bmri2013-314654

7/27/2019 BMRI2013-314654

1/11

Hndw Pshn CopotonBoMd Rsch IntntonVom 2013, Atc ID 314654, 11 pshttp://dx.do.o/10.1155/2013/314654

Research ArticleStaphylococcus aureus Clinical Isolates: AntibioticSusceptibility, Molecular Characteristics, and Ability toForm Biofilm

N. Indrawattana,1 O. Sungkhachat,1 N. Sookrung,2

M. Chongsa-nguan,1 A. Tungtrongchitr,3 S. P. Voravuthikunchai,4

T. Kong-ngoen,1 H. Kurazono,5 and W. Chaicumpa3

1 Department o Microbiology and Immunology, Faculty o ropical Medicine, Mahidol University, Bangkok 10400, Tailand2 Department o Research and Development, Faculty o Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Tailand3 Department o Parasitology, Faculty o Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Tailand4 Natural Products Research Center and Department o Microbiology, Faculty o Science, Prince o Songkla University,

Songkhla 90112, Tailand5 Department o Applied Veterinary Medicine and Public Health, Obihiro University o Agriculture and Veterinary Medicine,

Inada-cho, Obihiro, Hokkaido 080 8555, Japan

Cospondnc shod ddssd to W. Chcmp; [email protected]

Rcvd 30 My 2013; Accptd 24 Jy 2013

Acdmc Edto: So-ch Mkno

Copyht 2013 N. Indwttn t . Ts s n opnccss tc dsttd ndth CtvCommons AtttonLcns,whch pmts nstctd s, dstton, nd podcton n ny mdm, povdd th on wok s popy ctd.

Podc monton o Staphylococcus aureus chctstcs n octy s mptv s th d-sstnt vnts csttmnt pom. In ths stdy, ntoms, pvnc o toxn ns (sea-see, seg-ser, seu, tsst-1, eta, etb, nd etd), PFGE typs,ccssoy n to (agr) ops, nd ty to om ofm o 92 S. aureus Tnd cnc sots w nvsttd. Tywcssfdnto 10 d ops: ops 17 (56 sots)wmthcn sstnt (MRSA)nd 810 (36 sots)wmthcnsnstv (MSSA). On sot dd not hv ny toxn n, 4 sots cd on toxn n (seq), nd 87 sots hd two o motoxn ns. No sot hd see, etb, o tsst-1; sx sots hd eta o etd. Comnd seg-sei-sem-sen-seo o th hhy pvnt egcocs ws 26.1%. T seb, sec, sel, seu, nd eta ssoctd snfcnty wth MSSA; sek ws mo n MRSA. T sek-seq ssoctonws 52.17% wh comndsed-sej wsnot ond. wnty-th PFGE typs w vd,no ssoctono toxnnswth PFGEtyps. A o agrops w psnt; agrop 1 ws pdomnnt (58.70%) t agr op 2 stns cd mo toxn nsnd w mo qnt toxn podcs. Bofm omton ws ond n 72.83% o th sots t th ws no ssocton wthntoms. Ts stdy povds nsht nomton on moc nd phnotypc mks o Tnd S. aureus cnc sotswhch shod s o t ctv svnc tht md to conto spd o xstn ntmco sstnt ct ndy conton o nwy md vnt.

1. Introduction

Staphylococcus aureus, m postv cocc ctm, sth commns tht coonzs hthy ns mcos [1] opthon o hmns. As pthon, th ct cs v-ty o commnty nd hospt cqd dsss ncdnskn scss [2], ood posonn [3], pnmonts [4], spss[5], nd toxc shock syndom [6]. Ts ctm podcssv vnt ctos ncdn dhsns (coonzton

ctos), toxc potns/nzyms (.., DNs o ctspd, cos, nd cts o host mmnty vson)nd xotoxns ncdn xotv toxns (Exs), stphyo-cocc ntotoxns (SEs), nd toxc shock syndom toxn-1(SS-1). Ptnts nctd wth th Ex podcn S. aureusmy dvop scdd-skn syndom [7]. T SEs nd SS-1,sds csn ood posonn, so spntns (SA)tht cn stmt tvy cton o pphood cs to s mssv monts o ponmmtoy
http://dx.doi.org/10.1155/2013/314654http://dx.doi.org/10.1155/2013/314654

7/27/2019 BMRI2013-314654

2/11

2 BoMd Rsch Intnton

cytokns nd -c stmtn ctos dn to toxcshock syndom whch my t [8, 9]. T ntotoxctynd spntncty dstnct popts o th toxnmoc [6]. SEs cssfd nto two typs sd on thmtc ctvty n th toxn d modd pmt. oxns thtndc vomtn n th pmt pcd n th cssc

