation–induced cell death independently from O-glycosylation.Fig. S4. Glucose deprivation–induced cell death is not mediated by apoptosis.Fig. S5. Glucose deprivation–induced cell death is independent from autophagy.Fig. S6. AMPK is not involved in glucose deprivation–induced cell death.Fig. S7. Glucose deprivation induces RIPK1 phosphorylation.Fig. S8. Glucose deprivation induces RIPK1-dependent cell death.Fig. S9. Glucose deprivation–induced cell death is not mediated by necroptosis.Fig. S10. Glucose deprivation induces PP2Ac demethylation.

on October 20, 2020


Dow

nloaded from

http://www.sciencesignaling.org/cgi/content/full/11/512/eaam7893/DC1




16 of 18

Fig. S11. Glucose deprivation induces PP2Ac demethylation and RIPK1 phosphorylation independently from the mTOR signaling pathway.Fig. S12. PP2Ac demethylation is required for glucose deprivation–induced cell death.Fig. S13. Glucose deprivation induces calcium influx into the cytoplasm.Fig. S14. Knockdown efficiency of CACNA1C and CACNA1D.Fig. S15. GLUT1 inhibitor increases cytoplasmic calcium concentration in U2OS cells.Movie S1. PI staining in the presence of glucose.Movie S2. PI staining in the absence of glucose.Movie S3. Cell death in the presence of control siRNA and glucose.Movie S4. Cell death in the presence of PPME1 siRNA and glucose.Movie S5. Cell death in the presence of control siRNA but in the absence of glucose.Movie S6. Cell death in the presence of PPME1 siRNA but in the absence of glucose.Movie S7. Calcium staining in the presence of glucose.Movie S8. Calcium staining in the absence of glucose.

REFERENCES AND NOTES 1. D. Hanahan, R. A. Weinberg, Hallmarks of cancer: The next generation. Cell 144, 646–674

(2011). 2. M. G. Vander Heiden, L. C. Cantley, C. B. Thompson, Understanding the Warburg effect:

The metabolic requirements of cell proliferation. Science 324, 1029–1033 (2009). 3. G. Kroemer, J. Pouyssegur, Tumor cell metabolism: Cancer’s Achilles’ heel. Cancer Cell 13,

472–482 (2008). 4. O. Warburg, The metabolism of carcinoma cells. J. Cancer Res. 9, 148–163 (1925). 5. C. V. Dang, Links between metabolism and cancer. Genes Dev. 26, 877–890 (2012). 6. W. H. Koppenol, P. L. Bounds, C. V. Dang, Otto Warburg’s contributions to current

concepts of cancer metabolism. Nat. Rev. Cancer 11, 325–337 (2011). 7. N. El Mjiyad, A. Caro-Maldonado, S. Ramírez-Peinado, C. Muñoz-Pinedo, Sugar-free

approaches to cancer cell killing. Oncogene 30, 253–264 (2011). 8. D. A. Chan, P. D. Sutphin, P. Nguyen, S. Turcotte, E. W. Lai, A. Banh, G. E. Reynolds, J.-T. Chi,

J. Wu, D. E. Solow-Cordero, M. Bonnet, J. U. Flanagan, D. M. Bouley, E. E. Graves, W. A. Denny, M. P. Hay, A. J. Giaccia, Targeting GLUT1 and the Warburg effect in renal cell carcinoma by chemical synthetic lethality. Sci. Transl. Med. 3, 94ra70 (2011).

9. K. Birsoy, R. Possemato, F. K. Lorbeer, E. C. Bayraktar, P. Thiru, B. Yucel, T. Wang, W. W. Chen, C. B. Clish, D. M. Sabatini, Metabolic determinants of cancer cell sensitivity to glucose limitation and biguanides. Nature 508, 108–112 (2014).

10. D. M. Virshup, S. Shenolikar, From promiscuity to precision: Protein phosphatases get a makeover. Mol. Cell 33, 537–545 (2009).

11. A. Cegielska, S. Shaffer, R. Derua, J. Goris, D. M. Virshup, Different oligomeric forms of protein phosphatase 2A activate and inhibit simian virus 40 DNA replication. Mol. Cell. Biol. 14, 4616–4623 (1994).

12. B. McCright, A. M. Rivers, S. Audlin, D. M. Virshup, The B56 family of protein phosphatase 2A (PP2A) regulatory subunits encodes differentiation-induced phosphoproteins that target PP2A to both nucleus and cytoplasm. J. Biol. Chem. 271, 22081–22089 (1996).

13. I. De Baere, R. Derua, V. Janssens, C. Van Hoof, E. Waelkens, W. Merlevede, J. Goris, Purification of porcine brain protein phosphatase 2A leucine carboxyl methyltransferase and cloning of the human homologue. Biochemistry 38, 16539–16547 (1999).

14. T. Tolstykh, J. Lee, S. Vafai, J. B. Stock, Carboxyl methylation regulates phosphoprotein phosphatase 2A by controlling the association of regulatory B subunits. EMBO J. 19, 5682–5691 (2000).

