ICANCER RE5EARCH55, 5424—5433,November 15, 19951

of the tumors. In addition to its prognostic relevance, the steroidreceptor content of breast cancer cells has emerged as a reliablepredictor of response to endocrine treatment (Refs. 7 and 8; reviewedin Ref. 9). There is need for additional prognostic markers, since aconsiderable percentage of patients with a pattern of favorable factorsmay be cured by local treatment, thereby avoiding systemic therapy(8—10).

A number of gene products have been proposed as importantfactors for the clinical course of breast cancer. These include HER2/neu, EGF receptor, 67 kDa high-affinity laminin receptor, cathepsinD, and proteins involved in cell cycle regulation (p53, Rb, c-Myc, andCyclin D), which are either overexpressed and/or altered by mutations(reviewed in Refs. 11 and 12). Decreased expression of Nm23 (13) orup-regulation of hepatocyte growth factor/scatter factor (14) are correlated with reduced disease-free and overall survival of the patients.Cell adhesion molecules such as integrmns, E-cadherin, and the hyaluronate receptor CD44 have also been shown to correspond withsurvival of breast carcinoma patients (15—18).In an animal model, theformation of spontaneous metastases in tumors of the rat has beenconferred by cDNA transfections of specific CD44 splice variants(19). Furthermore, the expression of distinct CD44 isoforms appearsto be involved in human tumor progression as well (reviewed inRef. 20).

CD44 is a transmembrane glycoprotein encoded by 20 exons, atleast 10 of which are variably expressed due to alternative splicing ofthe nuclear RNA (21). Thus, accompanying the highly abundantCD44s,2 which is devoid of alternatively spliced variant exons, aconsiderable number of splice variants code for additional parts of theextracellular region (Fig. 1). Numerous combinations of the variantexons were detected in the more than 30 different isoforms reportedfor various tissue types, embryogenesis, lymphohemopoiesis, andleukocyte activation (reviewed in Refs. 22—24).Combinations contaming exon 6v appear to be of major importance for tumor dissemination in rat pancreas carcinoma (19, 25) and in human nonHodgkin's lymphoma (26) and colon carcinoma (27), as well as inmammary carcinoma (28). Whereas CD44s is the principle receptorfor hyaluronate, ligands for the variant regions remain to be determined (reviewed in Ref. 29). Cell attachment to hyaluronate is directly implicated in the regulation of tumor development and promotion of growth (30). In addition to the interaction with components ofthe extracellular matrix, the CD44 variant regions may confer newbinding properties to soluble or membrane-bound molecules facilitating the directional dissemination of tumor cells.

To determine its prognostic relevance in a larger tumor collection,we have analyzed protein and RNA expression of CD44 isoforms in108 node-negative and 119 node-positive breast carcinomas. Theevaluations were correlated with disease-free and overall survival ofthe patients.

2 The abbreviations used are: CD44s and CD44v, standard and variant isoforms of

CD44, respectively; HPRT, hypoxanthine phosphoribosyltransferase; RT, reverse transcription; ER, estrogen receptor; PR, progesterone receptor.

5424

CD44IsoformsCorrelatewithCellularDifferentiationbutnotwithPrognosisinHumanBreastCancerKay Friedrichs, Folker Franke, Björn-WielandLisboa, Gerd Kügler,Ingbert Gile, Hans-Joachim Terpe,FritZ Hölzel, Heinrich Maass, and Ursula Günthert'

Department of Obstetrics and Gynecology, University of Hamburg. Hamburg, Germany [K. F., B-W. L, G. K., F. H., H. Mi; Department of Pathology, University of Giessen.Giessen, Germany (F. F., 1. G., H-i. TI: and Basel Institute for immunology, Grenzacherstrasse 487, CH-4IXJ5 Basel, Switzerland (U. G.J

ABSTRACT

CD@1is a transmembrane glycoprotein occurring in several isoformswith different extracellular regions. The various transcripts are encodedby one gene locus containing 20 exons, of which at least 10 can bealternatively spliced in nascent RNA. Isoforms encoded by the variantexous (termed CD44v) are highly restricted in their distribution in nonmalignant tissue as opposed to the standard form of CD44 (CD44s)abundant in many tissues. Specific variant Isoforms containing exon 6vhave been shown to render nonmetastatic rat tumor cells metastatic.Based on the prominent role in rat metastasis formation, CD44v isoformswere suggested to be involved in human tumor progression. Correlationsbetween prognosis and expression of CD44v have been reported forgastric and colon carcinoma, for non-Hodgldn's lymphoma, and recentlyfor breast carcinoma. We evaluated the expression of CD44 isoforms Innode.positive (n = 119) and node-negative (n 108) cases of breastcarcinoma by immunohistochemistry using CD44v exon-specilic mAbs. Ina subset of 43 cases of high-risk patients, reverse transcrlption-PCR wasused to determine the exon composition of the transcripts. Protein andRNA expression data were probed statistically for their correlation tosurvival of the patients and clinical risk factors. In contrast to recentlypublished data (M. Kaufmann et aL, Lancet, 345: 615—619, 1995), in ourcohort disease-free and overall survival data did not Indicate significantcorrelations with the expression ofthe analyzed isoforms in univariate andmultivariate analyses. Comparison of CD44 protein expression with established clinical risk factors for survival such as tumor size (pT1+pT1)and histOlOgicalgrading revealed correlations with the presence of CD44s(P = 0.02 and P 0.03, respectively) and CD44—9v(P = 0.05 forhistological grading). Carcinoma tissues with elevated estrogen and progesterone receptor levels showed positive correlation with CD44-6v(P = 0.001), while a trend for significant coexpression of CD44s andCD44—9v Isoforms was observed in estrogen receptor-positive tissues(P = 0.08 and 0.06, respectively). In breast cancer, CD44s, CD44-9v, andCD44—6v are apparently markers for cellular differentiation but not fortumor progression. Our data suggest that steroid hormone receptors maybe associated with the in vivoexpression of CD44—6v-containingisoformsin human mammary carcinoma.

INTRODUCTION

Breast cancer is estimated to affect approximately one of ninewomen, thus representing the most common cancer of females inmany industrialized countries (1). Early detection and improved treatment in the past decades were unable to reduce the mortality rates (2,3). Since risk-adapted, adjuvant systemic treatment of early breastcancer leads to a significant reduction in the rate of recurrence anddeath, accurate assessment of prognostic factors has become mandatory (4—6).Besides recognition of stromal invasion and of tumor type,the current procedure includes the examination of axillary lymphnodes, histological grading, size, and steroid hormone receptor status

Received 5/17/95; accepted 9/8/95.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Basal Institute for Immunol

ogy, Grenzacherstrasse 487, CH-4005 Basel, Switzerland. Phone: (+41) 61 605 1111; Fax(+41) 61 605 1222. E-mail: Guenthert@bii.ch. The Basel Institute for Immunology wasfounded and is supported by F. Hoffmann LaRoche Ltd., Basel, Switzerland.

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

•ztracsllulsrrsgion

standird .xon.

