betaine aldehyde dehydrogenase in sorghumâ€™

Plant Physiol. (1996) 110: 1301-1308

Betaine Aldehyde Dehydrogenase in Sorghum’

Molecular Cloning and Expression of Two Related Cenes

Andrew J. W O O ~ ~ ? ~ , Hirofumi Saneoka, David Rhodes, Robert J. Joly, and Peter B. Goldsbrough*

Department of Horticulture, Purdue University, West Lafayette, Indiana 47907-1 165 (A.J.W., D.R., R.J.J., P.B.G.); and Faculty of Applied Biological Sciences, Hiroshima University, 1-4-4 Kagamiyama,

Higashi-Hiroshima 724, Japan (H.S.)

The ability to synthesize and accumulate glycine betaine i s widespread among angiosperms and i s thought to contribute to salt and drought tolerance. I n plants glycine betaine i s synthesized by the two-step oxidation of choline via the intermediate betaine aldehyde, catalyzed by choline monooxygenase and betaine aldehyde dehydrogenase (BADH). Two sorghum (Sorghum bicolor) cDNA clones, BADHl and BADHl5, putatively encoding betaine aldehyde dehydrogenase were isolated and characterized. BADHl i s a trun- cated cDNA of 1391 bp. BADHl5 is a full-length cDNA clone, 181 2 bp in length, predicted to encode a protein of 53.6 kD. The predicted amino acid sequences of BADHl and BADH15 share signif- icant homology with other plant BADHs. The effects of water deficit on BADH mRNA expression, leaf water relations, and glycine betaine accumulation were investigated i n leaves of preflowering sorghum plants. BADHl and BADH15 mRNA were both induced by water deficit and their expression coincided with the observed glycine betaine accumulation. During the course of 17 d, the leaf water potential in stressed sorghum plants reached -2.3 MPa. In response to water deficit, glycine betaine levels increased 26-fold and proline levels increased 108-fold. I n severely stressed plants, proline accounted for >60% of the total free amino acid pool. Accumulation of these compatible solutes significantly contributed to osmotic potential and allowed a maximal osmotic adjustment of 0.405 MPa.

The ability to modify essential metabolic processes is key to adapting to adverse environmental conditions (Yancey et al., 1982). Plants utilize a number of protective mechanisms to maintain normal cellular metabolism and prevent damage to cellular components. In response to declining Ww, many plant species experience a similar decline in WT (Morgan, 1984). The decrease in WT can be the result of either passive ion concentration, caused by a reduction in

’ This research was supported by grants from the U.S. Depart- ment of Agriculture-National Research Institute (contract Nos. 93-37100-8870 and 91-37100-5873) and the McKnight Founda- tion.

’A.J.W. was supported by a fellowship from the McKnight Foundation.

Present address: U.S. Department of Agriculture-Agricultura1 Research Service, Cropping Systems Research Laboratory, Box 215, Route 3, Lubbock, TX 79401.

* Corresponding author; e-mail [email protected]. edu; fax 1-317-494-0391.

1301

cell volume, or the active accumulation of solutes. The decrease in W,, that results from the active accumulation of solutes is termed OA (Morgan, 1984). OA is a mechanism for maintaining turgor and reducing the deleterious effects of water stress on vegetative and reproductive tissues (Flower et al., 1990). The active accumulation of solutes compatible with cellular metabolism is thought to play a central role in OA (Yancey, 1994). Gly betaine (Rhodes and Hanson, 1993) and Pro (Yancey, 1994) are compatible solutes that accumulate in response to osmotic stress, and the accumulation of these osmolytes may represent an important adaptive response to drought stress.

Gly betaine is a quaternary ammonium compound that accumulates in a diverse array of prokaryotic (Csonka, 1989) and eukaryotic organisms (Rhodes and Hanson, 1993). The ability to synthesize and accumulate Gly betaine is widespread among angiosperms (Weretilnyk et al., 1989) and is thought to contribute to salt and drought tolerance (Grumet and Hanson, 1986). Gly betaine is synthesized by the two-step oxidation of choline via betaine aldehyde (reviewed by Hanson, 1993). In plants, CMO is responsible for the oxidation of choline to betaine aldehyde and BADH converts betaine aldehyde to Gly betaine. The biosynthesis and accumulation of Gly betaine has been extensively studied in two plant families, the Chenopodiaceae (Brouquisse et al., 1989) and the Poaceae (Rhodes et al., 1989; Lerma et al., 1991).

The biosynthesis of Gly betaine is oxygen dependent and has been localized to the chloroplast in chenopods (Hanson et al., 1985). CMO is an Fd-dependent enzyme and has been partially purified from spinach leaves (Burnet et al., 1995). BADH is a pyridine nucleotide-dependent dehydrogenase (Weretilnyk et al., 1989) specific to betaine aldehyde (Wei- gel et al., 1986). BADH has been purified to homogeneity from the leaves of salinized spinach plants and, like CMO, is found primarily in the stromal fraction of the chloroplast (Arakawa et al., 1987; Weretilnyk and Hanson, 1989). cDNA clones corresponding to BADH have been cloned

Abbreviations: AWC, apoplastic water content; BADH, betaine aldehyde dehydrogenase; CMO, choline monooxygenase; OA, osmotic adjustment; PD-MS, plasma desorption MS; W , osmotic potential; 9r(loo), osmotic potential at full turgor; W,, leaf water potential; RACE, rapid amplification of cDNA ends; RWC, relative water content.