15. H. Wei, D. G. Ashby, C. S. Moreno, E. Ogris, F. M. Yeong, A. H. Corbett, D. C. Pallas, Carboxymethylation of the PP2A catalytic subunit in Saccharomyces cerevisiae is required for efficient interaction with the B-type subunits Cdc55p and Rts1p. J. Biol. Chem. 276, 1570–1577 (2001).

16. J. Wu, T. Tolstykh, J. Lee, K. Boyd, J. B. Stock, J. R. Broach, Carboxyl methylation of the phosphoprotein phosphatase 2A catalytic subunit promotes its functional association with regulatory subunits in vivo. EMBO J. 19, 5672–5681 (2000).

17. X. X. Yu, X. Du, C. S. Moreno, R. E. Green, E. Ogris, Q. Feng, L. Chou, M. J. McQuoid, D. C. Pallas, Methylation of the protein phosphatase 2A catalytic subunit is essential for association of B regulatory subunit but not SG2NA, striatin, or polyomavirus middle tumor antigen. Mol. Biol. Cell 12, 185–199 (2001).

18. H. Hombauer, D. Weismann, I. Mudrak, C. Stanzel, T. Fellner, D. H. Lackner, E. Ogris, Generation of active protein phosphatase 2A is coupled to holoenzyme assembly. PLOS Biol. 5, e155 (2007).

19. Y. Xing, Z. Li, Y. Chen, J. B. Stock, P. D. Jeffrey, Y. Shi, Structural mechanism of demethylation and inactivation of protein phosphatase 2A. Cell 133, 154–163 (2008).

20. J. Lee, Y. Chen, T. Tolstykh, J. Stock, A specific protein carboxyl methylesterase that demethylates phosphoprotein phosphatase 2A in bovine brain. Proc. Natl. Acad. Sci. U.S.A. 93, 6043–6047 (1996).

21. E. Ogris, X. Du, K. C. Nelson, E. K. Mak, X. X. Yu, W. S. Lane, D. C. Pallas, A protein phosphatase methylesterase (PME-1) is one of several novel proteins stably associating

with two inactive mutants of protein phosphatase 2A. J. Biol. Chem. 274, 14382–14391 (1999).

22. C.-W. Lee, F.-C. Yang, H.-Y. Chang, H. Chou, B. C.-M. Tan, S.-C. Lee, Interaction between salt-inducible kinase 2 and protein phosphatase 2A regulates the activity of calcium/calmodulin-dependent protein kinase I and protein phosphatase methylesterase-1. J. Biol. Chem. 289, 21108–21119 (2014).

23. T. R. Soderling, The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem. Sci. 24, 232–236 (1999).

24. D. E. Clapham, Calcium signaling. Cell 131, 1047–1058 (2007). 25. M. J. Berridge, P. Lipp, M. D. Bootman, The versatility and universality of calcium

signalling. Nat. Rev. Mol. Cell Biol. 1, 11–21 (2000). 26. S. Orrenius, B. Zhivotovsky, P. Nicotera, Regulation of cell death: The calcium-apoptosis

link. Nat. Rev. Mol. Cell Biol. 4, 552–565 (2003). 27. W. A. Catterall, Voltage-gated calcium channels. Cold Spring Harb. Perspect. Biol. 3,

a003947 (2011). 28. D. Pietrobon, P. Hess, Novel mechanism of voltage-dependent gating in L-type calcium

channels. Nature 346, 651–655 (1990). 29. A. Y. Choo, S. G. Kim, M. G. Vander Heiden, S. J. Mahoney, H. Vu, S.-O. Yoon, L. C. Cantley,

J. Blenis, Glucose addiction of TSC-null cells is caused by failed mTORC1-dependent balancing of metabolic demand with supply. Mol. Cell 38, 487–499 (2010).

30. S. Jung, C. Li, J. Duan, S. Lee, K. Kim, Y. Park, Y. Yang, K.-I. Kim, J.-S. Lim, C.-I. Cheon, Y.-S. Kang, M.-S. Lee, TRIP-Br1 oncoprotein inhibits autophagy, apoptosis, and necroptosis under nutrient/serum-deprived condition. Oncotarget 6, 29060–29075 (2015).

31. P. M. Gullino, F. H. Grantham, A. H. Courtney, Glucose consumption by transplanted tumors in vivo. Cancer Res. 27, 1031–1040 (1967).

32. A. Hirayama, K. Kami, M. Sugimoto, M. Sugawara, N. Toki, H. Onozuka, T. Kinoshita, N. Saito, A. Ochiai, M. Tomita, H. Esumi, T. Soga, Quantitative metabolome profiling of colon and stomach cancer microenvironment by capillary electrophoresis time-of-flight mass spectrometry. Cancer Res. 69, 4918–4925 (2009).

33. Y. Urasaki, L. Heath, C. W. Xu, Coupling of glucose deprivation with impaired histone H2B monoubiquitination in tumors. PLOS ONE 7, e36775 (2012).