•xon-.p.cificmAbs

•-cI@J---EEiJ----c::Ii@:::J •v-8v-lOv (3•S,l7bp)

variant•xons

$v-8v (1S2,S7bp)

3v (12S+llbp)

2v-3v (258+$7bp)

4v-lv (482.Slbp)

Iv (12•.S7bp)

@ •v-1@(167.Slbp)

@ 4v-lOvI IOv I tOy (204+$7bp)

@ 3v-lOv(1014.lbp)

@ 2-tOy (I I 43,Slbp)

Fig. I. CD44v isoforms expressed in human breast carcinoma. The alternatively spliced variant regions encoding exons 2v to lOv are shown between exons 5s and 6s of the standardregion. Exons is to 5s refer to the genomic exons I to 5, exons 2v to iOv to the genomic exons 6 to 14 (exon lv is not expressed in humans), and exons 6s to lOs to the genomicexons 15 to 19 (21). The lengths of the variant exons are indicated above each box in bp. CD44-specific PCR primers are located at the 3' end of exon 5s and the 5' end of exon 6s,respectively (large arrows I and II). Small arrows below the boxes for the variant exons indicate primers for the amplification of exon-specific probes. The epitopes of mAin 25.32(CD44s), 11.10 (4v), I 1.9 and 11.31 (both 6v), and 11.24(9v) are marked below the exon boxes. In the lower part of the figure, the most frequently expressed compositions of variantexons in breast carcinoma samples are represented. Lengths of the expected PCR products are given in parentheses.

25.32 is specific for CD44s (exon 5s; working dilution, 1:100), mAb 11.10 forCD44—4v(working dilution, 1:20), mAbs 11.9 and 11.31 for CD44—6v(working dilutions, 1:30 and 1: 25, respectively), and mAb 11.24 for CD44—9v(working dilution, 1:10) containing isoforms. The expression of CD44 isoforms was evaluated independently by two pathologists (F. F. and H-i. T.) ina semiquantitative manner. Levels of protein expression were graded into four

easily reproducible subgroups: (a) no detectable expression; (b) questionableor faint expression detected in 5% of tumor cells, indicating immunopositivesubpopulations; and (d) strong and homogeneous expression in >75% of tumorcells. For practical and statistical purposes, subgroups a and b were combinedinto the group “negative―(—), and subgroups c and d were combined into the

group “positive―(+).RT-PCR. Cryopreserved carcinoma sections of 5—10 @mwere selected

microscopically before tumor cell areas were lysed by the addition ofguanidinium isothiocyanate solution in a consecutive section. RNA and

cDNA were prepared as described previously (26, 33). Briefly, total RNAwas isolated from one cryosection, followed by cDNA synthesis usingrandom primers (Pharmacia, Zurich, Switzerland) and mouse mammaryleukemia virus reverse transcriptase (Promega, Zurich, Switzerland).cDNA amounts were equilibrated semiquantitatively using the humanHPRT sequence as marker transcriptto yield a PCR product of 840 bp(primers: CCAAAGATGGTCAAGGTCGC 5' sequence, positions448-467; and CTGCTGACAAAGKVFCACTGG 3' sequence, positions

1292—1272). The CD44-specific PCR products were amplified using prim

ers homologous to the standard region directly flanking the variantsequences (Fig. 1: arrow 1, GCACAGACAGAATCCCTGCfACC, 5'

5425

MATERIALS AND METHODS

Patients and Tissue Samples. Tissue specimens of 227 cryopreserved(—80°C)primary mammary carcinomas, diagnosed between July 1987 andMarch 1990, were randomly recruited from the archives of the Department ofGynecopathology at the University Hospital Hamburg-Eppendorf. Median age

at diagnosis was 52.8 years (range, 31—76years), with approximately one-third(37.8%) premenopausal patients. Median time of observation was 56.9 months(range, 45—80 months). Node-negative patients (n 108) were followed up

and obtained no adjuvant systemic treatment. Node-positive postmenopausalpatients (n = 70) received adjuvant endocrine treatment (tamoxifen) for 2

years, while ER- and/or PR-negative patients (n = 17) were treated with CMFchemotherapy (6 cycles of cyclophosphamide, methotrexate, and S-fluorouracil, applied every 3 weeks). Premenopausal patients with a maximum of three

involved lymph nodes (n = 32) also received the CMF regimen. Premenopausal women with more than three tumor-infested lymph nodes (n 17)

underwent six cycles of FEC polychemotherapy (5-fluorouracil, epirubicin,

and cyclophosphamide), according to standard protocols. Distant metastaseshad been diagnosed in 35% (n 79) of the women studied, and 46 patients

ultimately died during follow-up.Pathology and Immunohistochemistry. Diagnostic evaluation, tumor

typing, and grading (31) as well as determination of the lymph node statuswere routinely performed in the Department of Gynecopathology in Hamburg.In hematoxylin/eosin stainings of the cryopreserved tissue each specimen wasproven to contain invasive tumor cells. Subsequently, serial cryostat sectionsof the 227 tumors were used for immunohistochemistry, applying the alkalinephosphatase anti-alkaline phosphatase technique (32). mAbs against defined

regions of CD44 (Fig. 1) were applied as described by Mackay et a!. (33). mAb

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

CD@ ISOFORMSIN HUMANBREASTCARCINOMA

Fig. 2. Expression of CD44 proteins in normal breast tissue. A, mAb 25.32 detects CD44s in the epithelium of terminal ducts and ductules as well as in surrounding endothelial andsome stromal cells. B. mAb 11.31 specific for CD44—6v shows expression confined to the epithelial compartment, e.g., to myoepithelial and to basally located epithelial cells of theproliferating pool of the terminal duct lobular unit. Immunoreactivity is almost absent in the more matured luminal duct epithelium at lateral and apical cell borders. (A and B, sametissue area; X 125).

%@ C

@ 4_ “@iim,.“- - . _.4: ... ,,:dMI,:.@@

... ,, :- t@ ,..@. ...4:@J;. ... ‘l,•@@@@@@@ .@ - . . J:.@@ ‘@

@. .... ,@ 1.@ @•@ .!@ ‘@ -.@@ @-

@ ‘... .... .y.. ._- .@

r,, .@, .:@.jf .;@@@ ..@:?:-.@ - .:.:..@ ..

.,. . . @-?--4.f@3.@ @‘. .:: ‘.-@@@ •@ . .

,

0@@ :‘lt:•Ilf@'@i@@@

@-‘;:.i;.. ‘I 7

B :@•.‘:@ ..@ • ... % @.