www.plantphysiol.orgon December 13, 2018 - Published by Downloaded from Copyright © 1996 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

1302 Wood et al. Plant Physiol. Vol. 110, 1996

from spinach (Weretilnyk and Hanson, 1990), sugar beet (McCue and Hanson, 1992), and barley (Ishitani et al., 1995). The accumulation of Gly betaine in higher plants is induced by cold (Kishitani et al., 1994), drought (Ladyman et al., 1980), and salinity (Hanson and Wyse, 1982). Gly betaine accumulates primarily in the leaves of stressed plants (Hanson, 1993). The stress-induced accumulation is associated with increases in the activities of CMO (Brou- quisse et al., 1989) and BADH (Weretilnyk and Hanson, 1989). The observed increase in BADH activity is accom- panied by increases in the levels of BADH protein (Wer- etilnyk and Hanson, 1989) and mRNA (Weretilnyk and Hanson, 1990; McCue and Hanson, 1992).

We are interested in how solute composition and gene expression change in response to water deficit and how these responses might contribute to drought tolerance of sorghum (Sorgkum bicolor). We report here the cloning of two cDNAs from sorghum encoding proteins with homology to BADH. We have analyzed BADH gene expression within a broader physiological context. In addition to the expression of BADH mRNA, we describe the effect of water deficit on leaf water status, OA, and the accumulation of Pro and Gly betaine.

MATERIALS AND METHODS

Plant Material and Cultural Conditions

Sorghum (Sorgkum bicolor) seeds of cv P954035 were obtained from G. Ejeta and J.D. Axtell (Purdue University, West Lafayette, IN). P954035 is derived from an African land race and has been selected for drought tolerance. Seeds were germinated in 15-L pots containing a 2:2:1 (v/v/v) mixture of perlite, peat moss, and top soil. Seed- lings were thinned to one plant per pot and grown on unshaded benches in the Department of Horticulture (Pur- due University) greenhouse, during the summer of 1993. Plants were watered daily with a solution containing 200 mg L-' each of K and N supplied by 517 mg L-' KNO, and 367 mg L-' NH,NO,, and 46 mg L-' P supplied by means of 75% technical grade phosphoric acid. Sixty individual plants were maintained. Four weeks after planting, plants were randomly assigned to either a control or stress group. Stress was developed by withholding a11 water, whereas the control group was watered daily. Leaf samples were harvested from randomly selected plants on the days indicated, between 10 AM and noon. To study the recovery from water deficit, plants from the stress group were re- watered 17 d after the initiation of stress. A11 analyses subsequently described (eg. leaf water status, OA, RNA expression, and quantification of Gly betaine and amino acids) were performed on the third-uppermost fully expanded leaf.

.

Leaf Water Relations

qw was measured on the third-uppermost fully expanded leaf using a pressure chamber (PMS Instruments, Corvallis, OR). RWC was measured in the same leaf as described by Premachandra et al. (1994) and calculated according to the formula RWC = [(fresh weight - dry

weight)/(turgid weight - dry weight)] x 100. After mea- surement of qw, half of the remaining leaf was sealed in a polyethylene freezer bag, frozen in liquid nitrogen, and stored at -20°C. Leaf tissue was thawed and centrifuged at 1200g for 25 min at 4°C to extract cell sap. T, of the collected cell sap was measured using a Wescor mode15100 C vapor pressure osmometer (Wescor, Logan, UT). P, was corrected, according to the method of Tyree (1976), for the dilution of symplastic sap by apoplastic water that occurs when expressed sap is collected from frozen and thawed tissue. Sorghum AWC has been estimated to range between 11 and 13% (Flower et al., 1990). An AWC value of 11.5% was calculated, based on analysis of the water potential isotherm from a subset of the experimental plants, and used in a11 subsequent osmotic calculations. Pressure potential was calculated by subtracting the corrected T, from 'Pw . 'T,(loo) was calculated according to the formula 9m(loo) = qm (RWC - AWC)/(100 - AWC) (Wilson et al., 1979). OA was calculated as the difference between T,(loo) values estimated for drought-stressed and nonstressed sorghum leaves (Flower and Ludlow, 1986).

Analysis of Amino Acids and Cly Betaine

Amino acids and Gly betaine were isolated as described by Rhodes et al. (1989). Cell sap was extracted as described above from the same leaf used to measure Tw and RWC. a-Amino-n-butyrate (250 nmol) and d,-Gly betaine (500 nmol) were added as internal standards. The aqueous phase was removed, air dried, and dissolved in distilled water. Gly betaine and amino acids were purified by Dowex-1-OH- and Dowex-50-H+ ion-exchangc chroma- tography (Rhodes et al., 1989). Gly betaine was eluted from Dowex-1-OH- with distilled water, and amino acids were eluted with 2.5 N HCl. Gly betaine was eluted from a Dowex-50-H+ column with 6 M NH,OH. The purified fractions were air dried and quantified as described below. Amino acid fractions were derivatized as N(0,S)-heptaflu- orobutryl isobutyl derivatives and analyzed by IGC as described by Rhodes et al. (1989).