SE typ wh thos tht ck th mtc ctvty o hvnot n tstd octd n th SE-k (SEls) typ[10, 11]. Mms o th cssc SEs SEA-SEE nd thmo cnty conzd SEG, SEH, SEI, SER, SES, ndSE. T SEls mms ncd SElJ, SElK, SElL, SElM,SElN, SElO, SElP, SElQ, SElU, SElU2 o SEW, nd SElV[11]. T stphyococc ntotoxn F (SEF) whch cksmtc ctvty t s ssoctd wth toxc shock syndom spsnty cd toxc shock syndom toxn-1 (SS-1) [12].T SEs nd th SS-1 s w s th ct sstncto ds ncodd y ns on th mo ntc -mnts ncdn pophs, psmds, pthoncty snds,nomc snds, nd ntotc sstnc csstt [13]; thsthy tnsmttd hozonty th sy. Expsson oS. aureusvnc ctos nd mtosm o mtoc pth-wys dn owth coodntd/td y qom-snsn opon nmd ccssoy n to (agr) [14, 15].Bsd on th mno cd sqnc poymophsms o thagr-ncodn tondcn pptds nd th spondncptos, S. aureus stns cn dvdd nto o mjo agrops (ops 14) [16].

Dn th st fv dcds, S. aureus cons thtsst mthcn (mthcn-sstnt S. aureus, MRSA) ds-smntd nd csd mdc nd pc hth pomwodwd [17, 18]. Ts stns not ony sstnt tomthcn, t so sstnt to oth -ctms, sch scphospon [18, 19]. In Tnd, MRSA nctons wpotd om 23 hospts om 1988 to 1998 [20, 21]. Tpopotons o MRSA to MSSA n th nothst, cnt, ndsothn ons o th conty dn th stdd podncsd om 11 to 23.4%, 16 to 30.5%, nd 21 to 30.3%,spctvy [22]. Moov, mthcn-sstnt S. aureuswth dcd sscptty to vncomycn ws conzd[23]. Howv, dt on notypc chctstcs nd othttts o th S. aureus sots n Tnd tvy. To, ths stdy nvsttd th pvnc o

vnc toxn ns codn o ntotoxns (sea-see, seg-ser,nd seu), toxc shock syndomtoxn-1 (tsst-1), nd xotvtoxns (eta, etb, nd etd) mon S. aureus Tnd cncsots. Moc dvsty o th sots dn th

ndoncs-stctd pttns o nomc DNA (PFGE),agr typs, nd ntmco sscptty s w s thty to podc ofm w so nvsttd.

2. Materials and Methods

2.1. Bacterial Strains. Nnty-two stns oS. aureus sotdom cnc spcmns w otnd om th hospts.Ty w 43 stns (S1S43) sotd n 2007 om ptntso Pnc o Sonk Unvsty chn Hospt nd kptt th Dptmnt o Mcoooy, Fcty o Scnc, Pnco SonkUnvsty, Sonkh povnc,sothn Tnd;36 stns (P1P36) om th ptnts o Pst Nooc

Insttt, Bnkok, n 2010, nd 13 stns (113) sotdn 2010 om ptnts o th Hospt o opc Dsss,Fcty o opc Mdcn, Mhdo Unvsty, Bnkok,Tnd. T ct w confmd y Gm stnn,ochmc tstn (cts, cos, nd DNs), ndmnnto mntton. T ty to podc potn A ws

dtctd y tnton ssy.

2.2. Antimicrobial Susceptibility esting. Dsc dsonmthod ws sd o ntmco sscptty tstn oth S. aureus sots whch ws don ccodn to CLSIdns [24]. Antotc dscs w coxtn, cpooxcn,cndmycn, ythomycn, ntmycn, oxcn, pncnG, mpn, ttcycn, smthoxzo ps tmtho-pm, nd tcopnn (Oxod, UK). Coxtn dsc (30 )nd oxcn dsc (1 ) w sd o dtctn mthcn-sstnt sots. S. aureus ACC 25923 ws sd s conto.Rdcton o vncomycn sscptty o th sots wsso dtmnd y osvn th mnmm nhtoy

concntton (MIC) y dton ccodn to th CLSIdns [24].

