bio202_05_euk_trxn
DESCRIPTION
bbbbbbbbbbbbbbbbbbbTRANSCRIPT
![Page 1: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/1.jpg)
Transcription: a primer (eukaryotic)
Aurnab Ghose; 150202
![Page 2: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/2.jpg)
Same genome!
![Page 3: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/3.jpg)
Anise swallowtail, Papilio zelicaon
Same genome!
![Page 4: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/4.jpg)
Gene mRNA Translation at ribosome
Protein
Transcription
![Page 5: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/5.jpg)
![Page 6: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/6.jpg)
![Page 7: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/7.jpg)
![Page 8: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/8.jpg)
Transcription • Requires
– Transcription initiation site • where transcription begins
– Promoter • to which RNA polymerase binds
• In multicellular eukaryotes – RNA polymerase binds to promoter (TATA
box)
![Page 9: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/9.jpg)
Eukaryotic promoter elements. A eukaryotic promoter usually contains a TATA box located 25-35 bp upstream from the transcription initiation site. One or more UPEs (upstream promoter elements) is usually present.
TATA box Transcription initiation
site UPE TATA A
pre-mRNA
A A
T T
![Page 10: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/10.jpg)
Enhancers
• Located far away from promoter – control some gene expression
• Help form active transcription initiation complex
• Specific regulatory proteins – bind to enhancer elements – activate transcription by interacting with
proteins bound to promoters
![Page 11: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/11.jpg)
Enhancers
![Page 12: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/12.jpg)
![Page 13: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/13.jpg)
actcaaaaaaaaaacggttgggttgcgccatacatatgaaagagtatagaataatgatgtatttcccaaatcaaatatcatggt
aaaatttaaCAATgacccattcggattcattgataatattagttgatggatcatttgtaaaaaggttttattaactcctaagt
tatgtcgagtagaccttgttgttgttgcTATAATTcttaatcATGcgttgtagggggagatttatgtcaccacaaacagaaacgaaagcaaaggttgggttcaaagctggtgttaaagactgaacgtagcagctacgatcgatcgactagctgcatcgggctagcgaagcttcgatcgatcgatcgagctagcgagcccccagttttaggtcgagctttcagctcagctaggcgcgaaatctcgagcgcagctcactagctgctctagcatcgagctacgatcgcgatcgagctagctagaattatccgtgaagcttgcaaatggagtcctgaattagctgctgcttgtgaagtctggaaggaaatcaaatttga
attcccagcaatggatactttgTAAtccagtaataatcattcgttctattaatttccattaaactcggcccaatctt
![Page 14: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/14.jpg)
Transcription • Is the process of making messenger RNA (mRNA) from a DNA template
• RNA polymerase • Very similar to DNA replica;on • Remember: as in replica;on, in transcrip;on, addi0on of a new nucleo0de occurs at the 3’ end!
• Transcrip;on occurs by base pairing: – A-‐U: 2 H bonds; G-‐C: 3 H bonds
![Page 15: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/15.jpg)
![Page 16: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/16.jpg)
Three Steps of transcription
![Page 17: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/17.jpg)
Complementary Base-pairing of DNA to mRNA
• If the template strand reads: T-‐A-‐C-‐C-‐T-‐T-‐A-‐A-‐C-‐C-‐G-‐G-‐T-‐T-‐A
• The transcribed mRNA is: A-‐U-‐G-‐G-‐A-‐A-‐U-‐U-‐G-‐G-‐C-‐C-‐A-‐A-‐U
Transcrip;on
![Page 18: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/18.jpg)
The structure of mRNA
1. 5’ Guanine cap (G-‐cap) 2. Leader sequence: does not get made into protein 3. Protein coding region begins with AUG & ends with a STOP
codon 4. Trailing sequence does not get made into protein. 5. 3’ poly-‐A tail
![Page 19: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/19.jpg)
1. 5’ Guanine cap (G-cap) 2. Leader sequence: does not get made into protein 3. Protein coding region begins with AUG & ends with
a STOP codon 4. Trailing sequence does not get made into protein. 5. 3’ poly-A tail
![Page 20: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/20.jpg)
Gene Expression: Translation • Central Dogma: DNA → RNA → Protein
– Proposed by Francis Crick
• DNA: 3' ACC AAA CCG AGT • mRNA: 5' UGG UUU GGC UCA • Protein: Trp Phe Gly Ser
• The string of amino acids has a direct rela;onship to nucleo;de bases in RNA and DNA
• Every three nucleo;des is called a Codon • Each Codon corresponds to ONE amino acid
![Page 21: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/21.jpg)
• Amino acid subunits are added at the carboxyl terminus of the growing protein
![Page 22: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/22.jpg)
The elements of eukaryotic transcription
• Cis-acting elements – Basal promoter elements – UPEs – Enhancers
• Trans-acting factors – RNA polymerase – Transcription factors – Accessory proteins
![Page 23: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/23.jpg)
Modulating eukaryotic transcription
Promoter proximal elements (UPEs) Enhancer elements: Can function in either orientation.
Can occur far (<50 kb) from the gene. Can be up- or downstream.
![Page 24: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/24.jpg)
Three RNA polymerases in eukaryotes"
I: pre-rRNA"II: mRNA"III: tRNAs, 5S rRNA, " small stable RNAs""!Also differentiated by sensitivity to α-amanitin.!
![Page 25: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/25.jpg)
Complexity of eukaryotic RNA polymerases"
Function of most subunits is unclear, but nearly all the subunits
are essential
![Page 26: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/26.jpg)
Transcription initiation at eukaryotic protein-coding genes
# of subunits Activity
RNA pol II 12 RNA synthesis
General TX factorsTFIID 9 Promoter recognitionTFIIB 1TFIIE 2TFIIF 2TFIIH 9 helicase
Mediator 20
![Page 27: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/27.jpg)
TBP binds to TATA-box DNA"
TATA-binding protein = TBP!!
TBP is a subunit of TFIID!
Pol II won’t bind unless TFs bind first.
![Page 28: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/28.jpg)
Stepwise assembly of Pol II transcription-initiation complex"
![Page 29: BIO202_05_Euk_Trxn](https://reader034.vdocuments.mx/reader034/viewer/2022042717/55cf92d0550346f57b99ca78/html5/thumbnails/29.jpg)
Transcriptional control requires still more proteins
RNA pol II (12 proteins) General transcription factors (23 proteins) chromatin remodeling complex (15 proteins) specific transcription factors (? proteins) Mediator complex (20 proteins)