Quantification of Cly Betaine by PD-MS

Gly betaine was quantified by PD-MS using a 20R Plasma Desorption mass spectrometer (BIOION KB, Upp- sala, Sweden) (Yang et al., 1995). Fifty microliters of meth- ano1 were added to the dried betaine sample. Sample tar- gets were prepared by electrospraying 50 p L of a 2 mg/mL nitrocellulose in acetone solution onto a Mylar target. Two microliters of the methanol-betaine solution were applied to the sample target and dried under a stream of nitrogen. Samples were inserted into the BIOION 20R carousel and ionized by means of a radioactive 252Cf source, and spectra were obtained for 15 min. Gly betaine was quantified from the ratio of ions at m/z 118:127 where the ion at m/z 118 represents the M+Ht ion of Gly betaine and the ion at m/z 127 represents the M+H+ ion of the d,-Gly betaine internal standard (Yang et al., 1995).



Gly Betaine Accumulation in Sorghum 1303

lsolation of RNA and Genomic DNA

Total RNA was isolated using the method described by Zhou and Goldsbrough (1993). Genomic DNA was isolated using the cetyltrimethylammonium bromide method described by Saghai-Maroof et al. (1984).

cDNA Library Screening

A cDNA library, prepared from mRNA isolated from seedlings subjected to water deficit, was screened using a spinach BADH cDNA, provided by A.D. Hanson (Weretil- nyk and Hanson, 1990). Filters were prehybridized for 4 h at 65°C in a solution containing 5X Denhardt's solution (0.1% BSA, 0.1% PVP, 0.1% Ficoll), 100 pg/mL denatured salmon sperm DNA, 3X SSC, and 0.5% SDS. Filters were hybridized with the 32P-labeled BADH cDNA at 65°C for 36 h in a solution identical with the prehybridization solution. Filters were washed three times at 65°C in 3X SSC, 0.1% SDS. Plaques that hybridized to the spinach BADH cDNA were purified through three rounds of screening under identical conditions. A second cDNA library, prepared from mRNA isolated from developing sorghum seeds (12-15 d after pollination), was obtained from R.A. Bressan (Purdue University). This library was screened as described using a sorghum BADH cDNA (pAW9, see below). Plaques that hybridized to the sorghum BADH cDNA were purified as described above.

5' RACE

Initial screening of the sorghum cDNA library produced BADH clones that were not full length (i.e. they lacked information at the 5' end). Additional 5' sequence for the longest clone, pBAD1, was obtained using the 5' RACE system (BRL). First-strand cDNA was synthesized from 1 mg of total RNA (isolated from stressed seedlings) primed with a gene-specific oligonucleotide, designated J (5'- AACTGGCCCAAGTCTGCAA-3'). Oligo(dC) was added to the 3' end of the cDNA using terminal deoxynucleotidyl transferase. The tailed cDNA was amplified by polymerase chain reaction (94"C, 20 s denature; 58"C, 60 s anneal; 72"C, 120 s extend; 25 cycles) using an anchor primer (5'-GGC- CACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3') and a nested gene-specific primer, designated AW (5'-TTCAA- GTGGATCCGAAACC-3'). Amplified DNA products were separated by agarose gel electrophoresis, and fragments >650 bp were cloned into the SmaI site of pGEM7Z (Pro- mega). The plasmid containing the largest insert was designated pAW9.

RNA and DNA Hybridization

Twenty micrograms of total RNA were fractionated by formaldehyde-agarose gel electrophoresis, transferred to supported nitrocellulose (Schleicher & Schuell), and immo- bilized by exposure to a UV source. Filter-bound RNA was hybridized with 32P-labeled DNA in a solution containing 50% formamide, 5X Denhardt's solution, 5X SSPE, 100 pg/mL denatured salmon sperm DNA, and 0.5% SDS. RNA blots were washed with 1 X SSC, 0.1% SDS and ex-

posed to x-ray film. 32P-labeled DNA probes were produced using a Decaprime labeling kit (Ambion, Austin, TX). Blots were subsequently hybridized with a probe prepared from DNA encoding 18s rRNA. Hybridization was normalized relative to the rRNA signal and quantified by densitometry of autoradiograms with different exposure times, using a PD-120 densitometer (Molecular Dynamics, Sunnyvale, CA).

Genomic DNA (10 pg) was digested with restriction enzymes, separated on an agarose gel, and transferred to supported nitrocellulose. Filter-bound DNA was hybridized with 32P-labeled DNA in a solution of 5X Denhardt's solution, 6X SSPE, 100 pg/mL denatured salmon sperm DNA, and 0.5% SDS at the temperatures indicated. Blots were washed three times in 1 X SSC, 0.1% SDS at 65°C.

DNA Sequencing and Analysis

The dideoxy chain termination method (Sanger et al., 1977) was used for DNA sequencing using a Sequenase sequencing kit (United States Biochemical). Nested dele- tions were generated with exonuclease I11 and mung bean nuclease according to the manufacturer's instructions (Erase-a-Base, Promega). The University of Wisconsin Ge- netics Computer Group package was used for sequence assembly, analysis, and homology searches (Devereux et al., 1984).