2.3. Detectiono Genes Coding or Staphylococcal Enterotoxins,SS-1, and Exs. Gnomc DNA ws xtctd om chS. aureus sot y DNA xtcton kt (Gnd, wn)oown th potoco o Gm-postv ct. Qtyo ch DNA ppton ws ssssd y dtmnn thtoo OD260nm/OD280nm. wnty-twovnc nswmpfd ncdn sea-see, seg-ser nd seu, tsst-1 nd eta,etb nd etd, sn spcfc ooncotd pm sqncsstd n 1 [25, 26]. T PCR cton mxt (25 L)s composd o 1 mM o ch pm, 1x aq PCR,

0.2 mM dNP, 2 mM MC2, 1 nt oaq DNA poyms(Fmnts, Gmny), nd 100 n o DNA tmpt. TPCR cton mxt ws sjctd to th thm cycs:n nt dntton o DNA t 95C o 10 mn po to 35cycs o dntton t 95C o 30 sc, 55C o 30 sc, nd72C o 30sc, oowd y fnxtnsono 10mn t 72Csn th Lcyc (BoRd, USA). T mpfd podctsw nyzd y 1.5% os ctophoss nd thd-m omd stnn. T DNA nds w osvd ndn UV tnsmnto (Synn, Ennd). Conto cto th PCR ncdd stns ACC 19095 (sea, sec, seh, seg,sei, sel, sem, sen, seo, seu, nd tst), ACC 14458 (seb nd sek),ACC 23235 (sed, sej), nd ACC 27664 (see, seq, nd sea).

Fo eta, etb, nd etd, th PCR mpcons w vfd y DNAsqncn nd th ncotd sqncs w nd wthth stphyococc eta, etb, nd etdsqncs o th dts(ccsson nms: L25372.1, M17348.1, nd AB057421.1,sp.).

2.4. Detection o SEs, SS-1, and Exs. T ct sotswhch cd sea, seb, sec nd sed; eta nd etb; tsst-1 wtstd o th ty to xpss th spctv potnsy thvsd-pssv tx tnton (RPLA) sn comm-cy v kts: SE-RPLA, S-RPLA, nd EX-RPLA(Dnk Skn, Jpn), spctvy. Oth toxn dtctonsw not don d to ck o v tst kts.

7/27/2019 BMRI2013-314654

3/11

BoMd Rsch Intnton 3

able 1: T pm sqncs o mpfcton o th S. aureus ntotoxn ns.

t n Pm sqnc 5 3 Sz o PCR podct

(p)Rnc

sea(F)(R)

GAAAAAAGCGAAGCAGGGAACACAAAAAACGAAAACCGAAGGC

560 [26]

seb(F)(R)

ACAAAGGACACAAGAGGGAACCCGCAAAGGCGAG 404 [26]

sec(F)(R)

CGAGAGGAGGAAAACAAAACAGCAACAACCAAAAAGAGCCG

275 [26]

sed(F)(R)

GAAAAGAGACCGCGCAAAAAAGGCGACCCCGAGAG

492 [26]

see(F)(R)

CAAAGAAAGCAAGCAACAGGCCACCACCGCCAAAGCG

482 [26]

seg(F)(R)

ACCGAAAAGCCAAGGACGCCAACGAACCAC

204 [26]

seh(F)(R)

CAACACACAAGCGAAAGCAGCACACCCAAACAAGCACC

376 [26]

sei(F)(R)

CYGAACAACMGGACAGGCAGCCACCCG-3

461 [26]

sej(F)(R)

CAGAACGGCCGCAGGAAACCAYCAAAGGAC

138 [26]

sek(F)

(R1)(R2)

AGCCAGCGCCAAGGCAGACAGAAAAGAGGAAGC

GCCAGCGCCAAGGG134 [26]

sel(F)(R)

GCGAGAGGCCAGGAAACCAAAAGACGAGAGAGAACCAA

234 [26]

sem(F)(R)

CAAACGGGAAGGAGAACCAGCGACAGGGCA

326 [26]

sen(F)(R)

CGGGCAAAGACGAGCGAGAYGAGAAKAG

474 [26]

seo(F)(R)

AGGGAAGAAGCAAGGAGAACAAACAGCAGAACCACAAC

180 [26]

sep (F)(R)

GAAGCAGGGAACGCGGCGGGCGAAC

182 [26]

seq(F)(R)

ACCGAAAAGCCAAGGACGCCAACGAACCAC

204 [26]

ser(F)(R)

AGCGGAAAGCAGAAAAGCGACCGAACCG

363 [26]

seu(F)(R)

AAGGCCAAAAGAGGAGACCACAGCC

215 [26]

tst(F)(R)

CACAGAAAAGGCAGACCCACACAAGAAACGAAGCCC

180 [26]

eta(F)(R)

