Bio 140 Exam 4 Fall 2015 _ Name ______________ __ Use the answer pages for answers. Indicate your test version, Section ______________ Sections

• Drawing • Multiple Choice (3 points each) Mark 2 as FREE on sheet • Fill in require you to use the word bank, recording the appropriate letter in the space. 2 points each,

mark 2 as FREE • Identify/name do not have a word list. Mark 1 free

Multiple Choice 1 In the figure shown, A is the _______ region, B is the

_______ region, and this gene includes _______ introns and _______ exons.

A. promoter; terminator; 2; 3 B. promoter; terminator; 3; 2 C. terminator; promoter; 2; 3 D. terminator; promoter; 3; 2 E. promoter; stop codon; 2; 3 2 Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the assembly

of microtubules, its effectiveness must be related to _____. A) disruption of mitotic spindle formation B) inhibition of regulatory protein phosphorylation C) suppression of cyclin production D) myosin denaturation and inhibition of cleavage furrow formation E) inhibition of DNA synthesis 3) Sister chromatids will separate from each other during which phase(s)? A) mitosis and cytokinesis B) mitosis C) mitosis and meiosis II D) nuclear membrane deconstruction 4 Independent assortment of chromosomes is a result of _____. A) the random way each pair of homologous chromosomes lines up at the metaphase plate during meiosis I B) the random combinations of eggs and sperm during fertilization C) the random distribution of the sister chromatids to the two daughter cells during anaphase II D) the relatively small degree of homology shared by the X and Y chromosomes E) the diverse combination of alleles that may be found within any given chromosome 5 At a certain location in a gene, the template strand of DNA has the sequence GAAG. A mutation results in an

insertion making the sequence GAAAG. This type of mutation is likely to cause a __________ mutation a. silent. b. missense. c. nonsense. d. frame-shift. e. translocation.

6 Which of the following statements about the structural organization of chromatin is true? A. The DNA from a single human cell measures about 2 meters when extended. B. Nucleosomes consist of DNA and several histone molecules. c. During mitosis and meiosis, chromatin becomes highly coiled and condensed. D All the statements are true E. A and B are true

7 In E. coli, what is the function of DNA polymerase III? A) to unwind the DNA helix during replication B) to seal together the broken ends of DNA strands C) to add nucleotides to the end of a growing DNA strand D) to degrade damaged DNA molecules E) to rejoin the two DNA strands (one new and one old) after replication 8 Which of the following sequences would result from replication of this DNA template strand?

3′-AAGTCAGT-5′ A) 3′-AAGTCAGT-5′ B) 5′-AAGTCAGT-3′ C) 5’TGACTGAA3’ D) 3’’TGACTGAA5’ E) 5′-TTCAGTCA-3′ 9 Hutchinson-Gilford progeria is a syndrome that results in the accelerated aging of infants and children. Balding, circulatory trouble, and fragile bone structure typically begin during infancy, and the children typically do not live through their teenage years. When scientists looked at the DNA of these individuals, they found the DNA had shorter ________ than those of healthy individuals. A) telomeres B) ribosomes C) introns D) primers 10 In a healthy cell, the rate of DNA repair is equal to the rate of DNA mutation. When the rate of repair lags behind the rate of mutation, what is a possible fate of the cell? A) The cell can be transformed to a cancerous cell. B) RNA may be used instead of DNA as inheritance material. C) The cell will become embryonic. D) DNA synthesis will continue by a new mechanism. 11 A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be _____. A) TTG-CTA-CAG-TAG B) AAC-GAC-GUC-AUA C) AUG-CTG-CAG-TAT D) AAA-AAT-ATA-ACA E) AAA-GAA-TAA-CAA 12 Suppose you are provided with an actively dividing culture of E. coli bacteria to which radioactive thymine has been added. What would happen if a cell replicates once in the presence of this radioactive base?

a. DNA in both daughter cells would be radioactive. b. One of the daughter cells, but not the other, would have radioactive DNA c. All four bases of the DNA would be radioactive. d. Radioactive thymine would pair with nonradioactive guanine. e. Neither of the two daughter cells would be radioactive.

