bio212ac take home final carlautta griffith

8/8/2019 BIO212AC Take Home Final Carlautta Griffith

1/11


2/11

1) You need to quickly and accurately (and cheaply) show that this change in viability is

due to induction of apoptosis and not to any other mechanisms. Explain in detail how

you would do this?

Electrophoresis would quickly and accurately (and cheaply) show that apoptosis

was effecting the cell causing it to die. It would prove this because if the cells are

undergoing apoptosis, the DNA would be all chopped up and therefore, when you run it

on a gel there will be multiple bands. This is called a ladder pattern. A ladder pattern

mimics a ladder that you would use to measure different particle sizes on an

electrophoresis gel. When cells undergo apoptosis, the DNA is cut into pieces and when

you run it on a gel you see a ladder pattern. DNA fragmentation by apoptosis occurs

when enzymes in the cell are released and the enzymes cut the DNA into pieces, much

like a digest. So essentially it is digested DNA that leaves that leaves the ladder pattern

in the gel. In cells that are not undergoing apoptosis, the DNA extracted from them form

a single band on the gel. This is how you can tell the difference. Though you should

probably check your sample multiple times because sometimes you can get genomic or

RNA blurs that might obscure multiple bands. Also, if only a small percentage of your

cells undergo apoptosis then it will be much harder to see multiple bands. Though the

threshold for visable bands is greater than 40%. So typically if you observe a band in a

particular sample you run on a gel more than 40% of that sample has undergone

apoptosis. Though sometimes if the amount is less and you have a better system for

detecting dye patterns it could be less than 40%.

citing:

"QUALITATIVE ANALYSIS OF."Home Page Del Sito Di Immunologia. Web.

08 Nov. 2010. .

"Apoptosis/DNA Laddering Assay Protocols."Protocol Online - Your Lab's

Reference Book. Web. 08 Nov. 2010. .
http://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.fullhttp://www.pnas.org/content/97/16/9215.full


3/11

2) You accidently used media containing no serum in one of the experimental replicates

and you find that even your negative controls have undergone apoptosis; however your

treated cells initiated apoptosis twice as fast in this media than in the normal media!

(Think about what is in normal media) How could you explain this and how would

you test your hypothesis?

A western blot would tell you that this change in viability is due to apoptosis

because the drug attacks mitochondria which release cytosome 3 which causes a chain

reaction in caspace 3 which is a protein in the mitochondria membrane, which makes it

fall apart thereby making the cell rupture and undergo apoptosis.

Apoptosis needs RNA and energy to make proteins to start the process. It sends

out RNA which are transcribed into pro-apoptosis proteins, one of which is cytosome

3. Western blots detect certain proteins. I would perform a western blot on each of the

samples to detect how much cytosome 3 is in each sample and their concentrations. If the

concentrations are higher in the treated cells then I know that the drug ziacid is making

the cells produce the RNA that translates into cytosome 3 which causes a chain reaction

in caspace 3 which makes the cell undergo apoptosis.

Fetal bovine serum is a stabilizer for cells. It is low in antibodies so many

different types of cells can grow in it. It also has nutrients and proteins that growing cells

need. Without FBS (fetal bovine serum) many cell lines will die because there isnt

enough nutrition in the media. The reason for both the treated cells and the untreated cells

dying is because there is not enough nutrients in the media to prevent the cells from

undergoing apoptosis. Also, FBS greatly reduces the risk of over-toxicity if there is a

toxic or semi-toxic element added to the media. It basically waters down the toxicity to a

sustainable level.

Citing:

"Fetal Bovine Serum." Wikipedia, the Free Encyclopedia. Web. 08 Nov. 2010.

.


4/11

3) You must present some data which indicates a potential apoptosis initiation

mechanism. Given your cell line genotype and your experimental drug, what would you

hypothesize? How could you test this?