RESULTS

lsolation and Characterization of BADHI and BADH15

A sorghum cDNA library was screened using the spinach BADH cDNA (Weretilnyk and Hanson, 1990) as probe. Forty recombinant bacteriophage that hybridized to the probe at high stringency were identified in the initial screen. One of these clones, designated pBAD10, was plaque purified and subcloned by in vivo excision, and the DNA sequence of both strands was determined. pBADlO was 899 bp in length and contained a single, continuous open reading frame. The deduced amino acid sequence has high homology (>64%) with spinach BADH (data not shown). The sorghum cDNA library was screened again using pBADlO as probe. However, none of the 50 recombinant bacteriophage examined contained a larger cDNA than present in pBAD10.

To obtain sequence data 5' to pBAD10, 5' RACE was used. The longest polymerase chain reaction fragment, designated AW9, was cloned and sequenced. AW9 is 691 bp in length and contains an overlapping sequence of 199 bp that is identical with BAD10, indicating that AW9 represents a legitimate amplification product of the BADlO mRNA. The composite nucleotide sequence was designated BADH1, and the deduced amino acid sequence is shown in Figure 1. The composite cDNA was 1391 bp in length and the 3' noncoding region included a putative polyadenylation sig- na1 (AATAAA) 28 nucleotides upstream from the poly(A) tail. The longest open reading frame begins at nucleotide 1, terminates with nucleotide 1275, and encodes 424 amino acids.



1304 Wood et al. Plant Physiol. Vol. 110, 1996

Figure 1 . Comparison of the deduced amino acid sequence for two sorghum BADH cDNA clones. BADHl (U12195) is a composite sequence composed of an 884-bp cDNA clone (pBAD10) and an overlapping 691-bp RACE fragment (pAW9). The combined length of BADHl is 1391 bp. BADH15 (U12196) is a single, continuous cDNA 1812 bp in length. Gaps were introduced for optimal alignment and are displayed using Prettybox (Devereux et al., 1984). A boxed and shaded background indicates identical amino acids, whereas a shaded background indicates conservative substitutions. Numbers to the right refer to amino acid residues.

BADHl BADH15

BADH1 BADH15

5ADHl BADH15

5ADHl BADH15

BADHl 5ADHl5

BADHl BADH15

BADHl BADH15

BADHl BADH15

BADH 1 BADHl5

To obtain a full-length BADH cDNA, a second cDNA library was screened using AW9 as probe and BADH15 was isolated. This cDNA is 1812 bp in length and contains an open reading frame encoding a 494-amino acid protein with a predicted mass of 53.6 kD and a pI of 5.65. The deduced amino acid sequence is presented in Figure 1. The 3' noncoding region of the cDNA includes two putative polyadenylation signals 25 and 143 nucleotides upstream from the poly(A) tail. The calculated molecular mass (53.6 kD) is very similar to those calculated for spinach (54.3 kD) and sugar beet (54.7 kD) BADH monomers (Weretilnyk and Hanson, 1990; McCue and Hanson, 1992). Immunoblot analysis using antibodies raised against the spinach BADH subunit has shown that sorghum leaves contain an immu- nologically related protein of similar molecular weight to spinach BADH (Ishitani et al., 1993).

The deduced amino acid sequences of BADHl and BADH15 are 66% identical and 77% similar at the amino acid leve1 (Table I). The deduced sorghum BADH proteins share between 62 and 71% identity with other plant BADH proteins. It is interesting that the sorghum BADH proteins encoded by these cDNAs have no greater homology to each other (66%) than to the spinach (67/64%), sugar beet (66/ 62%), or barley (62/71%) enzymes. The lowest identity was

Table 1. Comparison o f the deduced amino acid sequences for BADH from sorghum and various other species

The protein sequences were aligned and compared using BESTFIT (Genetics Computer Group). ldentity is expressed on a percentage basis. nd, Values were not determined.

B A D H l BADH15 Spinach Sugar Beet Barley

BADHl5 66 Spinach 67 64

Barley 62 71 69 70 fscherichia coli 36 35 nd nd nd

Sugar beet 66 62 90

154 239

272 359

424 494

observed with the bacterial BADH (36%). BADH1 contains a decapeptide, VTLELGGKSP (residues 145-1154), that is highly conserved among aldehyde dehydrogenases in gen- eral (Boyd et al., 1991) and among BADHs (Lamark et ai., 1991). In BADH15 there is one substitution of Ser for Thr in the second position of this decapeptide. The N terminus of BADH15 (residues 1-100) shows less identity with the spinach, sugar beet, and barley BADH proteins than the remainder of the deduced peptide (Fig. 2). BADH15 does share extensive homology (7 of 11 residues) with the sequence QLFIDGEWREP (amino acid residues 8--19 in spinach BADH), which is present within the matu.re spinach BADH protein (Weretilnyk and Hanson, 1990).

Genomic DNA Blot Analysis

AW9 hybridized to two bands in sorghum DNA digested with EcoRV and EcoRI and to a single band in XbaI- and BglII-digested DNA (Fig. 3A). BADH15, however, hybridized to a single band in each digest (Fig. 3B). The two cDNAs exhibited distinct hybridization patterns as ex- pected from the difference in DNA sequence and the hybridization conditions that were used. These results sug- gest that BADHl and BADH15 are each present in one to two copies within the sorghum genome.