!e@@g@ ?‘@ -

I

. ..-. @@•#. ....- ... ...,‘

,

I ?-

@t :@‘ :@@?-@ @/

_‘:L@@

.@; p' @çc@

I@@

D@

10 mm at 72°Cin an AMS Europe PCR cycler using AmpliTaq DNApolymerase (Hoffmann-La Roche, Basel, Switzerland). CD44 PCR products were separated on I .2% agarose gels, blotted onto nylon membranes

(Hybond N+, Amersham, Zurich, Switzerland), and subsequently hybrid

5426

;@“4@

@ .p@... ....@._., @p @@‘hU .@ •‘.@ .. . . . - . -

@ @;: . •@.@ .@ . . . . ..,@ ‘ -......... .,.... ..-.@

@ @“

— Ira

. , 1@@ ‘@@ @. . ‘@ @.@ -@@ . :

../:-‘• ,@ . . , . .. .—.:‘@ -@. . • .@

@::@! @.•- .@@ •:‘@@ @:â€@̃i. @:@@

@J.:@@ .;@ . ,@ -@@ 1' _@

C, : :@ :. : â€ẫ€˜.:

sequence, positions 759—781,and arrow II, 000GTGGAATGTGTCTTGGTCTC, 3' sequence, positions 805—783of the CD44s sequence). ThePCR regime used was 95°Cfor 5 s, annealing at 50°C(HPRT) or at 60°C(CD44) for 15 s, extension at 72°Cfor 1 mm with 31 cycles, followed by

Fig. 3. Invasive ductal carcinoma negative for CD44 isoforms. A, mAb 25.32 shows strong expression of CD44s in peritumoral inflammatory cells and area of angiogenesis, whereastumor cells are negative. B, mAb 11.24 specific for CD44—9v marks residual normal epithelium only (arrowheads) but no tumor cells. C, mAb 11.31 detects expression ofCD44—6v-containing isoforms in residual normal epithelium (arrowheads) but not on tumor cells. D, mAb 11.10 (CD44—4v specific) does not stain tumor cells or normal epithelium.(A-D, same tumor area; X 125).

‘@

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

CD44ISOFORMSIN HUMANBREASTCARCINOMA

t'::@@@@ @@:‘@ @?‘;@-::@; 4tb,@:@i

,,,-j.,T@-.‘@@ ..,@@@ @:

.- - @: •@

@@ @...@ . - .@ . - -@ --@ @_.3•-•.-,...

Fig. 4. Invasive ductal carcinoma positive for CD44 isoforms. A, mAb 25.32 shows strong expression of CD44s in tumor cells, peritumoral inflammatory cells, and areas ofangiogenesis. B and C, mAbs 11.24 (9v) and 11.31 (6v), respectively, indicate staining of all tumor cells. D, mAb 11.10 (4v) detects only a minority of tumor cells. (A-D, same tumorarea; Xl25).

@. @1':@

@ ;@

-., . .@ ,@ @,.. ‘p@@ .@ †ẫ€˜ -

. ..t@*@ .@.

@ @‘@

‘le@@@@ •.:@a@@'@4 @.‘

@@@ ‘i.. @;:4'.

‘I.@@@ •..@ . l@@

D@ ‘j―@ ..

. - :.:i,@@

-@

.‘ .

. -@ ‘l --@ ; •@

@ .

-,-@ _4.

ized with CD44 variant exon specific probes generated by PCR amplifica

tion using variant exon specific primers (Fig. 1, small arrows). The probes

were obtained from appropriate cDNA (1 pg/reaction) and span the exons2v-IOv. In addition, the cDNA from CD44s served as a source for determining the nonvariant form, yielding a product of 67 bp. The following

exon-specific primers were used for amplification of single variant exons to

generate exon-specific probes: exon 2v, 5'-ClTTGATGAGCACTAGTGCT and 5'-CAGCCA'ITFGTGTTGTFGTG; exon 3v, 5'-GTACGTCTTCAAATACCATC and 5'-TGGTGCTGGAGATAAAATCT; exon 4v, 5'-

@CAACCACACCACGGGCCand 5'-CAGTCATCCTfGTGGTfGTC;exon 5v, 5'-ATGTAGACAGAAATGGCACC and 5'-11@GTGCTfGTAGAATGTGGG; exon 6v, 5'-TCCAGGCAACTCCTAGTAGT and 5'-CAGCTGTCCCTG'fl@GTCGAA; exon 7v, 5'-CAGCCTCAGCTCATACCAGC and 5'-CCATCCTfCVFCCTGmGA; exon 8v, 5'-ATATGGACTCCAGTCATAGT and 5'-GCGTFGTCATTGAAAGAGGT; exon 9v,5'-AGCAGAGTAATTCTCAGAGC and 5'-TGCUGATGTCAGAGTAGAA; exon lOv, 5'-ATAGGAATGATGTCACAGGT and 5'-CTGATAAGGAACGA1TGACA.

The exon-specific probes were labeled with [a-32P]dCTP (Megaprime labeling kit; Amersham). The blotted products were hybridized, washed understringent conditions (0.2X SSC-0.1% SDS at 65°C)and exposed to KOdakX-AR films at —70°Cwith Cronexintensifyingscreens for 1 to 30 h.

Statistical Methods. Statistical evaluations were performed using theEGRET statistics package (Epidemiological Graphics, Estimation and Testing,version 0.26.6, Statistics and Epidemiology Research Corporation and Cytel

Software Corporation, Madison, WI). The Kaplan-Meier model (34) was usedfor disease-free and overall survival curves. Multivariate analyses were basedon the Cox regression model. Complete datasets with respect to pathobiological variables for prognosis and clinical follow-up were available in all cases.

Quantification of Steroid Hormone Receptors. Cytosolic ER and PRlevels were determined using the dextran-coated charcoal technique. Valuesabove 20 final/mg tissue protein were considered as positive in agreement withthe revised standards of the European Organization for Research on theTreatment of Cancer (1973).

RESULTS

Immunohistochemical Detection of CD44v Isoforms in BreastTumors and Normal Breast TIssue. For the evaluation of the potential role in the clinical course of breast cancer, the expressionpatterns of CD44 isoforms in primary invasive tumors were compared

with prognosis in a cohort of 227 patients of whom clinical follow-upwas available for almost 7 years. mAbs recognizing epitopes inCD44s as well as in the variant exons 4v, 6v, and 9v (33) were usedfor immunohistochemistry. Because this method detects the presenceof certain exon products but does not allow the analysis of the exoncomposition of the CD44 isoforms, we performed RT-PCR in a subsetof the carcinoma specimens.

To allow appropriate evaluation of CD44 expression in tumors,thorough immunohistochemical evaluations of nonmalignant humanbreast tissue were performed. Differing from other nonsquamousepithelial tissues, normal breast epithelium has been shown to expressCD44—6v-containing isoforms in addition to the isoforms CD44s andCD44—9v(Fig. 2; Refs. 35 and 36). Otherwise, CD44—6v-containingisoforms were detected in the epithelium of skin and esophagus (35,36). In this investigation CD44—9v- and CD44—6v-containing iso

5427

.t5* , I

-?‘

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

:is 0.75

2a-

-

3Cl)

CD44—9v,-6v, and -4v (Fig. 3, B, C, and D, respectively). In areas ofresidual normal ductal epithelium, focal staining was retained withmAbs 11.24 (CD44—9v) and 11.31 (CD44—6v) (Fig. 3, B and C,arrowheads). In case no. 465, expression of the isoforms CD44s(Fig. 4A), CD44—9v(Fig. 4B), CD44—6v (Fig. 4C), and CD44—4v(Fig. 4D) has been observed in tumor cell areas.