34. Y. Eguchi, S. Shimizu, Y. Tsujimoto, Intracellular ATP levels determine cell death fate by apoptosis or necrosis. Cancer Res. 57, 1835–1840 (1997).

35. N. Aykin-Burns, I. M. Ahmad, Y. Zhu, L. W. Oberley, D. R. Spitz, Increased levels of superoxide and H2O2 mediate the differential susceptibility of cancer cells versus normal cells to glucose deprivation. Biochem. J. 418, 29–37 (2009).

36. H. T. Kang, J. W. Ju, J. W. Cho, E. S. Hwang, Down-regulation of Sp1 activity through modulation of O-glycosylation by treatment with a low glucose mimetic, 2-deoxyglucose. J. Biol. Chem. 278, 51223–51231 (2003).

37. Z. Yang, D. J. Klionsky, Mammalian autophagy: Core molecular machinery and signaling regulation. Curr. Opin. Cell Biol. 22, 124–131 (2010).

38. N. Mizushima, T. Yoshimori, B. Levine, Methods in mammalian autophagy research. Cell 140, 313–326 (2010).

39. J. Kim, M. Kundu, B. Viollet, K.-L. Guan, AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141 (2011).

40. A. Degterev, Z. Huang, M. Boyce, Y. Li, P. Jagtap, N. Mizushima, G. D. Cuny, T. J. Mitchison, M. A. Moskowitz, J. Yuan, Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat. Chem. Biol. 1, 112–119 (2005).

41. T. Vanden Berghe, A. Linkermann, S. Jouan-Lanhouet, H. Walczak, P. Vandenabeele, Regulated necrosis: The expanding network of non-apoptotic cell death pathways. Nat. Rev. Mol. Cell Biol. 15, 135–147 (2014).

42. K. Newton, RIPK1 and RIPK3: Critical regulators of inflammation and cell death. Trends Cell Biol. 25, 347–353 (2015).

43. A. Degterev, J. Hitomi, M. Germscheid, I. L. Ch’en, O. Korkina, X. Teng, D. Abbott, G. D. Cuny, C. Yuan, G. Wagner, S. M. Hedrick, S. A. Gerber, A. Lugovskoy, J. Yuan, Identification of RIP1 kinase as a specific cellular target of necrostatins. Nat. Chem. Biol. 4, 313–321 (2008).

44. J. Sosna, S. Voigt, S. Mathieu, A. Lange, L. Thon, P. Davarnia, T. Herdegen, A. Linkermann, A. Rittger, F. K.-M. Chan, D. Kabelitz, S. Schütze, D. Adam, TNF-induced necroptosis and PARP-1-mediated necrosis represent distinct routes to programmed necrotic cell death. Cell. Mol. Life Sci. 71, 331–348 (2014).

45. M. J. Ratcliffe, K. Itoh, S. Y. Sokol, A positive role for the PP2A catalytic subunit in Wnt signal transduction. J. Biol. Chem. 275, 35680–35683 (2000).

46. W. Swiatek, I.-C. Tsai, L. Klimowski, A. Pepler, J. Barnette, H. J. Yost, D. M. Virshup, Regulation of casein kinase Iϵ activity by Wnt signaling. J. Biol. Chem. 279, 13011–13017 (2004).

47. N. Yokoyama, C. C. Malbon, Phosphoprotein phosphatase-2A docks to Dishevelled and counterregulates Wnt3a/-catenin signaling. J. Mol. Signal. 2, 12 (2007).

48. P. Turowski, A. Fernandez, B. Favre, N. J. Lamb, B. A. Hemmings, Differential methylation and altered conformation of cytoplasmic and nuclear forms of protein phosphatase 2A during cell cycle progression. J. Cell Biol. 129, 397–410 (1995).

on October 20, 2020


Dow

nloaded from




17 of 18

49. J. Han, L. Zhang, H. Guo, W. Z. Wysham, D. R. Roque, A. K. Willson, X. Sheng, C. Zhou, V. L. Bae-Jump, Glucose promotes cell proliferation, glucose uptake and invasion in endometrial cancer cells via AMPK/mTOR/S6 and MAPK signaling. Gynecol. Oncol. 138, 668–675 (2015).

50. S. A. Hawley, M. Davison, A. Woods, S. P. Davies, R. K. Beri, D. Carling, D. G. Hardie, Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J. Biol. Chem. 271, 27879–27887 (1996).

51. S. C. Stein, A. Woods, N. A. Jones, M. D. Davison, D. Carling, The regulation of AMP-activated protein kinase by phosphorylation. Biochem. J. 345 (Pt. 3), 437–443 (2000).

52. D. M. Gwinn, D. B. Shackelford, D. F. Egan, M. M. Mihaylova, A. Mery, D. S. Vasquez, B. E. Turk, R. J. Shaw, AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol. Cell 30, 214–226 (2008).