Analysis of BADHl and BADH15 mRNA Expression

In spinach, sugar beet, and barley, BADH mIWA is salt and drought inducible (Weretilnyk and Hanson, 1990; Mc- Cue and Hanson, 1992; Ishitani et al., 1995). We used RNA blot analysis to examine the accumulation of BADHl and BADH15 mRNAs under water deficit. Plants were maintained under well-watered conditions or subjected to stress by withholding water for up to 17 d. Both BADH1 and BADH15 mRNAs were detected in leaves of nonstressed plants (Fig. 4, lanes C , and CJ. Two representative control




BADH15SUGARSPINACHBARLEY

BADH15SUGARSPINACHBARLEY

GG———ALVA CiKRNKGREWAA T:RRN---NWSAARRRE-PWAR

54585860

100100100100

Figure 2. Comparison of the first 100 amino acid residues encoded by sorghum (BADH15), spinach (Weretilnyk andHanson, 1990), sugar beet (McCue and Hanson, 1992), and barley (Ishitani et al., 1995) BADHs. Gaps were introduced foroptimal alignment and are displayed using Prettybox (Devereux et al., 1984). A boxed and shaded background indicatesidentical amino acids, whereas a shaded background indicates conservative substitutions.

samples are shown. Similar results were observed in con-trol plants sampled on d 8, 12, 14, 16, and 19 (data notshown). The steady-state mRNA levels for BADH1 andBADH15 in control plants did not change during the pe-riod of these experiments.

In leaf 1 (the flag leaf), BADH1 mRNA increased approx-imately 2- to 3-fold within 12 d after the initiation of stressand maintained a relatively constant level of expressionduring the remainder of the drought stress. The level ofBADH1 mRNA did not change during the recovery fromstress (d 19 and 23). In leaf 3, the third-uppermost fullyexpanded leaf, where solute composition and ^w weredetermined (see below), BADH1 mRNA increased 3- to4-fold 8 d after the initiation of stress. The level of BADH1mRNA remained constant and then declined after 14 d ofstress. BADH1 mRNA declined immediately after rewater-ing but returned to nonstress levels by d 23. BADH15mRNA also was detectable in the leaves of nonstressedsorghum plants (lanes C1 and C2) but was less abundantthan BADH1 mRNA (Fig. 4). In leaf 1, BADH15 mRNAincreased approximately 2-fold within 12 d after the initi-ation of stress and maintained a constant level of expres-sion throughout the remainder of the treatment. In leaf 3,BADH15 mRNA increased approximately 2-fold 8 d afterthe initiation of stress and remained relatively constant

A BADH1

O o w

O o -°LU UJ X

B BADH15

8 8 % 1LU Uj X CDMW(Kb)

— 23.1

—— 9.42

—— 6.56

—— 4.36

MW(Kb)

-23.1

-9.42

-6.56

-4.36

Figure 3. DNA blot analysis of sorghum genomic DNA. GenomicDNA was digested with fcoRV, fcoRI, Xba\, and Bg/ll, separated bygel electrophoresis, transferred to nitrocellulose, and hybridized witha 32P-labeled cDNA probe for BADH1 (A) or BADH15 (B) at 65°C.The probe was AW9 or a 350-bp, 5' EcoR\-Kpn\ fragment, respec-tively. Blots were exposed to x-ray film with an intensifying screen at-70°C for 40 h.

during the remainder of the experiment. These results in-dicate a modest 2- to 3-fold increase in the level of BADHmRNAs in response to water stress in sorghum leaves. Thisinduction is similar to that observed in response to salin-ization in spinach (Weretilnyk and Hanson, 1990) andsugar beet (McCue and Hanson, 1992). BADH enzyme levelis increased approximately 1.6-fold in response to saliniza-tion of sorghum leaves (Ishitani et al., 1993).

Leaf Water Relations, Solute Composition, and OA

^w, solute composition, and OA were measured on leaf3. When water was withheld, Vm remained relatively highduring the 1st week (Fig. 5A). However, tyw declined lin-early during the next 8 d from -0.7 to -2.3 MPa. Uponrewatering (d 17), "Vw quickly returned to control levels

BADH1Control Days After Stress Initiation

C, C2 8 12 14 16 19 23

Leaf one m*"»

Leaf three 9 •••9 • *

BADH 15 Contro1 DaVs After stress InitiationCi C 2 8 12 14 16 19 23

Leaf one

Leaf three

rRNA limnsFigure 4. RNA blot analysis of BADH1 and BADH15 mRNA expres-sion in sorghum leaves. Total RNA was extracted from the leaves ofcontrol and stressed sorghum. Total RNA (10 fig) was separated byelectrophoresis in a formaldehyde-agarose gel and transferred tonitrocellulose. Top, RNA blot was hybridized with a 32P-labeledcDNA probe for BADH1 (pAW9). Bottom, RNA blots were hybrid-ized with a 32P-labeled cDNA probe for BADH15. Blots were ex-posed to x-ray film with an intensifying screen at -70°C for 60 h. C,(d 0) and C2 (d 23) are representative samples from nonstressedplants. RNA blots, from both leaf 1 and 3, were reprobed with DNAencoding rRNA. Hybridization was normalized relative to the rRNAsignal and quantified by densitometry of autoradiograms as de-scribed. www.plantphysiol.orgon December 13, 2018 - Published by Downloaded from

Copyright © 1996 American Society of Plant Biologists. All rights reserved.