Correlation of CD44 Isoform Expression with Survival of thePatients. For testing the biological relevance, CD44 expression wascompared with disease-free survival (Fig. 5, A-C) and overall survivalof the patients (Fig. 5, D-F). Immunohistochemical presence ofCD44s (Fig. 5A) and CD44—9v (Fig. 5C) isoforms did not reveal

0.50

0.25

70 80

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

1.00

0.75@

n-s.

CD44s +0.50. _________

025. CD44s-

- 27/67

+52/160 A. I I U I U U I

0 10 20 30 40 50 60 70 80

1.00@

0.75-@ CD4@6v +

n.s.(p< .07)

0.50-

025- CD44-6v-

- 52/128

+ 27/99 B

)

.0S

.00

a-

S.?

3Cl)

I,SSS

0

2a-

S.

3Cl)S

SSS.8a

.0

:1@

0 10 20 30 40 50 60 70 80

1.00

@b 0.75

.0

I:::1.00

&â€0̃.75.0

0I.

a- 0.50S

3Cl) 0.25

1.00

) 10 20 30 40 50 60 70 1

CD44.6v -

. 27/128

@+16:9@@@@@ E

80

1.00@

0.75@

0.50@

0.25@

forms were expressed in the epithelium only, whereas CD44s was alsodetected in stromal elements, e.g., fibroblasts, capillary endothelium,and extravasal lymphocytes (Fig. 2A). Thus, we substantiate thefinding of variably but focally strong immunoreactivity for CD44—6vin normal myoepithelial and in ductal and ductular epithelial celllayers, the latter often exhibiting well-defined decorations of basal aswell as basolateral cell membranes (Fig. 2B). CD44—4v isoformswere not detectable in normal breast tissue (data not shown).

The serial cryosections of invasive ductal carcinoma revealed considerable heterogeneity of CD44 isoform expression (Figs. 3 and 4).In case no. 1420, CD44s expression was restricted to stromal cells

0 10 20 30 40 50 60 70 80

Months0 10 20 30 40 50 60

Months

Fig. 5. Disease-free (A-C) and overall (D-F) survival probability of breast cancer patients categorized according to CD44 isoform expression. Disease-free survival of patients withtumor immunoreactivity for CD44s (A), CD44—6v (B), and CD44—9v(C). Overall survival probability for patients in correlation with the expression of CD44s (D), CD44—6v (F),and CD44—9v(F). Immunoreactivity was based on samples with >5% staining of the tumor cells (+) and on samples with none to

isoformsRisk

factorsNo.of CD44s CD44-6v CD44-9v

patients (% positive cases)―(% positive cases)―(% positivecases)°Menopausal

statusNS NSNSpremenopausal8669.8 46.568.6postmenopausal14174.5 44.771.6Node

statusNS NSNSpositive119 69.7 47.968.9negative108

75.9 38.976.8Tumor

sizeP = O.O2a NSNSpT16368.3 41.366.6pT211280.4 45.577.7pT33450.0 41.261.8pT41855.6 45.072.2ER

contentP = 0.08c p 0.OO1C pO.06c(fmol/mgprotein)196683.3 60.681.8PR

contentNS P = 0@1dNS(fmol/mgprotein)197281.9 62.576.4Histological

gradingP = 0.03e NS P =0.05eGI37 83.8 46.081.1GII88 703 48.969.3GIII102 60.8 36.3 59.8

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

Analysis of CD44 Exon Compositions by RT-PCR. To determine the pattern of variant CD44 expressed in a subset of 43 nodepositive patients with an adverse prognosis (>2 lymph nodes involved), RT-PCR analyses were performed (Fig. 6). The amount ofcDNA used for CD44-specific PCR was equilibrated semiquantitatively to the amount expressed by the HPRT gene (Fig. 6, HPRTpanel). Hybridizations with CD44 exon-specific probes (compareFigs. 1 and 6, panels CD44—2vto CD44—lOvand CD44s) revealedthat most of the analyzed tissues contained RNAs encompassing thecombined variant exons 8—9—10with a length of 463 bp (exons8v + 9v + lOv with 396 bp plus CD44s with 67 bp; Fig. 1). Otherrather constantly expressed isoforms containing either exons 3v, 6v,or lOv spliced into the standard framework resulted in PCR productlengths of 193, 196, and 271 bp, respectively. Expression of the threeshort isoforms was described previously as characteristic for reactiveand naive lymphocytes (24, 26). Longer isoforms, containing exon 6vin combination with other variant exons, have been observed predominantly in high-grade malignant non-Hodgkin's lymphomas and inactivated and memory lymphocytes (24, 26, 37). These isoforms(compare Fig. 1) consisting of exons 6v-lOv (724-bp length), 4v-7v(559 bp), 4v-lOv (955 bp), 3v-lOv (1081 bp), and less frequently2v-lOv (1210 bp) were detectable in most of the 43 cases analyzed inthis study. The same isoforms were observed and occur preferentiallyin normal squamous epithelia of the skin and esophagus (33, 35, 38).During our investigation, these isoforms were also observed in normal

breast epithelial cells by RT-PCR (data not shown) as well as by theless sensitive technique of immunohistochemistry (compare Fig. 2).Apparently, expression of isoforms containing exons 4v-7v, 4v-lOv,3v-lOv, and 2v-lOv is not occurring specifically in breast cancer cellsand rather appears to reflect the cellular heterogeneity of the individual tissue examined.

In the majority of the analyzed cases, high CD44—6v proteinexpression levels (+ + and + + +) were in accordance with elevatedlevels of RNA expression (Table 2). This was evident in 23 of the 26cases, when levels of RNA encoding the longer form of CD44—6v-containing isoforms were compared with the protein expression. Theshorter CD44—6v isoform containing only exon 6v in the standardframework was corresponding in 17 of 26 cases with elevated proteinexpression; 15 of the 17 cases were, however, coexpressing the longerisoforms. By evaluating all RT-PCR data for the long form of CD44—6v, concordance with one scoring point of deviation was observedwith the expression of CD44—6v protein in 41 of the 43 casesexamined. There appeared to be a predominance of elevated levels(+ + or + + +) of thelongformof CD44—6vRNAin 13tumorsofthe 16 deceased patients, in comparison with only 9 of 16 specimenscontaining the short form, 7 of those coexpressing the long form. Inthe 12 patients with remote metastases, expression of the long formwas noted in 6 tumor tissues and the short form in 8 tumors, 5 of thosecoexpressing the long form. However, in 12 tumors of the 15 patientsalive, elevated levels of the long form of CD44—6v RNA werelikewise found, and the short form in 9 of 15 tumors, 7 of thosecoexpressing the long form. Of the remaining 17 tumor specimenswith negative or weakly positive expression of the 6v short isoforms,11 of the tumor-bearing patients had developed metastases or diedmeanwhile. Among the 12 patients with reduced expression of the 6vlong isoform, 9 developed metastases or died. Thus up- or downregulation of neither the long nor the short form of CD44—6v-containing RNA correlated with progressive disease.