53. Y. Hanyu, K. K. Imai, Y. Kawasaki, T. Nakamura, Y. Nakaseko, K. Nagao, A. Kokubu, M. Ebe, A. Fujisawa, T. Hayashi, C. Obuse, M. Yanagida, Schizosaccharomyces pombe cell division cycle under limited glucose requires Ssp1 kinase, the putative CaMKK, and Sds23, a PP2A-related phosphatase inhibitor. Genes Cells 14, 539–554 (2009).

54. S. Saitoh, A. Mori, L. Uehara, F. Masuda, S. Soejima, M. Yanagida, Mechanisms of expression and translocation of major fission yeast glucose transporters regulated by CaMKK/phosphatases, nuclear shuttling, and TOR. Mol. Biol. Cell 26, 373–386 (2015).

55. E. Braunwald, Mechanism of action of calcium-channel-blocking agents. N. Engl. J. Med. 307, 1618–1627 (1982).

56. D. S. Adams, M. Levin, Measuring resting membrane potential using the fluorescent voltage reporters DiBAC4(3) and CC2-DMPE. Cold Spring Harb. Protoc. 2012, 459–464 (2012).

57. B. R. Landau, J. Laszlo, J. Stengle, D. Burk, Certain metabolic and pharmacologic effects in cancer patients given infusions of 2-deoxy-d-glucose. J. Natl. Cancer Inst. 21, 485–494 (1958).

58. B. K. Mohanti, G. K. Rath, N. Anantha, V. Kannan, B. S. Das, B. A. R. Chandramouli, A. K. Banerjee, S. Das, A. Jena, R. Ravichandran, U. P. Sahi, R. Kumar, N. Kapoor, V. K. Kalia, B. S. Dwarakanath, V. Jain, Improving cancer radiotherapy with 2-deoxy-d-glucose: Phase I/II clinical trials on human cerebral gliomas. Int. J. Radiat. Oncol. Biol. Phys. 35, 103–111 (1996).

59. M. Kurtoglu, N. Gao, J. Shang, J. C. Maher, M. A. Lehrman, M. Wangpaichitr, N. Savaraj, A. N. Lane, T. J. Lampidis, Under normoxia, 2-deoxy-d-glucose elicits cell death in select tumor types not by inhibition of glycolysis but by interfering with N-linked glycosylation. Mol. Cancer Ther. 6, 3049–3058 (2007).

60. L. Stryer, Biochemistry (W.H. Freeman, New York, ed. 4, 1995), pp. XXXIV, 1064 pp. 61. E. D. Renner, P. G. W. Plagemann, R. W. Bernlohr, Permeation of glucose by simple and

facilitated diffusion by Novikoff rat hepatoma cells in suspension culture and its relationship to glucose metabolism. J. Biol. Chem. 247, 5765–5776 (1972).

62. F. Zhang, C. M. Snead, J. D. Catravas, Hsp90 regulates O-linked -N-acetylglucosamine transferase: A novel mechanism of modulation of protein O-linked -N-acetylglucosamine modification in endothelial cells. Am. J. Physiol. Cell Physiol. 302, C1786–C1796 (2012).

63. A. Caro-Maldonado, S. W. G. Tait, S. Ramírez-Peinado, J.-E. Ricci, I. Fabregat, D. R. Green, C. Muñoz-Pinedo, Glucose deprivation induces an atypical form of apoptosis mediated by caspase-8 in Bax-, Bak-deficient cells. Cell Death Differ. 17, 1335–1344 (2010).

64. C. Bonde, J. Noraberg, H. Noer, J. Zimmer, Ionotropic glutamate receptors and glutamate transporters are involved in necrotic neuronal cell death induced by oxygen-glucose deprivation of hippocampal slice cultures. Neuroscience 136, 779–794 (2005).

65. H. M. Jeon, S. Y. Lee, M. K. Ju, C. H. Kim, H. G. Park, H. S. Kang, Early growth response 1 regulates glucose deprivation-induced necrosis. Oncol. Rep. 29, 669–675 (2013).

66. C. L. León-Annicchiarico, S. Ramírez-Peinado, D. Domínguez-Villanueva, A. Gonsberg, T. J. Lampidis, C. Muñoz-Pinedo, ATF4 mediates necrosis induced by glucose deprivation and apoptosis induced by 2-deoxyglucose in the same cells. FEBS J. 282, 3647–3658 (2015).

67. W. Ding, L. Shang, J.-F. Huang, N. Li, D. Chen, L.-X. Xue, K. Xiong, Receptor interacting protein 3-induced RGC-5 cell necroptosis following oxygen glucose deprivation. BMC Neurosci. 16, 49 (2015).

68. C.-Y. Huang, W.-T. Kuo, Y.-C. Huang, T.-C. Lee, L. C. H. Yu, Resistance to hypoxia-induced necroptosis is conferred by glycolytic pyruvate scavenging of mitochondrial superoxide in colorectal cancer cells. Cell Death Dis. 4, e622 (2013).