There are two important mutations that are in this cell line; Inactivated P53 is one of them

and uncleavable BID is the other. Inactivated P53 initiates apoptosis when strange

divisions in the cell are taking place, ie; daughter cells not splitting, uneven

chromosomes, duplicated chromosomes. Uncleavable BID initiates apoptosis by caspase

cascade. Caspase cascade is the pathway stated in problem 2. Basically an RNA message

is sent out which translates into cytosome 3 protein which then causes the protein caspace

3 to unravel in the mitochondria's membrane making it rupture. Without it's

mitochondria's, the cell cannot produce ATP and thereby dies and undergoes apoptosis.

Because this drug initiates apoptosis, we can use a western blot to determine which

pathway is used to make the cell undergo apoptosis. If it isnt caspace cascade, then we

can test for other protein triggers by using a western blot technique. As you go through

the list of possible pathways and figure out which ones are not the trigger, you narrow

down the search to find out which is the true pathway. There are many pathways to lead a

cell into apoptosis, some of the pathways include: Extrinsic pathway, intrinsic pathway,

and caspace cascade. Although extrinsic pathway would probably be the least likely

culprit because it triggers apoptosis independently of the p53 region which is a tumor

suppressor region. When a mutation occurs in this region the cell is more likely to

undergo apoptosis. Another test would be to see if there is a mutation in the p53 region of

the cell and then derive all the pathways that come off of that.

Citing:

"Apoptosis Pathways." Genentech BioOncology Cancer Therapy Research. Web.

08 Nov. 2010. .

Bioinformatics

Background-


5/11

You are the bioinformastition for a R&D lab which works on isolating novel

proteins from environmental metagenomic samples. You have been given the following

DNA sequence fragment to analyze. Answer all associated questions to the best of your

ability. Think about your answers, do they make logical sense?