1306 Wood et al. Plant Physiol. Vol. 11 O, 1996

0.0 I I I I

A

-3.0 1 I I 1 1 I 1

" O 5 10 15 20 25

Days After Withholding Water

Figure 5. Tw, RWC, and the accumulation of Pro and Gly betaine in mature sorghum plants during preflowering water deficit. Analysis was performed on the third-most fully expanded leaf (leaf 3). qW was measured using a pressure chamber. RWC was measured as described in "Materiais and Methods." Pro concentration was determined by GC analysis. Cly betaine concentration was determined by PD-MS. Each data point represents the mean of measurements on five individual plants and error bars indicate SE. In some instances, error bars are contained wholly within the symbol. The arrow in A indicates the time of rewatering.

and was indistinguishable from that of nonstressed plants on d 19. RWC followed a pattern similar to qw (Fig. 5B). RWC decreased from 97 to 90% during the first 7 d and then declined steeply during the next 8 d to 45%. As with Tw, RWC quickly returned to nonstress levels upon alle- viation of the stress.

In nonstressed leaf tissue, Pro levels were relatively low (approximately 0.17 mmol L-') and changed little during preflowering plant development (Fig. 5C). In stressed plants, Pro levels doubled to 0.31 mmol Lpl by d 8 and then increased to a maximum concentration of 18.84 mmol L-' on d 16. This represents a drought-induced increase in Pro concentration of more than 100-fold. Upon rewatering, the

Pro concentration declined to a leve1 indistinguishable from that in nonstressed tissue within 3 d. In nonstressed sorghum leaf tissue, Gly betaine levels were relatively low (approximately 0.20 mmol L-') and were constant during preflowering plant development (Fig. 5D). Gly betaine levels tripled within the first 8 d of stress and reached a maximum concentration of 6.41 mmol L-' on d 16. The concentration of Gly betaine increased 26-fold iii response to water deficit but did not return to control levels upon rewatering.

OA is a measure of TT relative to RWC ((Dr cellular volume). OA was calculated as the differencle between Ta(loo) values estimated for drought-stressed and nonstressed sorghum leaves. The development of OA in sorghum under stress is shown in Figure 6. The maximal OA was 0.405 MPa on d 12. OA declined during the most severe stress (d 12-16) but never decreased below 0.20 MPa.

DISCUSSION

Sorghum cDNAs have been isolated that encode proteins with homology to BADH. BADHl is a composite DNA sequence (BAD10 cDNA plus AW9 RACE product) that is 1391 bp in length. Based on comparison to other plant BADH cDNA clones, BADHl lacks 300 to 400 bp of 5' sequence. BADH15 is a full-length cDNA (1812 bp) capable of encoding a 494-amino acid protein. The two sorghum BADH clones are homologous to each other (66% amino acid identity) and share severa1 regions of total identity. Gly betaine biosynthesis occurs in the chloroplast in chenopods (Hanson et al., 1985). BADH is encoded by a nu- clear gene (Weretilnyk and Hanson, 1988), and tlie enzyme is localized in the chloroplast (Weigel et al., 1986). BADH cDNAs, however, do not encode typical, luminal transit peptides (Weretilnyk and Hanson, 1990). Spinach and sugar beet BADH either lack a transit peptide completely or possess a very unusual transit peptide. It is highly

Days After Withholding Water

Figure 6. OA in response to preflowering water deficit in sorghum leaves (leaf 3). OA was calculated as the difference between Tv~,oo~ values estimated for control and stressed sorghum leaves. Each data point represents the mean of five individual measurements. The arrow indicates the time of rewatering.




probable that the spinach BADH cDNA isolated by Wer- etilnyk and Hanson (1988, 1989, 1990) corresponds to the stromal BADH activity. Rathinasabapathi et al. (1994) dem- onstrated that transgenic tobacco plants, expressing either spinach or sugar beet BADH cDNAs, produce a chloroplas- tic BADH. The mechanism by which BADH enters the chloroplast is unknown in these species. Understanding this mechanism might provide new insight into cellular protein trafficking.

The deduced primary structure of spinach and sugar beet BADH contains the amino acid sequence QLFIDGE at residues 9 to 15. Protein sequencing of tryptic digests has shown that this peptide sequence is present in the mature spinach BADH protein (Weretilnyk and Hanson, 1990). BADH15 has a related sequence, PSFIGGD. However, compared to the spinach and sugar beet clones, the N-terminal sequence for BADH15 (residues 1-100) is considerably more divergent than the remainder of the deduced peptide. The subcellular localization of BADH in sorghum has not been established. Analysis of the predicted N-terminal amino acids of BADH15 does not give any clear indication of the localization of BADH15 peptide. Like spinach, sugar beet, and barley clones, sorghum BADH15 cDNA either does not encode a transit peptide or possesses an unusual transit sequence.

Sorghum is known to accumulate Gly betaine and Pro in response to salinity stress (Weinburg et al., 1982; Grieve and Maas, 1984). However, the individual solutes contrib- uting to OA have not been extensively studied in drought- stressed sorghum. Jones et al. (1980) have shown that free amino acids make an important contribution to OA in drought-stressed sorghum leaves, but they did not analyze the contribution of Gly betaine. Mature sorghum leaves developed (>0.40 MPa) and maintained (>0.20 MPa) OA. Levels of Gly betaine and Pro increased in response to water deficit and made major contributions to qT and OA (data not shown). Gly betaine and Pro each accounted for 3% (6% total) of the maximal measured OA (d 12). How- ever, under severe stress (q,,, < -2.3 MPa), Gly betaine and Pro accounted for 7 and 1970, respectively, of OA.