ACGAGGAGCAGGCAGGGAACGCACCACAAC

190 [26]

etb(F)

(R)

CAGAAAAGAGCAACACACAAC

AGGAACACCAGAAAAACACC612 [25]

etd(F)(R)

CAAACACAGACAAGGAGGCCAGAACCCGACCAG

358 [26]

2.5. Pulsed-Field Gel Electrophoresis (PFGE). PFGE pttnso chomosom DNA o S. aureus sots w dt-mnd y dstn ch DNA ppton wth SmaI. Tdstd DNA pptons w sjctd to ctophotcspton n CHEF-DR II systm (BoRd, USA) sdscd pvosy [27]. DNA mnt pttns wnyzd n th GnDctoy Appcton Vson 2.01.00Copyht 20002008 Synoptcs Ltd. Pcnt smts

w dntfd on dndom dvd om th nwhtdp op mthod wth thmtc vs (UPGMA) ndsd on Dc cocnts. Bnd poston tonc ws stt 1.0%. A cocnt smty o 70% ws sctd to dfncst o th PFGE typs.

2.6. Te Agr Alleles. GnomcDNA oth 92S. aureus sotsws sd s tmpts o mpfcton o agr s sn

7/27/2019 BMRI2013-314654

4/11

4 BoMd Rsch Intnton

th op spcfc pms [16]. T common owd (pn)pm: (5-AGCACAGGGCACAGC-3) ndvsdpms ncdn: 1 (5-GCACAAGACAAAGC-GCGA-3), 2 (5-AACAAGAAAAGGCC-AAGC-3), 3 (5-GAAGAAAGCGAAA-AAACCCAG-3), nd 4 (5-CGAAAGCCGAA-

ACCCG-3

) w sd. Ts pms owd mpfctono 439-, 572-, 320-, nd 657-p DNA mnts o th agrops 14, spctvy.

2.7. Bioflm Formation. Aty o th S. aureus sots toom ofm ws dtmnd ccodn to th potocodscd pvosy [28] wth modfcton. Indvd c-t sots w ctd n SB (Oxod) sppmntdwth 0.25% cos t 35C nt th tdty chdMcFnd no. 0.5. Appoxmty 100 c o ch ctw ppd n tpct nto ws o 96-w t-ottomdmcopt contnn 200 L o th SB nd 0.25% -cos. Ws ddd wth ctd S. epidermidis (ACC12228)svd s ntv contos. T pt ws nctd o 24 h.T contnt o ch w ws thn dscdd nd th wsw wshd fv tms wth st 0.9% NC soton. Echw sc ws stnd y ddn 100 L o 0.3% (w/v)cyst vot (Mck) n wt nd kpt o 5 mn. Afv wshn wth st dstd wt nd dd. Tofm fxd on ch w sc ws xtctd wth 100 Lo 70% thno nd msd th sonc t OD

570nm.T sots wth OD

570nm vs ov th mn OD570nmvs ps th stndd dvtons o th ntv conto(mnneg + 3S DN) w consdd postv o ofmomton.

2.8. Statistical Analyses. SPSS Sttstcs 16.0 ws sd o

sttstc nyss. Ch-sqd (2) tst nd -tst w sdto nyz th dt sotd y MRSA nd MSSA opsnd qncs o vnc ns nd ofm omton,spctvy. A poty v () < 0.05 ws consdddnt snfcnty.

3. Results

3.1. Antimicrobial Susceptibility. A o th 92 ct so-ts om ct stocks w vfd s S. aureus stnsccodn to th phnotypc chctstcs dtmnd yth convnton mcoooc mthod. A tstn wthth 30 coxtn dsc, 56/92 sots (60.87%) w MRSA

(37 sots om th Pnc o Sonk hospt nd 19sots om Pst Nooc Insttt), nd 36 sots(39.13%) w MSSA (5 sots om th Pnc o Sonkhospt, 17 sots om th Pst Nooc Insttt,nd 19 sots om th Hospt o opc Dsss).T 92 S. aureus Tnd sots w ty cssfdnto 10 d ops. Gops 17 w MRSA nd ops810 w MSSA. Dt on sscpt nd ntmdtsnstvty to th 11 ntotcs tstd (coxtn, cpooxcn,cndmycn, ythomycn, ntmcn, oxcn, pn-cn, mpn, tmthopm/smthoxzo (/S), tt-cycn, nd tcopnn) w op 1 (16 sots): sscp-t (9 sots) nd ntmdt (7 sots) to mpn