69. T. Aki, K. Yamaguchi, T. Fujimiya, Y. Mizukami, Phosphoinositide 3-kinase accelerates autophagic cell death during glucose deprivation in the rat cardiomyocyte-derived cell line H9c2. Oncogene 22, 8529–8535 (2003).

70. Y. Chen, R. Liersch, M. Detmar, The miR-290-295 cluster suppresses autophagic cell death of melanoma cells. Sci. Rep. 2, 808 (2012).

71. D. Ofengeim, J. Yuan, Regulation of RIP1 kinase signalling at the crossroads of inflammation and cell death. Nat. Rev. Mol. Cell Biol. 14, 727–736 (2013).

72. N. Holler, R. Zaru, O. Micheau, M. Thome, A. Attinger, S. Valitutti, J.-L. Bodmer, P. Schneider, B. Seed, J. Tschopp, Fas triggers an alternative, caspase-8–independent cell

death pathway using the kinase RIP as effector molecule. Nat. Immunol. 1, 489–495 (2000).

73. H. Li, M. Kobayashi, M. Blonska, Y. You, X. Lin, Ubiquitination of RIP is required for tumor necrosis factor -induced NF-B activation. J. Biol. Chem. 281, 13636–13643 (2006).

74. U. S. Cho, W. Xu, Crystal structure of a protein phosphatase 2A heterotrimeric holoenzyme. Nature 445, 53–57 (2007).

75. E. Wandzioch, M. Pusey, A. Werda, S. Bail, A. Bhaskar, M. Nestor, J.-J. Yang, L. M. Rice, PME-1 modulates protein phosphatase 2A activity to promote the malignant phenotype of endometrial cancer cells. Cancer Res. 74, 4295–4305 (2014).

76. J. Westermarck, W. C. Hahn, Multiple pathways regulated by the tumor suppressor PP2A in transformation. Trends Mol. Med. 14, 152–160 (2008).

77. D. C. Pallas, L. K. Shahrik, B. L. Martin, S. Jaspers, T. B. Miller, D. L. Brautigan, T. M. Roberts, Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell 60, 167–176 (1990).

78. R. Ruediger, H. T. Pham, G. Walter, Alterations in protein phosphatase 2A subunit interaction in human carcinomas of the lung and colon with mutations in the A subunit gene. Oncogene 20, 1892–1899 (2001).

79. R. Ruediger, H. T. Pham, G. Walter, Disruption of protein phosphatase 2A subunit interaction in human cancers with mutations in the A subunit gene. Oncogene 20, 10–15 (2001).

80. S. S. Wang, E. D. Esplin, J. L. Li, L. Huang, A. Gazdar, J. Minna, G. A. Evans, Alterations of the PPP2R1B gene in human lung and colon cancer. Science 282, 284–287 (1998).

81. D. Perrotti, P. Neviani, ReSETting PP2A tumour suppressor activity in blast crisis and imatinib-resistant chronic myelogenous leukaemia. Br. J. Cancer 95, 775–781 (2006).

82. X. Li, A. Scuderi, A. Letsou, D. M. Virshup, B56-associated protein phosphatase 2A is required for survival and protects from apoptosis in Drosophila melanogaster. Mol. Cell. Biol. 22, 3674–3684 (2002).

83. J. Lu, J. S. Kovach, F. Johnson, J. Chiang, R. Hodes, R. Lonser, Z. Zhuang, Inhibition of serine/threonine phosphatase PP2A enhances cancer chemotherapy by blocking DNA damage induced defense mechanisms. Proc. Natl. Acad. Sci. U.S.A. 106, 11697–11702 (2009).

84. J. P. MacKeigan, L. O. Murphy, J. Blenis, Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat. Cell Biol. 7, 591–600 (2005).

85. M. F. Santoro, R. R. Annand, M. M. Robertson, Y.-W. Peng, M. J. Brady, J. A. Mankovich, M. C. Hackett, T. Ghayur, G. Walter, W. W. Wong, D. A. Giegel, Regulation of protein phosphatase 2A activity by caspase-3 during apoptosis. J. Biol. Chem. 273, 13119–13128 (1998).

86. S. Simizu, Y. Tamura, H. Osada, Dephosphorylation of Bcl-2 by protein phosphatase 2A results in apoptosis resistance. Cancer Sci. 95, 266–270 (2004).

87. W. A. Catterall, Structure and function of voltage-sensitive ion channels. Science 242, 50–61 (1988).

88. L. B. Rosen, D. D. Ginty, M. J. Weber, M. E. Greenberg, Membrane depolarization and calcium influx stimulate MEK and MAP kinase via activation of Ras. Neuron 12, 1207–1221 (1994).

89. M. Sheng, G. McFadden, M. E. Greenberg, Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4, 571–582 (1990).

90. L. B. Rosen, M. E. Greenberg, Stimulation of growth factor receptor signal transduction by activation of voltage-sensitive calcium channels. Proc. Natl. Acad. Sci. U.S.A. 93, 1113–1118 (1996).