The presence of 8v-lOv- or 2v-containing isoforms also did notcorrelate with survival data. In most tissues, the presence of 3v, 6v,and lOv isoforms containing the single variant exon in the standardframework may be due to infiltrating lymphoid cells (24, 26). Theseisoforms were detectable at elevated levels in all of the 43 analyzed

toward significance (P < 0.07) was noted for the group of 128 patientswith tumors expressing CD44—6v (Fig. 5B). Thus, the presence ofCD44—6vappeared to be associated with less aggressive tumors inthis investigation. Comparison of overall survival with expression ofCD44s-, CD44—6v-, and -9v-containing isoforms did not reveal statistical significance (Fig. 5, D-F, respectively).

Expression of CD44 Isoform in Correlation with Clinical RiskFactors. Toestimate its prognostic value, the expression of CD44isoforms was compared with established clinical risk factors forrelapse, such as menopausal status, axillary lymph node status, tumorsize, hormone receptor status, and histological grading of the tumors(Table 1). Expression of CD44s was seen significantly more often inwell-differentiated tumors (grading I versus III) of relatively smallsize (5 cm, pT3 and pT4), CD44s was significantly less expressed than inthe group with smaller tumors (51.9% versus 76.0%), supporting theclinical observation of poorer outcome for the p1'3 and pT4 groups.Expression of CD44—9valso correlated significantly with better histological grading but not with tumor size. Noteworthy, CD44—6vexpression was significantly correlated with elevated levels of ERsand PRs, while the presence of CD44s and CD44—9visoforms onlyrevealed a trend toward significance for elevated ER contents (Table1). Other clinical factors were not correlated with CD44—6v expression. The association of favorable prognostic factors with expressionof CD44s isoforms does not imply a statistically significant differencein life table analyses, as illustrated by the Kaplan-Meier curves withrespect to disease-free (Fig. 5A) and overall (Fig. 5D) survival.However, CD44—6v expression was associated with prolonged disease-free survival with near significance (Fig. 5B). An independentmultivariate analysis of disease-free survival with respect to elevatedPR contents and the expression of CD44—6vrevealed a significantpositive correlation for better survival of the patients (P = 0.04; datanot shown). A subgroup of 89 carcinomas was analyzed for CD44—4vexpression and did not reveal a correlation with survival.

Table 1 Correlation of established clinical risk factors with expression of CD44

a Expression determined by microscopical evaluation. P refer to the difference inimmunoreactivity @j,ositive versus negative) evaluated in univariate analyses and werecalculated by [chi] test. NS, not significant.

b pT1 + pT2 versus pT3 + pT4 tumors.C ER content >19 versus < 20 fmollmg protein.

d PR content >19 versus < 20 tool/mg protein.

eG I versus G III.

5429

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

ii .@

@ -

, ______ ___

32@—.

@@ ___ 1CD44Sv

@ eM 16 17 18 19 20 21 22 23 2425 26 27 28 29

@ a@@

l@@!o@@ ; _,@ @@@@CD44-3v

1J@tT•ICD4 Iv

U 6 17 18 19 20 21 22 23 2425 26 27 28 29

M 30 31 32 33 34 35 36 37 38 39 40 41 42 43M30 31 32 33 34 35 36 37 36 394041 42 43

@@ __@ . CD44-2v

I@ @:T@11 CD44-3v

I @!I-@J@j:;t;i CD44-4v

‘::@ @O ‘@‘@°,°,::@ •_@ I—.

I@@ I cD44-Sv

LE:@i•I I —5m@

‘@°!:@I@

M°@-@-•

4A@ 234567 I 9 10 11 12 13 14 15 6 7 89 10 1l_12 13)415•@lIN@m!1!1@@

•@iuuii@—ó@@@ C D44@5v

.@CD44-2v

C044-3v

‘@—

CD44-4v

1@I1@e.@.- —,@@

@aFig. 6. CD44 expression by RT-PCR in 43 nodepositive patients. The amount of cDNA was equilibrated semiquantitatively for each sample to the cxpression of HPRT (HPRT panel). CD44 PCR wasperformed with equivalent amounts of cDNA usingprimers I and II (compare Fig. 1), and the productswere separated on 1.2% agarose gels (CD44s gelpanel), blotted, and hybridized with the indicatedexon-specific probes. M, molecular weight marker.

CD44-IOv

I.

‘:@

@ 0•@,4_as.... ,

C

CD44-9v

C044-1 Dv

CD44.

CD44s(gel)

HPRT

(9.')

;:ti @i.-iji—.... -.

ala

!@@ 1—'1CD44-5e

C

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

Patient no.Patients'outcome―Immunohistochemistry―

CD44-6vRT-PCRCD44@6vc

(short form)RT-PCRCD44@6vc

(long form)ERstatus'@PRstatus'@1m++++++++++2m++++++3d++++++++4a+++++++5m+++++++++6r@+++++——7d+++—+++(+)+8a++++4+++++9d+++÷++(+)10a++++——11a+++++++12d+•:-++++++++13a+++++++++++14d++++++++++(+)15d++++++16m—+++———17d+—+++—18a+++++++19d++++++++(+)20d—+++(i)+21d+++—+++(+)+22a++++++++++23a++++++++(+)24d++++++++++25a++-+++(+)+26a+++++——27m++++++++28a+++++++++29d+++++++++++30m++++——31d++++++——32m+—+——33m++++++++++34m++—+(+)35a—++—+(i)36m+++++++++++37d—+—+—38m—++—++39a++—(+)+40d++++—+(+)41d++++++++++42a++++———43a++++÷+++

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

patients with gastric (39) and colon (27) carcinoma as well as inpatients with non-Hodgkin's lymphoma (26). Additionally, in a recentreport, a positive correlation between protein expression of CD44—6vas revealed by immunohistochemistry and adverse clinical outcome ofbreast carcinoma patients is indicated (28). In our study involving theclinical data of 227 breast carcinoma patients observed over a periodof up to 80 months (median time of observation, 57 months),CD44—6vexpression did not correlate with an adverse prognosis. Onthe contrary, CD44—6vprotein expression was corresponding with anincrease in disease-free survival, although not in overall survival.Analysis of the RT-PCR data revealed that expression of neither thelong form nor the short form of CD44—6v-specific RNA provided areliable indicator for the state of disease. Taken together with thelevels of immunohistochemically-determined presence of CD44v isoforms and CD44s, a wide spectrum of expression levels is obvious,reflecting rather the tumor heterogeneity of individual patients than anassociation with parameters of aggressive tumor growth. In the otherstudy (28), the clinical course of the rather small cohort of 91 patients(median time of observation, 35 months) does not, however, correlatewell with established clinical risk factors such as node status, tumorsize, and histological grading in multivariate analyses (1, 4, 6). Thismay explain why immunohistochemical evaluation using mAb VFF7indicates a positive correlation between expression of CD44—6visoforms and overall survival in this cohort, while we have notdetected such as correlation using the same antibody for screening ourtumor specimens. Analyses of the epitopes recognized by the CD44—6v-specific antibodies reveal either complete identity or substantialoverlap, when 16-mer nested peptides are applied for blocking thebinding to a 3v-lOv fusion protein in an ELISA (33). Furthermore,only reactivity with DIII, a less defined polyclonal serum, emerges asan independent prognostic factor for an adverse outcome (28).