nd sscpt to tcopnn; op 2 (2 sots): ss-cpt to ntmcn nd tcopnn, ntmdt tompn; op 3 (7 sots): sscpt to ntmcn ndtcopnn; op 4 (1 sot): sscpt to ttcycnnd tcopnn; op 5 (7 sots): sscpt to mpn,tmthopm/smtoxzo, ttcycn, nd tcopnn

nd sscpt to ntmcn (1 sot); op 6 (10 sots):sscpt to mpn, tmthopm/smtoxzo (10sots), ntmdt to tmthopm/smtoxzo (1sot), nd sscpt to tcopnn; op 7 (13 sots):sscpt to tcopnn; op 8 (3 sots): sscptto oxcn (2 sots), coxtn, ntmcn, ntmcn,nd tcopnn; op 9 (28 sots): sstnt to pncnnd ttcycn (13 sots), ntmdt to ythomycn(1 sts); op 10 (5 sots): sstnt to ntmcn (1sot), cpooxcn (2 sots), ythomycn (2 sots),nd cndmycn (2 sots). A o th sots w snstvto vncomycn ccodn to th MIC tstn. T mthcnsscptty nd d ops o th 92 sots shown n 2.

3.2. Prevalence o oxin Genes in Individual S. aureus Isolates.Amon th 92 sots, 1 sot (1.08%) ddnot hv ny toxnn (S38), 4 (4.35%) sots (S16, S33, S40, nd P33) cdon toxn n (seq), nd th mnn 87 sots (94.57%)cd two o mo toxn ns ( 2). T w ony6/92 sotstht cy thetxns th eta o etd(P28,P31,3, 8, 9, nd 13). T pvnco toxn ns mon thsots s shown n F 1. T pdomnnt ntotoxnn ws seq whch ws psntd n 91/92 sots (98.91%),oowd y sea (65.22%) nd sek (54.35%). T ws nosot wth see, tsst-1 (se), o etb. T pvnc o sea,

sec, sed, seg, seh, sei, sej, sem, sen, seo, sep, seq, ser, eta, ndetdmon th MRSA nd MSSA sots w not dnt.Howv, th pvnc oseb, sel, nd seu mon sots oth two mthcn ops ws dnt snfcnty.

3.3. Determination o oxin Production. T ct sotswhch cd sea, seb, sec, sed; eta nd etb; tsst-1 w dt-mnd o th ty to podc th spctv toxns ysn SE-RPLA, S-RPLA, nd EX-RPLA, spctvy,nd 35 sots w toxn podcs ( 2). T w21/60 sea stns (35%) tht podcd SEA; 9/13 seb sots(69.23%) podcd SEB; 4/7 sec sots (57.14%) podcdSEC; nd 3/5 sed sots (60%) podcd SED. On o th

th eta postv stns (33.33%) cod podc EA. Nono th o sots wth etd-postv stns podcd ED.Amon th MRSA, 24/56 sots (42.86%) podcd toxns(17 SEA nd 7 SEB), whs 11/36 (30.55%) o th MSSAsots podcd toxns (SEA 4 sots, SEB 1 sot, SEC3 sots, SED 2 sots, nd SEB nd EA 1 sot). Tw 3 MSSA sots tht podcd mo thn on toxn: S41podcd SEB nd SED, P23 podcd SEA nd SEC, nd 3podcd SEB nd EA.

3.4. PFGE ypes. T 92 S. aureus sots cod cssfdccodn to th PFGE sts nto 23 notyps, notyps123 (F 2). Inomton on th PFGE typs o ndvd

7/27/2019 BMRI2013-314654

5/11

BoMd Rsch Intnton 5

able 2: Chctstcs o th 92 S. aureus Tnd sots.

Isot no. Mthcnsscptty

D op Entotoxn n(s) Ex n RPLA toxn PFGE typ A op Bofm (OD)

S1 R 1 sek, seq ND 1 1 + (0.831)

S2 R 1 sea, sek, seo, seq ND 1 1 + (0.828)

S3 R 1 sek, seq ND 1 1 + (0.039)S4 R 1 sek, seq ND 1 1 + (0.181)

S5 R 1 sea, sek, seq 1 1 + (0.701)

S6 R 1 sek, seq ND 2 1 + (1.566)

S7 R 1 sea, sed, sek, seq 1 2 + (1.841)

S8 R 1 sea, sek, seq SEA 6 1 + (1.701)

S9 R 1 sea, sek, seq SEA 21 1 + (0.996)

S10 R 1 sea, sek, seq SEA 21 1 + (1.219)

S11 R 1 sea, sek, seo, seq SEA 21 1 + (1.749)