91. H. H. Yang, F. St-Pierre, X. Sun, X. Ding, M. Z. Lin, T. R. Clandinin, Subcellular imaging of voltage and calcium signals reveals neural processing in vivo. Cell 166, 245–257 (2016).

92. M. B. Cannell, J. R. Berlin, W. J. Lederer, Effect of membrane potential changes on the calcium transient in single rat cardiac muscle cells. Science 238, 1419–1423 (1987).

93. M. T. Nelson, H. Cheng, M. Rubart, L. F. Santana, A. D. Bonev, H. J. Knot, W. J. Lederer, Relaxation of arterial smooth muscle by calcium sparks. Science 270, 633–637 (1995).

94. S. Torihashi, T. Fujimoto, C. Trost, S. Nakayama, Calcium oscillation linked to pacemaking of interstitial cells of Cajal: Requirement of calcium influx and localization of TRP4 in caveolae. J. Biol. Chem. 277, 19191–19197 (2002).

95. M. J. Berridge, Smooth muscle cell calcium activation mechanisms. J. Physiol. 586, 5047–5061 (2008).

96. F. McCoy, R. Darbandi, H. C. Lee, K. Bharatham, T. Moldoveanu, C. R. Grace, K. Dodd, W. Lin, S.-I. Chen, R. P. Tangallapally, M. Kurokawa, R. E. Lee, A. A. Shelat, T. Chen, D. R. Green, R. A. Harris, S.-H. Lin, R. A. Fissore, R. J. Colbran, L. K. Nutt, Metabolic activation of CaMKII by coenzyme A. Mol. Cell 52, 325–339 (2013).

97. B. Huang, C.-S. Yang, J. Wojton, N.-J. Huang, C. Chen, E. J. Soderblom, L. Zhang, S. Kornbluth, Metabolic control of Ca2+/calmodulin-dependent protein kinase II (CaMKII)-mediated caspase-2 suppression by the B55/protein phosphatase 2A (PP2A). J. Biol. Chem. 289, 35882–35890 (2014).

98. L. K. Nutt, S. S. Margolis, M. Jensen, C. E. Herman, W. G. Dunphy, J. C. Rathmell, S. Kornbluth, Metabolic regulation of oocyte cell death through the CaMKII-mediated phosphorylation of caspase-2. Cell 123, 89–103 (2005).

on October 20, 2020


Dow

nloaded from




18 of 18

99. Z. Cai, S. Jitkaew, J. Zhao, H.-C. Chiang, S. Choksi, J. Liu, Y. Ward, L.-G. Wu, Z.-G. Liu, Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nat. Cell Biol. 16, 55–65 (2014).

100. M. Nomura, A. Ueno, K. Saga, M. Fukuzawa, Y. Kaneda, Accumulation of cytosolic calcium induces necroptotic cell death in human neuroblastoma. Cancer Res. 74, 1056–1066 (2014).

101. A. Rempel, S. P. Mathupala, C. A. Griffin, A. L. Hawkins, P. L. Pedersen, Glucose catabolism in cancer cells: Amplification of the gene encoding type II hexokinase. Cancer Res. 56, 2468–2471 (1996).

102. D. R. Wise, C. B. Thompson, Glutamine addiction: A new therapeutic target in cancer. Trends Biochem. Sci. 35, 427–433 (2010).

103. A. M. Strohecker, J. Y. Guo, G. Karsli-Uzunbas, S. M. Price, G. J. Chen, R. Mathew, M. McMahon, E. White, Autophagy sustains mitochondrial glutamine metabolism and growth of BrafV600E-driven lung tumors. Cancer Discov. 3, 1272–1285 (2013).

104. J. Son, C. A. Lyssiotis, H. Ying, X. Wang, S. Hua, M. Ligorio, R. M. Perera, C. R. Ferrone, E. Mullarky, N. Shyh-Chang, Y. Kang, J. B. Fleming, N. Bardeesy, J. M. Asara, M. C. Haigis, R. A. DePinho, L. C. Cantley, A. C. Kimmelman, Glutamine supports pancreatic cancer growth through a KRAS-regulated metabolic pathway. Nature 496, 101–105 (2013).

105. P. Gao, I. Tchernyshyov, T.-C. Chang, Y.-S. Lee, K. Kita, T. Ochi, K. I. Zeller, A. M. De Marzo, J. E. Van Eyk, J. T. Mendell, C. V. Dang, c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature 458, 762–765 (2009).

106. P. Caro, A. U. Kishan, E. Norberg, I. A. Stanley, B. Chapuy, S. B. Ficarro, K. Polak, D. Tondera, J. Gounarides, H. Yin, F. Zhou, M. R. Green, L. Chen, S. Monti, J. A. Marto, M. A. Shipp, N. N. Danial, Metabolic signatures uncover distinct targets in molecular subsets of diffuse large B cell lymphoma. Cancer Cell 22, 547–560 (2012).