While in two independent reports expression of CD44—6visoformscannot be detected in normal breast epithelium (28, 40), in variousother analyses, including the present one (compare Fig. 2), this isoform can readily be detected in the myoepithelium, ductal epithelium,and acini (35, 36, 41, 42). Thus, their complete absence in normalcells of tumor tissue and the usefulness as indicators of malignantcells (28) appear highly unlikely. Therefore, we assume that the datashowing a positive correlation between the expression of CD44—6visoforms and prognosis (28) are influenced by a strong bias in thepatients' population evaluated with a poorly defined polyclonal serum(43). Further analyses including more patients representing a standarddistribution of clinical parameters have to be performed to excludevariations due to the complex and multifunctional nature of the CD44isoforms.

Most invasive carcinomas develop within the epithelium of theterminal duct lobular unit (44). They may contain variously differentiated tumor areas and thus may be accompanied by precursor lesions,e.g., carcinoma in situ or atypical hyperplasia. It has been reportedthat in cases of carcinoma in situ, expression of CD44—6visoforms isdown-regulated (36, 41), although distinct expression patterns withinthe major breast tumor types have not been observed.3 Taking intoaccount that expression of CD44—6v often occurs in normal epithehum, in benign epithelial hyperplasia and in benign neoplasms likefibroadenomas, this parameter can hardly indicate a metastatic potential per se. More likely, in human breast parenchyma, the presence ofCD44—6v and -9v isoforms may be a marker for a specific stage ofcellular differentiation, possibly involving in the maintenance of cellcell and cell-matrix interactions of the ductal and ductular epithelium.The deregulation of various cell adhesion molecules, e.g., integrins, is

Table 2 Compilation of RT-PCR data in comparison with patients â€õutcome,immunohistochemistry, and receptor status

aAll patientswerenodalpositive;a,alive;m,withdistantmetastases;d,deceased.b Immunohistochemical evaluation with antibody I 1 .9 as described in “Materials and

Methods.―C RT-PCR data taken from Fig. 6. Evaluation semiquantitatively: +++, strong expres

sion, ++, moderate expression; +, weak expression; —,no expression. Short form, 196-bplength containing only exon 6v in the standard frame-work; long form, combinations ofexon 6v with other variant exons, resulting in longer isoforms.

d Hormone receptor status: +, >19 fmol/mg protein; (+), 10—19 fmol/mg protein; —,

0—10fmol/mg protein.

cases for the 3v isoforms, for the 6v isoforms in 26 of 43 cases, andfor the lOv isoforms in 39 of 43 cases.

In the overwhelming majority ofthe 43 samples studied, the ER andPR status were concurring. In only two cases was the elevated ERcontent not accompanied by distinctly increased PRs. In 28 of the 33cases with elevated PR and/or ER levels, these correlated with elevated levels of the CD44—6v-containing long isoform. The 10 casesof reduced or negative levels of hormone receptor were mostly negative or only weakly positive for the 6v long isoform. The RNAexpression data thus confirm the positive correlation between elevatedhormone receptor levels and protein expression of CD44—6v (compare Table 1) and furthermore indicate that markers for cellulardifferentiation are the long CD44—6v-containing isoforms (compareFig. 1).

DISCUSSION

CD44v isoforms are implicated in metastasis formation in a rattumor model (19) and are correlated with adverse prognosis in

3 F. Franke, K. Friedrichs, J. Gille, H-J. Terpe, and U. GOnthert. CD44 isoforms in

breast cancer, manuscript in preparation.

5431

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

a known phenomenon in tumor progression accompanied by loss ofdifferentiation and cellular polarization (15). Similarly, dedifferentiation during malignant transformation may change the polarized expression of CD44 isoforms and thereby lead to alterations in thecell-cell and cell-matrix interactions. This is corroborated by ourfmdings in steroid receptor-positive tumors with histological gradingI, which are mostly CD44—6v positive and reflect the cellular differentiation and surface distribution as in normal epithelial tissue. Interestingly, tubular carcinoma, a highly differentiated type of invasivebreast carcinoma, usually with a favorable prognosis, shows consistent expression of CD44s as well as 9v- and 6v-containing isoforms.3

Additional data reveal that CD44—6v-containing isoforms are indicators for well-differentiated tumors, but only in those in whichnontransformed cells are CD44—6v positive. In squamocellular tumors in which tumor cells retain CD44s expression, CD44—6v-containing isoforms are practically absent from the invasive cells (45).In tumors originating from squamous epithelium of the skin, expression of CD44—6v is apparently associated with regulated, normaldifferentiation and proliferation processes, and expression of thisisoform is silenced during malignant transformation (45). In themaintenance ofthe pulmonary histoarchitecture, CD44v isoforms playpivotal roles. During pathological alterations such as pulmonary fibrosis, the disrupture of the epithelial-mesenchymal interactions isaccompanied by loss of CD44v isoforms on the surface of the cells(46). In neuroblastomas, in which CD44v expression is undetectable,

CD44s expression is strongly correlated with cell lineage differentiation (47, 48). N-Myc amplification characteristic for advanced stageswith aggressive and metastatic behavior is highly inversely correlatedwith CD44s expression in neuroblastoma patients (47, 48).

Although discussed with some controversy, a likely marker forcellular differentiation in breast tumor tissue is an elevated level ofERs and PRs (49, 50). These receptors are hormone-inducible transcription factors that share common structures with receptors for

retinoic acid, thyroid hormone, vitamin D, and glucocorticoids (reviewed in Ref. 11). All of these receptors are composed of severaldomains with distinct functions, among them a DNA-binding regioncontaining two zinc fingers. This domain recognizes and binds tospecific palindromic sequences in the promoter region of responsivegenes (51, 52). For transcriptional activation, not only hormone receptor binding is required, but additional nuclear proteins are necessary to perform protein-protein interactions (reviewed in Ref. 1 1). It

remains to be demonstrated whether regulatory sites function in vivoto modulate expression of CD44 by hormone receptors. Estrogens caninfluence cellular proliferation and differentiation in breast epithelialcells (49). In a preliminary study, human breast cancer cell linesshowed positive correlations between ER status and expression ofCD44v (53). Other genes, which are involved in breast tumor progression and regulated by steroid hormones, are cathepsin D (49) andthe high-affinity 67-kDa laminin receptor (54).

We found a coincidence in the apparent markers for differentiation(ERs and PRs) with a putative marker for a more differentiatedphenotype (CD44—6v), disproving a significant role of CD44—6v-containing isoforms in the progression of breast cancer but suggestinga regulatory influence of steroids in the expression of CD44—6visoforms.

