beta glucosie metabolism

8/8/2019 Beta Glucosie Metabolism

1/8

JOURNAL OF BACTERIOLOGY, July 2004, p. 42464253 Vol. 186, No. 130021-9193/04/$08.000 DOI: 10.1128/JB.186.13.42464253.2004Copyright 2004, American Society for Microbiology. All Rights Reserved.

Involvement of Streptococcus gordonii Beta-Glucoside MetabolismSystems in Adhesion, Biofilm Formation, and In Vivo

Gene ExpressionAli O. Kilic,1 Lin Tao,1* Yongshu Zhang,2 Yu Lei,2 Ali Khammanivong,2 and Mark C. Herzberg2,3

Department of Oral Biology, College of Dentistry, University of Illinois at Chicago, Chicago, Illinois 60612,1 and Department of Oral Sciences, School of Dentistry,2 and Mucosal and Vaccine Research Center,3

University of Minnesota, Minneapolis, Minnesota 55455

Received 4 November 2003/Accepted 15 March 2004

Streptococcus gordonii genes involved in beta-glucoside metabolism are induced in vivo on infected heartvalves during experimental endocarditis and in vitro during biofilm formation on saliva-coated hydroxyapatite(sHA). To determine the roles of beta-glucoside metabolism systems in biofilm formation, the loci of theseinduced genes were analyzed. To confirm the function of genes in each locus, strains were constructed with geneinactivation, deletion, and/or reporter gene fusions. Four novel systems responsible for beta-glucoside metab-olism were identified, including three phosphoenolpyruvate-dependent phosphotransferase systems (PTS) and

a binding protein-dependent sugar uptake system for metabolizing multiple sugars, including beta-glucosides.Utilization of arbutin and esculin, aryl-beta-glucosides, was defective in some mutants. Esculin and oligochi-tosaccharides induced genes in one of the three beta-glucoside metabolism PTS and in four other genetic loci.Mutation of genes in any of the four systems affected in vitro adhesion to sHA, biofilm formation on plasticsurfaces, and/or growth rate in liquid medium. Therefore, genes associated with beta-glucoside metabolismmay regulate S. gordonii in vitro adhesion, biofilm formation, growth, and in vivo colonization.

Streptococcus gordonii is a pioneer colonizer on the surfaceof human teeth, initiating the formation of dental plaque (25). Although not directly associated with dental or gingival dis-eases in the oral cavity, S. gordonii colonizes damaged heartvalves once it enters the bloodstream in the experimental rab-bit (15) and is considered to cause endocarditis in humans (1,

8, 12). Thus, the virulence ofS. gordonii is reflected in its abilityto adhere, colonize, and survive in the heart, where it is apathogen, and on teeth in the oral cavity, where it is not. Itsvirulence in a specific environment may reflect expression ofgenes uniquely in that environment.

Using an in vivo expression technology (IVET) library con-structed in S. gordonii V288, at least 13 genes were shown to beexpressed in vivo on infected heart valves during experimentalendocarditis, but they were unexpressed in vitro under labora-tory conditions (15). Since expression occurred only on heartvalves, these genes were suggested to contribute to virulenceand perhaps pathogenicity. Similarly, S. gordonii genes ex-pressed during in vitro colonization of saliva-coated hydroxy-apatite (sHA) were identified using the IVET library (17).Among the genes expressed during colonization of sHA anddamaged heart valves in the rabbit were beta-glucoside metab-olism-encoding genes. We therefore initiated in vitro studies tounderstand how the beta-glucoside metabolism genes mightcontribute to colonization of heart valves in infective endocar-ditis and on sHA.