S12 R 1 sea, sek, seq SEA 21 1 + (1.377)

S13 R 1 sea, sek, seq SEA 21 1 + (1.687)

S14 R 1 sea, sek, seq SEA 21 1 + (0.796)S15 R 2 sea, sek, seq 1 1 + (0.097)

S16 R 2 seq ND 3 1 + (0.132)

S17 R 3 sea, sek, seq 1 1 + (0.085)

S18 R 3 sea, sek, seq 4 1 + (0.230)

S19 R 3 sea, sek, seq 4 1 + (0.080)

S20 R 3 sek, seq ND 6 1 + (0.417)

S21 R 3 sek, seq ND 6 1 + (1.103)

S22 R 3 sek, seq ND 6 1 + (1.835)

S23 R 3 sek, seq ND 21 1 + (0.097)

S24 R 4 sea, sek, seq 2 1 + (0.552)

S25 R 7 sea, sek, seq 1 1 + (0.569)

S26 R 7 sek, seq ND 1 1 + (1.000)

S27 R 7 sek, seq ND 1 1 + (1.155)

S28 R 7 sea, sek, seq 1 1 + (0.715)

S29 R 7 sek, seq ND 2 1 + (1.061)

S30 R 7 sek, seq ND 2 1 + (1.131)

S31 R 7 sek, seq ND 2 1 + (0.774)

S32 R 7 sea, sec, sek, sel, seq 9 1 + (1.796)

S33 R 7 seq ND 21 1 + (2.481)

S34 R 7 sea, sec, sel, seq 21 1 + (1.000)

S35 R 7 sea, sek, seq 21 1 + (1.792)

S36 R 7 sek, seq ND 21 1 + (1.184)

S37 R 7 sek, seq ND 21 1 + (2.332)

S38 S 8 ND 4 1 (0.052)

S39 S 8 sej, sek, seq ND 4 2 + (0.367)

S40 S 8 seq ND 21 1 + (0.508)

S41 S 9 seb, sed, sej, sek, seq, ser, etd SEB, SED 21 3 + (0.074)

S42 S 9 seg, sei, sem, sen, seo, seq, seu 19 3 (0.007)

S43 S 9 seg, sei, sek, sem, sen, seo, seq 7 2 (0.008)

P1 R 1 sea, seq SEA 21 1 + (0.317)

P2 R 1 sea, seg, sei, sek, sen, seo, seq SEA 9 2 + (0.700)

7/27/2019 BMRI2013-314654

6/11

6 BoMd Rsch Intnton

able 2: Contnd.

Isot no. Mthcnsscptty

D op Entotoxn n(s) Ex n RPLA toxn PFGE typ A op Bofm (OD)

P3 R 5 sea, seg, sei, sem, sen, seo, seq SEA 9 2 + (0.098)

P4 R 5 sea, seg, sei, sem, sen, seo, seq SEA 9 2 (0.194)

P5 R 5 sea, sei, sek, sen, seo, seq SEA 9 2 + (0.543)P6 R 5 sea, seg, sei, sem, sen, seo, seq SEA 9 2 (0.144)

P7 R 5sea, seg, sei, sek, sem, sen, seo,

seq SEA 9 2 (0.095)

P8 R 5 sea, seg, sei, sem, sen, seo, seq SEA 13 2 + (0.451)

P9 R 5sea, sed, seg, sei, sej, sem, sen,

seo, sep, seq, ser SED 16 2 (0.05)

P10 R 6 sea, sek, seq SEA 21 1 + (0.817)

P11 R 6sea, seb, seg, sei, sem, sen, seo,

seq SEB 22 2 + (0.141)

P12 R 6 seb, seg, sei, sem, sen, seo, seq SEB 22 2 + (0.179)

P13 R 6 seb, seg, sei, sem, sen, seq SEB 22 2 (0.176)


seq 22 2 + (0.182)


seq SEB 22 2 (0.084)


seq SEB 22 2 (0.249)

P17 R 6 seb, seg, sei, sem, sen, seo, seq SEB 22 2 (0.051)

P18 R 6 seb, seg, sei, sem, sen, seo, seq SEB 22 2 (0.137)


seq 22 2 (0.117)

P20 S 9 sea, sek, sel, seq 1 1 + (1.311)

P21S

9sea, sec, sel, seq

2

1 (0.173)

P22 S 9 sea, seo, seq 8 1 + (0.300)

P23 S 9 sea, sec, sel, seq SEA, SEC 9 1 (0.204)

P24 S 9 sea, seq 9 1 + (2.210)