ACKNOWLEDGMENTS

We thank Dr. Patricia Ruiz (Max DelbrUckCenter, Berlin, Germany) andDes. Reinhard Stauder and Beat A. Imhof (Basel Institute for Immunology) forcritical comments and helpful suggestions on the manuscript, and Viviane

Anquez (Basel Institute for Immunology) for expert technical assistance.

REFERENCES

1. Harris, J. R., Lippman, M. E., Veronesi, U., and Willett, W. Breast cancer. N. Engl.J. Med., 327: 319—328, 390—398, 473—480, 1992.

2. Kessler, L. G., Feuer, E. J., and Brown, M. L. Projections of breast cancer burden to

U.S. women: 1990—2000.Prey. Med., 20: 170-182, 1991.3. Miller, B. A., Feuer, E. J., and Hankey, B. F. The increasing incidence of breast cancer

since 1982: relevanceof early detection.Cancer Causes & Control, I: 67—74,1982.4. Davidson, N. E. Biology of breast cancer and its clinical implications. Curr. Opin.

Oncol., 4: 1003—1009,1992.5. Wood, W. C., Budman, D. R., Korzun, A. H., Cooper, M. R., Younger, J., Hart, R. D.,

Moore, A., Ellerton, J. A., Norton, L, Ferree, C. R., Ballow, A. C., Frei, E., III, andHenderson, 1. C. Dose and dose intensity of adjuvant chemotherapy for stage II,node-positive breast carcinoma. N. EngI. J. Med., 330: 1253—1259,1994.

6. Mansour, E. 0., Ravdin, P. M., and Dressier, 1. Prognostic factors in early breastcarcinoma. Cancer (Phila.), 74: 381—400, 1994.

7. Aamdal, S., Bormer, 0., Jorgensen, 0., Host, H., Eliassen, 0., Kaalhus, 0., and PihI,

A. Estrogen receptors and long-term prognosis in breast cancer. Cancer (Phila.), 53:2525—2529,1984.

8. Ewers, S. B., Attewell, R., Baldetorp, B., FernO, M., UngstrOm, E., and Killander, D.Prognostic significance of flow cytometric DNA analysis and estrogen receptorcontent in breast carcinomas: a 10 year survival study. Breast Cancer Res. Treat., 24:115—126,1992.

9. Brown, M. Estrogen receptor molecular biology. Hematol. Oncol. Clin. N. Am., 8:101—112,1994.

10. Simpson, J. F., and Page, D. 1. Pathology of preinvasive and excellent-prognosisbreast cancer. Curr. Opin. Oncol., 5: 960—965,1993.

11. El-Ashry, D., and Lippman, M. E. Molecular biology of breast carcinoma. world J.Surg., 18: 12—20,1994.

12. Porter-Jordan, K., and Lippman, M. E. Overview of the biologic markers of breastcancer. Hematol. Oncol. Clin. N. Am., 8: 73—100,1994.

13. Barnes, R., Masood, S., Barker, E., Rosengard, A. M., Coggin, D. L, Crowell, T.,King, C. R., Porter-Jordan, K., Wargotz, E. S., and Liotta, L. A. Low nm23 proteinexpression in infiltrating ductal breast carcinomas correlates with reduced patientsurvival. Am. J. Pathol., 139: 245—250,1991.

14. Yamashita, J-I., Ogawa, M., Yamashita, S-I., Nomura, K., Kuramoto, M., Saishoji, T.,and Shin, S. Immunoreactive hepatocyte growth factor is a strong and independentpredictor of recurrence and survival in human breast cancer. Cancer Res., 54:1630—1633,1994.

15. Pignatelli, M., Cardillo, M. R., Hanby, A., and Stamp, 0. W. H. Integrins and theiraccessory adhesion molecules in mammary carcinomas: loss of polarization in poorlydifferentiated tumors. Hum. Pathol., 23: 1159—1166, 1992.

16. Friedrichs, K., Ruiz, P., Franke, F., Gille, I., Terpe, H-i., and Imhof, B. A. Highexpression level of a6 integrin in human breast carcinoma is correlated with reducedsurvival. Cancer Res., 55: 901—906,1995.

17. Lipponen, P., Saarelainen, E., Ji, H., Aaltomaa, S., and Syrjanen, K. Expression ofE-cadherin (E-CD) as related to other prognostic factors and survival in breast cancer.J. Pathol., 174: 101—109, 1994.

18. Joensuu, H., Klemi, P. J., Toikkanen, S., and Jalkanen, S. Glycoprotein CD44expression and its association with survival in breast cancer. Am. J. Pathol., 143:867—874, 1993.

19. GUnthert, U., Hofmann, M., Rudy, w., Reber, S., Zöller,M., Haussmann, I., Matzku,S., wenzel, A., Ponta, H., and Herrlich, P. A new variant of glycoprotein CD44

confers metastatic potential to rat carcinoma cells. Cell, 65: 13—24,1991.20. GUnthert, U., Stauder, R., Mayer, B., Terpe, H-i., Finke, L., and Friedrichs, K. Are

CD44 variant isoforms involved in human tumour progression? Cancer Surv., 24:9—42,1995.

21. Screaton, G. R., Bell, M. V., Bell, i. I., and Jackson, D. G. The identification of a newalternative exon with highly restricted tissue expression in transcripts encoding themouse Pgp-1 (CD44) homing receptor. Comparison of all 10 variable exons betweenmouse, human, and rat. J. Biol. Chem., 268: 12235—12238, 1993.

22. GUnthert, U. CD44: a multitude of isoforms with diverse functions. CTMI, 184:

47—63,1993.23. Ruiz, P., SchwSrzler, C., and GUnthert, U. CD44 isoforms during differentiation and

development. Bioessays, I 7: 17—24,1995.24. Stauder, R., and GOnthert, U. CD44 isoforms; impact on lymphocyte activation and

differentiation. Immunologist, 3: 26—31,1995.25. Seiter, S., Arch, R., Reber, S., Komitowski, D., Hofinann, M., Ponta. H., Herrlich, P.,

Matzku, S., and Zbller, M. Prevention of tumor metastasis formation by anti-variantCD44. J. Exp. Med., 177: 443—455,1993.

26. Stauder, R., Eisterer, W., Thaler, J., and GUnthert, U. CD44 variant isoforms innon-Hodgkin's lymphoma: a new independent prognostic factor. Blood, 85: 2885—2899, 1995.

27. Mulder, i-w. R., Kruyt, P. M., Sewnath, M., Oosting, J., Seldenrijk, C. A., Weidema,w. F.,Offerhaus,G.i. A.,andPals,S.T. Colorectalcancerprognosisandexpressionof exon-v6-containing CD44 proteins. Lancet, 344: 1470—1472, 1994.

28. Kaufmann, M., Heider, K-H., Sinn, H-P., von Minckwitz, 0., Ponta, H., and Herrlich,P. CD44 variant exon epitopes in primary breast cancer and length of survival.Lancet, 345: 615—619,1995.