> Unknown environmental sequence

tttgaatggctgattggcagcccgcgctggcgcgaaagcgcggcggaacgcggcgatgtg

aacccggtgggcggcctggaagaagtgctgtatgaactgagcccgattgaagattttagc

ggcagcatgagcctgagctttagcgatccgcgctttgatgatgtgaaagcgccggtggat

gaatgcaaagataaagatatgacctatgcggcgccgctgtttgtgagcgcggaatttatt

aacaacaacaccggcgaaattaaaagccagaccgtgtttatgggcgattttccgatgatg

accgaaaatggcacctttattattaacggcaccgaacgcgtggtggtgagccagctggtg

cgcagcccgggcgtgtattttgatgaaaccattgataaaagcaccgataaaaccctgcat

agcgtgaaagtgattccgagccgcggcgcgtggctggaatttgatgtggataaacgcgag

accgtgggcgtgcgcattgatcgcaaacgccgccagccggtgaccgtgctgctgaaagcg

ctgggctggaccagcgaacagattgtggaacgctttggctttagcgaaattatgcgcagc

accctggaaaaagataacaccgtgggcaccgatgaagcgctgctggatatttatcgcaaa

ctgcgcccgggcgaaccgccgaccaaagaaagcgcgcagaccctgctggaaaacctgttt

tttaaagaaaaacgctatgatctggcgcgcgtgggccgctataaagtgaacaaaaaactg

ggcctgcatgtgggcgaaccgattaccagcagcaccctgaccgaagaagatgtggtggcg

accattgaatatctggtgcgcctgcatgaaggccagaccaccatgaccgtgccgggcggc

gtggaagtgccggtggaaaccgatgatattgatcattttggcaaccgccgcctgcgcacc

gtgggcgaactgattcagaaccagattcgcgtgggcatgagccgcatggaacgcgtggtg

cgcgaacgcatgaccacccaggatgtggaagcgattaccccgcagaccctgattaacatt

cgcccggtggtggcggcgattaaagaattttttggcaccagccagctgagccagtatatg

tatcagaacaacccgctgagcggcctgacccataaacgccgcctgagcgcgctgggcccg

ggcggcctgagccgcgaacgcgcgggcctggaagtgcgcgatgtgcatccgagccattat

ggccgcatgtgcccgattgaaaccccggaaggcccgagcattggcctgattggcagcctg

agcgtgtatgcgcgcgtgaacccgtttggctttattgaaaccccgtatcgcaaagtggtg

gatggcgtggtgagcgatgaaattgtgtatctgaccgcggatgaagaagatcgccatgtg

gtggcgcaggcgaacagcccgattgatgcgggtggccgctttgtggaaccgcgcgtgctg

4) Your boss wants to know the protein that is associated with the DNA fragment. Paste

the protein sequence. Is this a complete protein? Is there any secondary structure

associated with this protein, if so include a graphical representation of this.


6/11

RNA polymerase III is the protein associated with this DNA fragment. This is not a

complete protein. Graphical representation has been attached. RNA polymerase III is a

protein that transcribes DNA into ribosomal RNA so the ribosomes can translate it into a

protein. It is a very essential gene for a cell to function. If a cell has unviable RNA

polymerase III then it cannot create proteins to survive. I found out the protein by pasting

the sequence into a converter that turns it into protein code, then searched the protein

code and entered it into a site that found matches. The closest match was RNA

polymerase III. I know this is not a complete protein code because I looked up the whole

code for the protein and it is MUCH more code than what was given here. There is

secondary structure with this protein, as there is all proteins. I found a site that gives a

graphical representation, though it is not in a photograph but in a colour code that tells

you where all the twists and bends are.

Citing:

"RNA Polymerase III." Wikipedia, the Free Encyclopedia. Web. 08 Nov. 2010.

.
http://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_IIIhttp://en.wikipedia.org/wiki/RNA_polymerase_III


7/11


8/11


9/11

5) What type of protein could this be, i.e. whats its putative function? Does it have any

conserved domains, if so what are they and what do we know about them? What could be

the proteins function? Is there a version of this protein which has a determined 3D

structure?

RNA polymerase III is the most likely protein that this particular sequence codes for.

After doing a search and finding that there is a 99% likelihood of this being RNA

polymerase III. It's function is to transcribe DNA into ribosomal RNA which is then read

by ribosomes and translated into protein. Transcription factor BRF is a conserved domain


10/11

and it is a binding protein. A binding protein is a protein that binds to DNA. Some

binding proteins can bind to only single stranded DNA and some only to double stranded

DNA. They serve all kinds of functions like cleaving the DNA, repairing the DNA, and

acting as a port for other proteins to attach to. There should be a determined 3D structure

because if it cannot be different all the time and all proteins are 3D.

"Conserved Functional Domains of the RNA Polymerase III General

Transcription Factor BRF. Genes & Development." Genes & Development. Web. 08

Nov. 2010. .

"DNA-binding Protein." Wikipedia, the Free Encyclopedia. Web. 08 Nov. 2010.

.

6) What organisms could your protein have come from? Your boss wants a preliminary

report highlighting the potential evolutionary relationship of your unknown protein and at

least 15 similar proteins. What did you find out? (Hint: think trees) Did this protein

evolve independently from a single gene? Is your given protein relatively old or young,

how can you tell?

My proteins have come from various strains of mycobacterium. Mostly

Mycobacterium Tuberculosis. It evolved from one common ancestor, although there are

clearly there are three major branches. Though they all originated from mycobacterium

tuberculosis. When I looked at it in blast, there was an organism that had a difference of

50 base pairs. In a conserve domain between organisms, one nucleotide difference, we

can assume 10k years of evolutionary separation. So basically it's an old organism by this

fact.

It evolved from a single gene, not independently because there was only one

ancestor, not two. If it evolved independently it would have more than one ancestor.

Here is a picture of the tree:
http://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+htmlhttp://genesdev.cshlp.org/content/8/23/2879.full.pdf+html


11/11

bio212ac take home final carlautta griffith

Documents