Bacteria ferment beta-glucoside sugar substrates, includingcellobiose, arbutin, salicin, and esculin. While common in

plants and useful in establishing phenotypic fermentationpatterns of bacteria, the aryl-beta-disaccharides are not foundin mammalian tissues and fluids. Mammalian extracellularmatrix, however, is rich in glycosaminoglycans (GAGs),which contain beta-linked disaccharide repeating units (22,33). Structural analogues of cellobiose or N,N-diacetylchito-

biose [(GlcNAc)2], beta-linked disaccharides are released when GAGs degrade. In the rabbit model of endocarditis,S. gordonii may have metabolized GAGs from the injuredheart valves. Metabolism of beta-glucosides by other speciesinvolves known genes. In Escherichia coli, the cel (cellobiose)operon is induced by (GlcNAc)2 and has been renamed the chb(N,N-diacetylchitobiose) operon (14). Listeria monocytogenesexpresses beta-glucoside permease in vivo (10). Hence, metab-olism of beta-glucosides, perhaps in the form of GAG-derivedoligosaccharides, may be an important adaptive response tosurvival in vivo.

In the present study, we compared the gene sequences of theIVET clones with the S. gordonii genomic data (www.tigr.org)to identify the proximal genes in each locus. Five beta-glu-coside-associated genes expressed in vivo during experimentalendocarditis were shown to localize with other beta-glucosidemetabolism genes comprising two different novel phospho-enolpyruvate-dependent phosphotransferase systems (PTS)and a binding protein-dependent sugar transport and metab-olism. We also used this IVET system to identify S. gordoniigenes critical to and perhaps induced during biofilm formationunder in vitro conditions. Among the newly identified genes,many are associated with the metabolism of beta-glucosidesthrough yet another PTS. Therefore, four novel systems forbeta-glucoside metabolism have been identified in S. gordoniiwhich may contribute to virulence during colonization in mam-malian environments.

* Corresponding author. Mailing address: Department of Oral Bi-ology, College of Dentistry, University of Illinois at Chicago, 801 SouthPaulina St., Chicago, IL 60612. Phone: (312) 355-4077. Fax: (312)996-6044. E-mail: [email protected].

4246


2/8

MATERIALS AND METHODS

Bacterial strains, media, and chemicals. Bacterial strains used in this study are

listed in Table 1. S. gordonii V288 and its reporter gene-fusion strain library

based on the streptococcal IVET vector pAK36 (15) were grown in Todd-Hewitt

broth (THB; Difco) or FMC medium (40) at 37 C under CO2-rich conditions.Tetracycline (TET) was added at 15 g/ml to maintain the selective pressure for

growth of the strain library. For sugar fermentation studies, purple broth (Difco)

supplemented with appropriate carbohydrate was used. To detect esculin hydro-

lysis, a ferrous medium was used (4). For the amylase reporter assay, modifiedJordan medium (13) supplemented with 0.5% starch (wt/vol) and 1.5% agar

(wt/vol) plus 0.1% glucose (wt/vol) with or without 0.1% esculin (wt/vol) was

used.

Genes induced during biofilm formation on sHA. The adhesion assay de-

scribed by Gong et al. (11) was modi fied to study biofilm formation by using theIVET library for S. gordonii. An overnight culture of the S. gordonii V288

reporter gene (amy-cat) fusion library in THB with TET was diluted 1,000-fold

in FMC medium. Chloramphenicol was added to a concentration of 15 g/ml to

provide selective pressure for biofilm-induced genes. Bacteria were mixed with

sHA and incubated at 37C for 24 h. Adherent surviving S. gordonii cells wereremoved and spread on THB plates containing TET. Single colonies were replica

plated onto three new THB plates. One contained 5 g of chloramphenicol/ml;

the second contained 0.5% starch (wt/vol); and the third was THB without

antibiotic supplement. After incubation for 24 h at 37C, the colonies on the

starch agar plate were flooded with a solution of 0.5% I2 and 1% KI to detect

amylase activity (starch hydrolysis). Colonies that were sensitive to chloramphen-

icol and negative for amylase activity were selected from the third plate.

Selecting mutants defective in biofilm formation on plastic. Biofilms wereformed in 96-well polystyrene microtiter plates (18, 27). The S. gordonii V288

reporter gene-fusion library was spread on THB plates containing TET and

incubated at 37C for 24 h. Individual colonies were picked and transferred into wells on microtiter plates (Costar 3799) containing 200 l of THB with TET.