29. Lesley, i., Hyman, R., and Kincade, P. W. CD44 and its interactions with theextracellular matrix. Adv. Immunol., 54: 271—335,1993.

30. Bartolazzi, A., Peach, R., Aruffo, A., and Stamenkovic, I. Interaction between CD44and hyaluronate is directly implicated in the regulation of tumor development. J. Exp.Med., 180: 53—66,1994.

31 . WHO Histological typing of breast tumours. In: International Histological O@ification of Tumours, No. 2., pp. 17—25,Geneva, 1981.

5432

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

CD44 ISOFORMS IN HUMAN BREAST CARCINOMA

32. Cordell, J. L., Falini, B., Erber, W. N., Ghosh, A. K., Abdulaziz, Z., MacDonald, S.,Pulford, K. F., Stein, H., and Mason, D. Y. Immunoenzymatic labeling of monoclonalantibodies using immune complexes of alkaline phosphatase and monoclonal antialkaline phosphatase (APAAP-complexes). J. Histochem. Cytochem., 32: 219—229,1984.

33. Mackay, C. R., Terpe, H. i., Stauder, R., Marston, W. L., Stark, H., and GOnthert, U.Expression and modulation of CD44 variant isoforms in humans. J. Cell Biol., 124:71—82,1994.

34. Kaplan, E. L, and Meier, P. Non-parametric estimation from incomplete observations. J. Am. Stat. Assoc., 53: 457—481, 1958.

35. Terpe, H-i., Stark, H., Prehm, P., and GUnthert, U. CD44 variant isoforms are

preferentially expressed in basel epithelia of non-malignant human fetal and adulttissues. Histochemistry, JO!: 79—89,1994.

36. Fox, S. B., Fawcett, i., Jackson, D. G., Collins, I., Gatter, K. C., Harris, A. L.,Gearing, A., and Simmons, D. L. Normal human tissues, in addition to sometumors, express multiple different CD44 isoforms. Cancer Res., 54: 4539—4546,1994.

37. Koopman, G., Heider, K. H., Horst, E., Adolf, G. R., van den Berg, F., Ponta, H.,Herrlich, P., and Pals, S. T. Activated human lymphocytes and aggressive nonHodgkin's lymphomas express a homologue of the rat metastasis-associated variantof CD44. J. Exp. Med., 177: 897—904,1993.

38. Hofmann, M., Rudy, W., Zöller,M., 161g. C., Ponta, H., Herrlich, P., and GUnthert,U. CD44 splice variants confer metastatic behavior in rats: homologous sequences areexpressed in human tumor cell lines. Cancer Res., 51: 5292—5297,1991.

39. Mayer, B., iauch, K. W., GUnthert, U., Figdor, C. G., Schildberg, F. W., Funke, I., andJohnson, J. P. De novo expression of CD44 and survival in gastric cancer. Lancet,342: 1019—1022,1993.

40. lida, N., and Bourguignon, L. Y. W. New CD44 splice variants associated withhuman breast cancer. i. Cell. Physiol., 162: 127—133,1995.

41. Fox, S. B., Gatter, K. C., Jackson, D. G., Screaton, G. R., Bell, M. V., Bell, J. I.,Harris, A. L., Simmons, D., and Fawcett, J. CD44 and cancer screening. Lancet, 342:548—549, 1993.

42. DalI, P., Heider, K-H., Sinn, H-P., Skroch-Angel, P., Adolf, G., Kaufmann, M.,Herrlich, P., and Ponta, H. Comparison of immunohistochemistry and RT-PCR for

detection of CD44v-expression, a new prognostic factor in human breast cancer. Int.J. Cancer, 60: 471—477, 1995.

43. Friedrichs, K., Kugler, 0., Franke, F., Terpe, H-i., ArIt, i., Regidor, P-A., andGOnthert, U. CD44 isoforms in the prognosis of human breast cancer. Lancet (Letter),345: 1237, 1995.

44. Tavassoli, F. A. Pathology of the Breast. East Norwalk, Connecticut: Appleton &Lange, 1992.

45. Salmi, M., Gron-Virta, K., Sointu, P., Grenman, R., Kalimo, H., and Jalkanen, S.Regulated expression of exon v6 containing isoforms of CD44 in man: downregulation during malignant transformation of tumors of squamocellular origin. i. Cell Blot.,122: 431—442,1993.

46. Kasper, M., GOnthert,U., Dali, P., Kayser, K., Schuh, D., and MOller,M. Distinctexpression patterns of CD44 isoforms during human lung development and inpulmonary fibrosis. Am. i. Reap. Cell Mol. Biol., in press, 1995.

47. Christiansen, H., Sahin, K., Berthold, F., Hero, B., Terpe, H-i., and Lampert, F.Comparison of DNA aneuploidy, chromosome 1 abnormalities, MYCN amplificationand CD44 expression as prognostic factors in neuroblastoma. Eur. J. Cancer, 31A:541—544,1995.

48. Combaret, V., L.asset, C., Frappaz, D., Bouvier, R., Thiesse, P., Rebillard, A-C.,Philip, T., and Favrot, M. C. Evaluation of CD44 prognostic value in neuroblastoma:comparison with the other prognostic factors. Eur. J. Cancer, 3/A: 545-549, 1995.

49. Lippman, M. E., and Dickson, R. B. Mechanisms of normal and malignant breastepithelial growth regulation. J. Steroid Biochem., 34: 107—121,1989.

50. Clarke, C. L., and Sutherland, R. L. Progestin regulation of cellular proliferation.Endocr. Rev., 11: 266—301,1990.

51. Klein-Hitpass, L, Schorpp, M., Wagner, U., and Ryffel, G. U. An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 genefunctions in transfected human cells. Cell, 46: 1053—1061,1986.

52. Berg, i. M. DNA binding specificity of steroid receptors. Cell, 57: 1065-1068, 1989.53. Watson, P. H., and Snell, L. S. CD44 expression and estrogen receptor status in breast

cancer. Proc. Am. Assoc. Cancer Res., 35: 83, 1994.54. Shi, Y. E., Tom, J., Yieh, L, Sobel, M. E., Yamada, Y., Lippman, M. E., Dickson,

R. B., and Thompson, E. W. Expression of 67 kDa laminin receptor in human breastcancer cells: regulation by progestins. am. & Exp. Metastasis, I 1: 251—261,1993.

5433

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

1995;55:5424-5433. Cancer Res Kay Friedrichs, Folker Franke, Björn-Wieland Lisboa, et al. with Prognosis in Human Breast CancerCD44 Isoforms Correlate with Cellular Differentiation but not

Updated version

http://cancerres.aacrjournals.org/content/55/22/5424

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

.pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/55/22/5424To request permission to re-use all or part of this article, use this link

on June 25, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/content/55/22/5424http://cancerres.aacrjournals.org/cgi/alertsmailto:pubs@aacr.orghttp://cancerres.aacrjournals.org/content/55/22/5424http://cancerres.aacrjournals.org/