Gly betaine is not appreciably catabolized in higher plants (Ladyman et al., 1980). The accumulation of Gly betaine is likely the result of increased biosynthesis, al- though we cannot exclude the possibility that altered transport may contribute to this response to water deficit. The observed decline in the level of Gly betaine upon rewatering of stressed plants may occur by severa1 mechanisms: increased phloem transport, tissue rehydration, new growth, and/or a decrease in biosynthesis. Similarly, accumulation of free Pro may reflect increased biosynthesis, reduced catabolism, or decreased use in de novo protein synthesis. In nonstressed sorghum leaves, no single amino acid accounted for more than 10% of the free amino acid pool (data not shown). In contrast, Pro accounted for more than 60% of the total free amino acid pool in severely stressed sorghum leaf tissue. Similar results have been observed in tobacco cell cultures adapted to 428 mM NaCl in which Pro represented greater than 80% of the total free amino acid pool (Binzel et al., 1987).

The level of BADHl and BADH15 mRNAs increased 2- to 3-fold under conditions of water deficit. The relative intensity of hybridization with these probes suggests that BADHl mRNA is more abundant than that for BADH15 in sorghum leaves. Further studies are required to confirm that these cDNAs encode proteins exhibiting authentic BADH activity and to determine the relative abundance of these mRNAs in different plant organs. The induction of BADHl and BADH15 mRNAs under drought stress is similar to that observed in salt-stressed spinach (Weretil- nyk and Hanson, 1990) and sugar beet (McCue and Han- son, 1992). It is unlikely that the increase in steady-state levels of BADH mRNA can fully account for the 26-fold increase in Gly betaine and there are likely to be other responses to drought stress that also contribute to accumulation of this solute.

ACKNOWLEDCMENT

We are indebted to Dr. Andrew Hanson (University of Florida, Gainesville) for providing the spinach BADH cDNA.

Received September 1, 1995; accepted January 9, 1996. Copyright Clearance Center: 0032-0889/96/110/1301/08. The accession numbers for the sequences reported in this article

are U12195 and U12196 for BADHl and BADH15, respectively.

LITERATURE ClTED

Arakawa K, Takabe T, Sugiyama T, Akazawa T (1987) Purifica- tion of betaine-aldehyde dehydrogenase from spinach leaves and preparation of its antibody. J Biochem 101: 1485-1488

Binzel ML, Hasegawa PM, Rhodes D, Handa S, Handa AK, Bressan RA (1987) Solute accumulation in tobacco cells adapted to NaC1. Plant Physiol 8 4 1408-1415

Boyd LA, Adam L, Pelcher LE, McHughen A, Hirji R, Selvaraj G (1991) Characterization of an Escherichia coli gene encoding betaine aldehyde dehydrogenase (BADH): structural similarity to mammalian ALDHs and a plant BADH. Gene 105: 45-52

Brouquisse R, Wiegel P, Rhodes D, Yocum CF, Hanson AD (1989) Evidence for a ferredoxin-dependent choline monooxygenase from spinach chloroplast stroma. Plant Physiol 90:

Burnet M, Lafontaine P, Hanson AD (1995) Assay, purification and partia1 characterization of choline monooxygenase from spinach. Plant Physiol 108: 581-588

Csonka LN (1989) Physiological and genetic responses of bacteria to osmotic stress. Microbiol Rev 53: 121-147

Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12:

Flower DJ, Ludlow MM (1986) Contribution of osmotic adjustment to the dehydration tolerance of water-stressed pigeonpea (Cajanus cajan (L.) Millsp) leaves. Plant Cell Environ 9: 33-44

Flower DJ, Rani AU, Peacock JM (1990) Influence of osmotic adjustment on the growth, stomatal conductance and light in- terception of contrasting sorghum lines in a harsh environment. Aust J Plant Physiol 17: 91-105

Grieve CM, Maas EV (1984) Betaine accumulation in salt-stressed sorghum. Physiol Plant 61: 167-171

Grumet R, Hanson AD (1986) Genetic evidence for an osmoregulatory function of glycinebetaine accumulation in barley. Aust J Plant Physiol 13: 353-364

Hanson AD (1993) Compatible solute synthesis and compartmen- tation in higher plants. In GN Somero, CB Osmond, CL Bolis, eds, Water and Life. Springer-Verlag, Berlin, pp 53-60

322-329

387-395



1308 Wood et al. Plant Physiol. Vol. I 1 O, 1996

Hanson AD, May AM, Grumet R, Bode J, Jamieson GC, Rhodes D (1985) Betaine synthesis in chenopods: localization in chloroplasts. Proc Natl Acad Sci USA 82 3678-3682

Hanson AD, Wyse R (1982) Biosynthesis, translocation and accumulation of betaine in sugar beet and its progenitors in relation to salinity. Plant Physiol 70: 1191-1198