Duplicates were made by transferring 100 l of each culture to another well on

a new microtiter plate. Plates were incubated at 37 C for 24 h, and then 25 l ofa 1% crystal violet (CV) solution was added into each well. The plates were

incubated at room temperature for 15 min and rinsed thoroughly with water.

Biofilm formation was quantified by the addition of 200 l of 95% ethanol to

each CV-stained well, of which 125 l was transferred to a new microtiter plate.

The absorbency at 568 nm was determined with a plate reader. Bacteria with

weak CV staining were picked from the duplicate plates as putative biofilm

formation-defective mutants.

Selecting mutants defective in beta-glucoside fermentation. Single colonies of

the S. gordonii V288 reporter gene-fusion library were plated onto modified

Jordan agar supplemented with esculin and ferrous salt (4). The clones that did

not show black pigmentation were tested again for their abilities to ferment

cellobiose, arbutin, and salicin.

PCR procedures. Arbitrary PCR was used to determine the DNA sequenceflanking the inserted IVET vector (2, 28). In the first-round PCR, a primer

unique to the ori sequence of pACYC184 (oriExt, 5-AGCTCAGAGAACCTT

CGAAAAAACC-3) and an arbitrary primer (ARB1, 5-GGCCACGCGTCGA

CTAGTACNNNNNNNNNNGATAT-3) were used in 50-l PCR mixtures (1

Vent polymerase buffer, MgSO4 [1 mM], deoxynucleoside triphosphates [0.25

mM], and Vent [exo] DNA polymerase [1 U] with 5 l of an overnight THB-

grown culture as the DNA template). The first-round PCR conditions were 95C

for 5 min; 6 cycles of 94C for 30 s, 30C for 30 s, and 72C for 1 min; 30 cycles

of 94C for 30 s, 43C for 30 s, and 72C for 1 min; and a final step at 72C for

10 min. The second-round PCR was performed with the same conditions as the

first round, except 5 l of the first-round PCR product was used as DNA

template with primers ARB2 (5-GGCCACGCGTCGACTAGTAC-3) and ori-

Int (5-CAAGAGATTACGCGCAGACC-3). The ARB2 sequence was identi-

cal to the 5 end of the ARB1 primer. The oriInt primer was derived from a

sequence of pACYC184 located closer than the oriExt sequence to the junction

between the inserted pAK36 and the S. gordonii chromosome.Nucleotide sequence determination and genetic loci identification. The PCR

products were purified using the QIAquick PCR purification kit (QIAGEN). The

purified PCR products were sequenced using the oriInt primer at the Advanced

Genetic Analysis Center, University of Minnesota. The sequences were com-

pared with the GenBank database using the BLAST program. The DNA se-

quence data that matched genes encoding the utilization of beta-glucoside sugars

from our previous IVET study (15) and those from the present study were used

for BLAST analysis against the partially completed S. gordonii genome (The

Institute for Genomic Research [TIGR]; www.tigr.org). In case complete se-

quence data were not available for a certain locus, the inverse PCR technique

(26) was used to complete the sequence data.

Phylogenetic analysis. From their nucleotide sequences, genes in S. gordonii

beta-glucoside regulons were translated into putative proteins. Protein sequences

of other bacterial species were obtained from GenBank via a BLAST search. The

sequences were aligned using the CLUSTAL X program (version 1.81; http://inn

-prot.weizmann.ac.il/software/ClustalX.html) (41), and phylogenetic trees wereconstructed with the TreeExplorer program (http://evolgen.biol.metro-u.ac.jp

/TE/TE_man.html). Bootstrap values were obtained with the CLUSTAL X pro-

gram.

Mutant construction and analysis. Mutants were constructed by two methods.