P25 S 9 sea, sek, seq 10 4 + (0.484)

P26 S 9 sea, sek, seo, seq 17 1 + (1.156)

P27 S 9 sea, seh, sek, seq SEA 17 3 (0.058)

P28 S 9 sea, sed, sei, seq etd SED 18 1 (0.225)

P29 S 9 sea, seq 18 2 + (0.098)

P30 S 9sea, sec, seg, sei, sel, sem, sen,

seo, seq SEC 18 2 (0.390)

P31 S 9 sea, seb, seg, sei, sem, sen, seo,seq, seu

eta 18 2 (0.147)

P32 S 9 sea, sec, seg, sei, sel, sen, seo, seq SEC 20 3 + (0.128)

P33 S 9 seq ND 20 3 (0.245)

P34 S 9 seo, seq ND 22 1 (0.326)

P35 S 9 sea, seo, seq 23 1 + (0.054)

P36 S 9 sed, sek, seq ND 23 1 + (1.107)

1 S 9 sea, sen, seq 5 2 (0.073)

2 S 9 sea, seg, sem, sen, seo, seq SEA 5 2 + (0.046)

3 S 9seb, seg, sei, sem, sen, seo, seq,

seueta SEB, EA 8 4 + (3.872)

7/27/2019 BMRI2013-314654

7/11

BoMd Rsch Intnton 7

able 2: Contnd.

Isot no.Mthcn

sscpttyD op Entotoxn n(s) Ex n RPLA toxn PFGE typ A op Bofm (OD)

4 S 9 sea, seg, sen, seq 9 2 + (0.319)

5 S 9sea, seg, sei, sek, sem, sen, seo,

seq, seu 9 4 (0.081)

6 S 9 seg, sen, seq ND 11 1 + (0.736)

7 S 9 sea, seg, sei, sek, sen, seo 15 2 + (2.818)

8 S 9 sea, seg, sei, sem, sen, seo, seq eta 18 1 + (0.156)

9 S 10 seq etd ND 12 1 (0.114)

10 S 10 sea, seg, sei, sem, sen, seo, seq SEA 14 2 + (0.086)

11 S 10 sea, seg, sei, sem, sen, seo, seq 15 2 + (0.808)

12 S 10 sec, seh, sel, seq SEC 15 3 (0.198)

13 S 10 sea, sek, seq etd SEA 18 1 + (0.235)

: not dtct, +: podcd ofm.ND: not don.

58

12

7

5

0

302

29

3

49

8

1

2

4

0

3

0

4

0 10 20 30 40 50 60 70 80 90 100

sea

seb

sec

sed

see

seg

seh

sei

sej

sek

sel

se

sen

seo

sep

seq

ser

seu

tsst

eta

etb

etd

Number of isolates

Viru

lencegenes

(0 MRSA, 3 MSSA; P = 0.057)

(0 MRSA, 4 MSSA; P = 0.021)

(1 MRSA, 1 MSSA; P = 0.632)

(1 MRSA, 0 MSSA; P = 0.609)

34 (18 MRSA, 15 MSSA; P = 0.239)

90 (56 MRSA, 34 MSSA; P = 0.151)

32(17 MRSA, 15 MSSA; P = 0.187)

25 (17 MRSA, 15 MSSA; P = 0.187)(2 MRSA, 6 MSSA; P = 0.038)

(39 MRSA, 10 MSSA; P < 0.001)(1 MRSA, 2 MSSA; P = 0.338)

(17 MRSA, 12 MSSA; P = 0.536)

(0 MRSA, 2 MSSA; P = 0.151)(17 MRSA, 13 MSSA; P = 0.363)

(2 MRSA, 3 MSSA; P = 0.298)

(2 MRSA, 5 MSSA; P = 0.080)

(9 MRSA, 13 MSSA; P = 0.026)

(35 MRSA, 23 MSSA; P = 0.536)

(0 MRSA, 4 MSSA; P = 0.021)

sem

Figure 1: Pvnc o th ntotoxn nd xotv toxn ns mon th 92 S. aureus Tnd sots. v twn pvnc oMRSA compd to MSSA.

sots s vn n 2. PFGE typ 21 ws pdomnnt (16sots), oowd y typs 1, 9, nd 22 (13, 11, nd 10 sots,sp.); typs 2 nd 18 hd 6 sots ch; typs 4 nd 6 hd 4sots ch; 3 sots ond to typ 15; typs 5, 8, 17, 20,nd 23 hd 2 sots ch, nd typs 3, 7, 10, 11, 12, 13, 14, 16,nd 19 hd 1 sot ch.