107. S. Beloribi-Djefaflia, S. Vasseur, F. Guillaumond, Lipid metabolic reprogramming in cancer cells. Oncogenesis 5, e189 (2016).

108. P. Sonveaux, F. Végran, T. Schroeder, M. C. Wergin, J. Verrax, Z. N. Rabbani, C. J. De Saedeleer, K. M. Kennedy, C. Diepart, B. F. Jordan, M. J. Kelley, B. Gallez, M. L. Wahl, O. Feron, M. W. Dewhirst, Targeting lactate-fueled respiration selectively kills hypoxic tumor cells in mice. J. Clin. Invest. 118, 3930–3942 (2008).

109. Z. T. Schug, B. Peck, D. T. Jones, Q. Zhang, S. Grosskurth, I. S. Alam, L. M. Goodwin, E. Smethurst, S. Mason, K. Blyth, L. McGarry, D. James, E. Shanks, G. Kalna, R. E. Saunders, M. Jiang, M. Howell, F. Lassailly, M. Z. Thin, B. Spencer-Dene, G. Stamp, N. J. F. van den Broek, G. Mackay, V. Bulusu, J. J. Kamphorst, S. Tardito, D. Strachan, A. L. Harris, E. O. Aboagye, S. E. Critchlow, M. J. O. Wakelam, A. Schulze, E. Gottlieb, Acetyl-CoA synthetase 2 promotes acetate utilization and maintains cancer cell growth under metabolic stress. Cancer Cell 27, 57–71 (2015).

110. G. Karsli-Uzunbas, J. Y. Guo, S. Price, X. Teng, S. V. Laddha, S. Khor, N. Y. Kalaany, T. Jacks, C. S. Chan, J. D. Rabinowitz, E. White, Autophagy is required for glucose homeostasis and lung tumor maintenance. Cancer Discov. 4, 914–927 (2014).

111. R. L. Elstrom, D. E. Bauer, M. Buzzai, R. Karnauskas, M. H. Harris, D. R. Plas, H. Zhuang, R. M. Cinalli, A. Alavi, C. M. Rudin, C. B. Thompson, Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 64, 3892–3899 (2004).

112. J. Yun, C. Rago, I. Cheong, R. Pagliarini, P. Angenendt, H. Rajagopalan, K. Schmidt, J. K. V. Willson, S. Markowitz, S. Zhou, L. A. Diaz Jr., V. E. Velculescu, C. Lengauer, K. W. Kinzler, B. Vogelstein, N. Papadopoulos, Glucose deprivation contributes to the

development of KRAS pathway mutations in tumor cells. Science 325, 1555–1559 (2009).

113. K. M. Nieman, H. A. Kenny, C. V. Penicka, A. Ladanyi, R. Buell-Gutbrod, M. R. Zillhardt, I. L. Romero, M. S. Carey, G. B. Mills, G. S. Hotamisligil, S. D. Yamada, M. E. Peter, K. Gwin, E. Lengyel, Adipocytes promote ovarian cancer metastasis and provide energy for rapid tumor growth. Nat. Med. 17, 1498–1503 (2011).

114. T. Fiaschi, A. Marini, E. Giannoni, M. L. Taddei, P. Gandellini, A. De Donatis, M. Lanciotti, S. Serni, P. Cirri, P. Chiarugi, Reciprocal metabolic reprogramming through lactate shuttle coordinately influences tumor-stroma interplay. Cancer Res. 72, 5130–5140 (2012).

115. M. Younes, L. V. Lechago, J. R. Somoano, M. Mosharaf, J. Lechago, Wide expression of the human erythrocyte glucose transporter Glut1 in human cancers. Cancer Res. 56, 1164–1167 (1996).

116. N. T. Q. Doan, E. S. Paulsen, P. Sehgal, J. V. Møller, P. Nissen, S. R. Denmeade, J. T. Isaacs, C. A. Dionne, S. B. Christensen, Targeting thapsigargin towards tumors. Steroids 97, 2–7 (2015).

117. K. Itahana, Y. Zhang, Mitochondrial p32 is a critical mediator of ARF-induced apoptosis. Cancer Cell 13, 542–553 (2008).