Ishitani M, Arakawa K, Mizuno K, Kishitani S, Takabe T (1993) Betaine aldehyde dehydrogenase in the Gramineae: levels in leaves of both betaine-accumulating and non-accumulating plants. Plant Cell Physiol 34 493-495

Ishitani M, Nakamura M, Han SY, Takabe T (1995) Expression of the betaine aldehyde dehydrogenase gene in barley in response to osmotic stress. Plant Mo1 Biol 27: 307-315

Jones MM, Osmond CB, Turner NC (1980) Accumulation of solutes in leaves of sorghum and sunflower in response to water deficits. Aust J Plant Physiol 7: 193-205

Kishitani S, Watanabe K, Yasuda S, Arakawa K, Takabe T (1994) Accumulation of glycinebetaine during cold acclimation and freezing tolerance in leaves of winter and spring barley plants. Plant Cell Environ 17: 89-95

Ladyman AR, Hitz WD, Hanson AD (1980) Translocation and metabolism of glycine betaine by barley plants in relation to water stress. Planta 150 191-196

Lamark T, Kaasen I, Eshoo MW, Falkenberg P, McDougall J, Strom AR (1991) DNA sequence and analysis of the bet genes encoding the osmoregulatory choline-glycine betaine pathway of Escherichia coli. MOI Microbiol 5 1049-1064

Lerma C, Rich PJ, Ju GC, Yang W-J, Hanson AD, Rhodes D (1991) Betaine deficiency in maize. Complementation tests and metabolic basis. Plant Physiol 95: 1113-1119

McCue K, Hanson AD (1992) Salt-inducible betaine aldehyde dehydrogenase from sugar beet cDNA cloning and expression. Plant Mo1 Biol 18: 1-11

Morgan JM (1984) Osmoregulation and water stress in higher plants. Annu Rev Plant Physiol 35: 299-319

Premachandra GS, Hahn DT, Joly RJ (1994) Leaf water relations and gas exchange in two grain sorghum genotypes differing in their pre- and post-flowering drought tolerance. J Plant Physiol

Rathinasabapathi B, McCue KF, Gage DA, Hanson AD (1994) Metabolic engineering of glycine betaine synthesis: plant betaine dehydrogenases lacking typical transit peptides are targeted to tobacco chloroplasts where they confer betaine aldehyde resis- tance. Planta 193: 155-162

Rhodes D, Hanson AD (1993) Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu Rev Plant Physiol Plant Mo1 Biol 44 357-384

Rhodes D, Rich PJ, Brunk DG, Ju GC, Rhodes JC, Pauly MH, Hansen LA (1989) Development of two isogenic sweet corn

143: 96-101

hybrids differing for glycinebetaine content. Plant Physiol 91: 11 12-1 121

Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW (1984) Ribosomal DNA spacer-length polymorphismj in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc Natl Acad Sci USA 81: 8014-8018

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463- 5467

Tyree MT (1976) Negative turgor pressure in plant cells: fact or fallacy. Can J Bot 54: 2738-2746

Weigel P, Weretilnyk EA, Hanson AD (1986) Betaine aldehyde oxidation by spinach chloroplasts. Plant Physiol 82: 753-759

Weinburg R, Lerner HR, Poljakoff-Mayber A (1982) A relation- ship between potassium and proline accumulaticin in salt- stressed Sorgkum bicolor. Physiol Planta 55 5-10

Weretilnyk EA, Bednarek S, McCue KF: Rhodes D, Hranson AD (1989) Comparative biochemical and immunological studies of the glycine betaine synthesis pathway in diverse families of dicotyledons. Planta 178: 342-352

Weretilnyk EA, Hanson AD (1988) Betaine aldehyde dehydrogenase polymorphism in spinach genetic and biochemical characterization. Biochem Genet 26: 143-151

Weretilnyk EA, Hanson AD (1989) Betaine aldehyde dehydrogenase from spinach leaves: purification, in vitro translation of the mRNA and regulation by salinity. Arch Biochem Biophys 271:

Weretilnyk EA, Hanson AD (1990) Molecular cloning of a plant betaine-aldehyde dehydrogenase, an enzyme implicated in ad- aptation to salinity and drought. Proc Natl Acad Sci USA 87:

Wilson JR, Fisher MJ, Schulze E-D, Dolby GR, Ludlow MM (1979) Comparison between pressure-volume and dewpoint- hygrometry techniques for determining the water rela tions char- acteristics of grass and legume leaves. Oecologia 41: 77-88

Yancey PH (1994) Compatible and counteracting solutes. In K Strange, ed, Cellular and Molecular Physiology of Cell Volume Regulation. CRC Press, Boca Raton, FL, pp 81-109

Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN (1982) Living with water stress: evolution of osmolyte systerns. Science

Yang W-J, Nadolska-Orczyk A, Wood KV, Hahn DT, Rich PJ, Wood AJ, Saneoka H, Premachandra GS, Bonham CC, Rhodes JC, Joly RJ, Samaras Y, Goldsbrough PB, Rhodes D (1995) Near-isogenic lines of maize differing for glycinebetaine. Plant Physiol 107: 621-630

Zhou J, Goldsbrough PB (1993) An Arubidopsis gene with homology to glutathione S-transferases is regulated by ethylene. Plant Mo1 Biol 22 517-523

56-63

2745-2749

217: 1214-1222



betaine aldehyde dehydrogenase in sorghumâ€™

Documents