3.5. Te Agr Groups. T pdomnnt agrop mon th92 sots ws op 1 (54/92 sots; 58.70%) oowd yops 2 (29 sots; 31.52%), 3 (6 sots; 6.52%), nd 4 (3sots; 3.26%).

3.6. Bioflm Formation. T w 67/92 sots (72.83%)tht podcd ofm; 21/36 (58.33%) w MSSA nd 46/56sots (82.14%) w MRSA. T pvnc o th ofmomton o th MRSA nd MSSA ws not dnt ( >0.05).

4. Discussion

Dsss csd y S. aureus hth hzd to hmnwodwd. Snc th fst conton o mthcn-sstntS. aureus n 1961 [29], th hs n n ps o nctons

7/27/2019 BMRI2013-314654

8/11

8 BoMd Rsch Intnton

10092857770625547403225

Similarity (%)

1

2

16

15

9

8

7

6

5

4

3

14

13

12

11

10

20

19

18

17

22

21

23

Banding pattern

Figure 2: Dndom o PFGE pttns th 92 S. aureus Tnd sots.

csd y th S. aureus vnts tht sst not ony mth-cn, t so oth -ctms nd vncomycn, whch thptc ds o choc [3032], dn to ttmnt nd ncsd cs tty t. T mthcn nd

vncomycn sstnc o th S. aureus ncodd ystphyococc csstt chomosom mec (SCCmec) ndvanA, spctvy[30, 31]. Assocton o th psnc oS.aureus toxn ns wth mthcn snstvty nd sstnc

7/27/2019 BMRI2013-314654

9/11

BoMd Rsch Intnton 9

mon S. aureus hs n potd pvosy [28, 3335].T ssocton ws ond so n th psnt stdy; thpvnc o th seb, sec, sel, seu, nd eta ws ssoctdsnfcnty ( < 0.05) wth th MSSA wh sek ws ondmo n MRSA.

T toxn ns cd y th 92 Tnd sots vd

om non to s mny s 11 ns ( 2). Fv o thS. aureus ntotoxn ns, tht s, seg, sei, sem, sen, ndseo, ond to th hhy pvnt egc ocs [36, 37]; ths,th coxstncws qntypotd. Coxstnc oseg-sei n th sm stn, th on o n mo comntonwth oth toxn n(s) (sea, sec, sed, seh, sej, nd/o tst) ws

ond n55%o th 429 S. aureus sots om Gmny [38].

In Jpn, th seg-sei on o wth seb, sec, o sed w 24,2.7, 6.8, nd 2.0%, spctvy [39]. T comnd seg-sei-

sem-sen-seo wth seu ws 15.1% mon th Chns sots

[26]. In th psnt stdy, th comnd seg-sei-sem-sen-seowth oth toxn ns ncdn sea, seb, sed, sej, sek, sel, sep,

seq, ser, nd/o eta ws ond n 24/92 sots (26.1%). Tw 3 sots tht cd seg-sei-sen-seo wth sea, sec, sek,sel, nd/o seq nd 1 sot wth seg-sei-sem-sen nd seb. Tpvosy potd fxd ssocton o sed-sej [38] ws notond mon th 92 Tnd sots. T comnd sek-seqwth oth toxn n(s), tht s, sea nd/o seb, ws 45.5%

mon th Chns sots [26]. In th psnt stdy, th sek-seq ssocton ws ond n 48 o th 92 sots (52.17%),th th two ns on (16.3%) o wth th oth toxnns (35.86%).

T ty o th sots to podc SEA, SEB, SEC,nd SED nd EA, EB, nd SS-1 ws xmnd y snSE-RPLA, S-RPLA, nd EX-RPLA tst kts, spc-

tvy. Not sots hon th ns xpssd thspctv toxns. T sts w sm to th fndnpotd pvosy mon S. aureus sots om mk nd

mk podcts om Moocco [40]. T nconomd ststwn notyps (y PCR) to phnotyps (y RPLA) cod d to th ct tht toxn podcton o th ct cn ctd y th owth condtons ncdn tmpt,pH, nd wt ctvty. T so-podcd toxn vs mht

ow thn th dtcton mts o th mmnossy [40,

41]. Atntvy, th toxn n my not xpssd dto mtton th n th codn on o n toyon, o xmp, agr [42, 43]. No nnottd dt v n th tt on ssocton o th ty o toxnpodcton nd ntoms o th S. aureus. Nvthss,n ths stdy, th qncy o toxn podcton s hhmon th MRSA (48.86%) thn th MSSA (30.55%) (

bmri2013-314654

Documents