13 How can DNA, which is made up of only four different bases, encode the information necessary to specify the workings of an entire organism? a. DNA molecules are extremely long. b. DNA molecules form codons of three bases that code for amino acids. c. The genetic code is redundant but not ambiguous. d. DNA can be replicated with low error rates. e. All of the above

14 Suppose a piece of DNA is digested with two different restriction enzymes in three reactions. Reactions 1 and 2

contain only a single enzyme, the third reaction receives both enzymes. The reactions are loaded into wells of an electrophoresis gel. Wells #1 and #2 receive the reactions with single enzymes while well #3 gets the reaction with both enzymes. The figure here shows the results of the electrophoresis run. Which of the following choices correctly describes the relationship between the fragment size of DNA in the bands (A-E)? A. C = A + B B. B = D + A C. B = D + E D. C = A + D E. A + B = D

15 A man has extra digits (six fingers on each hand and six toes on each foot). His wife and their daughter have a normal number of digits. Having extra digits is a dominant trait. The couple's second child has extra digits. What is the probability that their next (third) child will have extra digits? A) 1/2 B) 1/16 C) 1/8 D) 3/4 E) 9/16 16 Which one of the following statements about RNA processing is true? A) Ribozymes may function in RNA splicing B). Exons are cut out before mRNA leaves the nucleus. C) RNA splicing can be catalyzed by tRNA. D) A primary transcript is often much shorter than the final RNA molecule that leaves the nucleus. 17 Death cap mushrooms produce a substance called alpha-amanitin. Alpha-amanitin efficiently blocks synthesis of mRNA, but not of tRNA or rRNA in eukaryotic organisms. This is possible because alpha-amanitin efficiently interferes with _____. A) the action of RNA polymerase I, but not RNA polymerase II or III B) RNA polymerase III, but not RNA polymerase I and II C) the action of one or more basic transcription factors D) the action of RNA polymerase II, but not RNA polymerase I or III

MATCHING/FILLIN (2 points each) (Mark two as FREE.) Select a word or figure from the “bank”.

1 The following DNA sequence is found at the start of a protein coding gene, and contains the first amino acid codon followed several more codons. Translate this using the codon table. Find it in the list. M G I R G H S I

5'atggggatacgcggccattcgatc3'

2 The template strand for this DNA coding strand: 5'atggggatacgcggccattcgatc3' 5'gatcg aatggccgcgtatccccat'3

3 The experiments of Meselson and Stahl established that the replication of DNA is _________.semiconservative_______________.

4,5 In lab you used _______________ to cut _________________ DNA.

6 Point mutations are referred to as missense, silent, frameshift, or ___________ nonsense

7 _____________ are removed by a spliceosome complex.

8 An example of codominance is _____________ ABo bloodtype

9 ________________is NOT synthesized from a DNA template.

10 In garden peas, the allele for tall plants is dominant over the allele for short plants. A true-breeding tall plant is crossed with a short plant, and one of their offspring is test crossed. Out of 20 offspring resulting from the test cross, about _______ should be tall. Ten

11 Genes that are on the same chromosome, or "linked", do not assort independently, but can be separated by recombination. True or false

12 Ultraviolet light, like the type you receive while sunbathing, can cause a type of mutation called ______________. ____thymine dimers___

13 DNA synthesis in eukaryotic cells initiates at many points simultaneously (true or false) true 14 This molecule carries the amino acid during translation. __________

15 In the DNA gel shown which suspect is guilty? (# not in word list)

16, 17 Name a gene and its protein that was modeled during the chromosome project (not in list)

Identify the molecule or structure. 2 points each one free (names not in word bank)

__________________ _______________________ ___________________________

_________________________ __________________________ _________________________

Identify the molecule or structure. 2 points each one free (names not in word bank)

__________________ _______________________ ___________________________

_________________________ __________________________ _________________________