Acknowledgments: We thank A. Andersen, Life Science Editors, for editorial assistance. We thank T. W. Soong (NUS) and P. Yen (Duke-NUS) for helpful discussion for the manuscript and P. Xu, J. K. Cheong, K. Iwamoto, A. K. Guo, and Y. Lee at Duke-NUS for the various reagents, help, and suggestions. Funding: This work was supported by Duke-NUS Signature Programme Block Grant and the Singapore Ministry of Health’s National Medical Research Council grants (NMRC/CBRG/0031/2013 and NMRC/OFIRG/15nov049/2016 to K.I.; NMRC/STaR/0017/2013 to D.M.V.; NMRC/CBRG/0075/2014 to H.S.J.), Singapore Ministry of Education Academic Research Fund Tier 2 grants (MOE2013-T2-2-123 to K.I.; MOE2014-T2-2-071 to H.S.J.), and a Khoo Postdoctoral Fellowship Award (Duke-NUS-KPFA/2015/0001 to M.F.). Author contributions: H.Y.L., Y.I., M.F., and K.I. performed the experiments. E.O. and S.S. made the antibody specific to methylated PP2Ac. H.Y.L., Y.I., M.F, H.S.J., D.M.V., and K.I. designed the experiments and analyzed the results. H.Y.L., Y.I., E.O., D.M.V., and K.I. wrote the manuscript. Competing interests: H.Y.L., Y.I., D.M.V., and K.I. are inventors on international patent application no. PCT/SG2017/050208 for “A potential combination therapy using an inhibitor of glucose transport and an intracellular calcium inducer to target cancer metabolism.” E.O. serves as a consultant to Millipore Corporation. All other authors declare that they have no competing interests. Data and materials availability: There is a materials transfer agreement with the Medical University of Vienna (E.O.) for the methylated PP2Ac antibody.

Submitted 19 January 2017Resubmitted 16 October 2017Accepted 14 December 2017Published 9 January 201810.1126/scisignal.aam7893

Citation: H. Y. Lee, Y. Itahana, S. Schuechner, M. Fukuda, H. S. Je, E. Ogris, D. M. Virshup, K. Itahana, Ca2+-dependent demethylation of phosphatase PP2Ac promotes glucose deprivation–induced cell death independently of inhibiting glycolysis. Sci. Signal. 11, eaam7893 (2018).

on October 20, 2020


Dow

nloaded from


cell death independently of inhibiting glycolysisinduced−-dependent demethylation of phosphatase PP2Ac promotes glucose deprivation2+Ca

Ha Yin Lee, Yoko Itahana, Stefan Schuechner, Masahiro Fukuda, H. Shawn Je, Egon Ogris, David M. Virshup and Koji Itahana

DOI: 10.1126/scisignal.aam7893 (512), eaam7893.11Sci. Signal.

tumors or perhaps even prevent cell death in other cell types, such as neurons.depolarization, hence blocking calcium influx. This knowledge might be used to therapeutically induce cell death innonmetabolizable analog of glucose did not promote, but rather prevented, cell death by inhibiting cell membrane cell death through a pathway that is unlike the currently recognized apoptosis, necroptosis, and necrosis mechanisms. A(and inactivated) the phosphatase PP2A, leading to cell death through the activity of the kinase RIPK1. RIPK1 triggered Loss of glucose triggered the influx of calcium across the plasma membrane, which activated a protein that demethylatedfound that some cancer cells are particularly sensitive to glucose loss but not because of starvation as one might expect.

.et alGlucose is a critical nutrient for cell survival, particularly in neurons and some types of cancer cells. Lee A glucose-calcium connection in cell death

ARTICLE TOOLS http://stke.sciencemag.org/content/11/512/eaam7893

MATERIALSSUPPLEMENTARY http://stke.sciencemag.org/content/suppl/2018/01/05/11.512.eaam7893.DC1

CONTENTRELATED

http://stke.sciencemag.org/content/sigtrans/13/616/eaax6490.fullhttp://stke.sciencemag.org/content/sigtrans/12/597/eaaw8000.fullhttp://stke.sciencemag.org/content/sigtrans/11/546/eaao1716.fullhttp://stke.sciencemag.org/content/sigtrans/11/542/eaau9719.fullhttp://stm.sciencemag.org/content/scitransmed/9/408/eaao6129.fullhttp://stke.sciencemag.org/content/sigtrans/9/415/ra18.fullhttp://stke.sciencemag.org/content/sigtrans/9/415/eg2.full

REFERENCES

http://stke.sciencemag.org/content/11/512/eaam7893#BIBLThis article cites 116 articles, 47 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.Science SignalingYork Avenue NW, Washington, DC 20005. The title (ISSN 1937-9145) is published by the American Association for the Advancement of Science, 1200 NewScience Signaling

Science. No claim to original U.S. Government WorksCopyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of

on October 20, 2020


Dow

nloaded from

http://stke.sciencemag.org/content/11/512/eaam7893

http://stke.sciencemag.org/content/suppl/2018/01/05/11.512.eaam7893.DC1

http://stke.sciencemag.org/content/sigtrans/9/415/eg2.full

http://stke.sciencemag.org/content/sigtrans/9/415/ra18.full

http://stm.sciencemag.org/content/scitransmed/9/408/eaao6129.full

http://stke.sciencemag.org/content/sigtrans/11/542/eaau9719.full

http://stke.sciencemag.org/content/sigtrans/11/546/eaao1716.full

http://stke.sciencemag.org/content/sigtrans/12/597/eaaw8000.full

http://stke.sciencemag.org/content/sigtrans/13/616/eaax6490.full

http://stke.sciencemag.org/content/11/512/eaam7893#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


cell death copyright © 2018 ca2+-dependent demethylation ... · cium into the cytoplasm leads to...

Documents