All mutants except CG495 were constructed by insertion duplication using a

streptococcal integration plasmid, pVA891 or pSF151 (38). Strain CG495 was

constructed by gene replacement to delete the target gene(s). To delete the

target genes, the flanking genes, fucA and bglJ, of the target S. gordonii gom locus

were amplified by PCR and cloned jointly into PCR cloning vector pGEMT-Easy

(Promega). Next, an erythromycin resistance cassette derived from the strepto-

coccal shuttle plasmid pVA838 (21) was inserted into the fucA-bglJ joint gene

fragment, replacing parts of both genes. The recombinant gene cassette was then

excised by restriction enzyme digestion. Following gel puri fication, the excised

recombinant gene cassette was used to transform S. gordonii V288 to erythro-

mycin resistance. The gene insertion or deletion in each mutant was con firmed

by PCR with appropriate primers.Sugar fermentation. Mid-exponential-phase cells growing in THB with appro-

priate antibiotics were harvested by centrifugation, washed once, and then re-

suspended in purple broth supplemented with a sugar and antibiotics. Sugars (all

from Sigma or as noted) tested for fermentation included glucose, fructose,

galactose, lactose, maltose, mannose, cellobiose, arbutin, salicin, and esculin and

chitin oligosaccharides [(GlcNAc)n; n 2 to 8], N,N,N-triacetyl chitotriose,

1-2, 1-3, or 1-6 D-mannobiose, 1-3-1-6-D-mannopentose, Lewis-X oligosac-

charide, GlcNAc-1-2 mannose (Dextra), heparin, chondroitin sulfate, and li-

chenan. The cultures were incubated at 37C, and color changes were monitored

hourly. To assay for esculin hydrolysis, mid-exponential-phase cultures of the

wild-type strain and mutants were spotted onto ferrous salt-containing agar and

incubated for 24 h. A black color forms from the hydrolysis product of esculin,

6,7-dihydroxycoumarin, which reacts with the ferrous ion. To analyze for glucose-

mediated catabolite repression, the ferrous medium was supplemented with

glucose.

TABLE 1. S. gordonii strains used in the study

StrainRelevant

characteristicsIsolationmethod

Source orreference

V288 Wild type Gary DunnyKG212 bglC-amy-cat Tcr IVET 15KG206 escB1-amy-cat Tcr IVET 15KG207 escR-amy-cat Tcr IVET 15

KG210 escA-amy-cat Tcr IVET 15KG202 gomA-amy-cat Tcr IVET 15KG205 iviE-amy-cat IVET 15KG208 iviH-amy-cat IVET 15KG211 msrA-amy-cat IVET 15MG1006 bfbF1-amy-cat Tcr Biofilm This studyMG1007 bfbB-amy-cat Tcr Biofilm This studyMG1021 escB2-amy-cat Tcr Biofilm This studyMG1015 bfrA-amy-cat Tcr Biofilm This studyMG2025 bfbF2-amy-cat Tcr Biofilm on sHA This studyMG2026 bfbR-amy-cat Tcr Biofilm on sHA This studyCG420 escA Emr Insertion This studyCG425 escA Kmr Insertion This studyCG421 escP Emr Insertion This studyCG426 escP Kmr Insertion This studyCG422 gomG Emr Insertion This study

CG423 bglJ Emr

Insertion This studyCG427 gomF Emr Insertion This studyCG480 fucA Emr Insertion This studyCG482 manB Emr Insertion This studyCG484 gomH Emr Insertion This studyCG486 gomR Emr Insertion This studyCG495 gom Emr Deletion This studyCG532 merA-amy-cat Tcr Esculin-negative This study

VOL. 186, 2004 S. GORDONII BETA-GLUCOSIDE METABOLISM 4247


3/8

Biofilm and sHA adhesion assays. Mutants and previously isolated IVET

clones were analyzed for their abilities to form biofilms on microtiter plates asdescribed above. For the sHA adhesion assay, bacteria were cultured overnight

(16 to 18 h) in 3 ml of FMC with [3H]thymidine (10 Ci/ml). Cells were

centrifuged and resuspended to a final optical density at 620 nm of 0.32 (109

cells/ml). Suspensions (1 ml) were added to tubes with sHA and rotated for 1 h

at room temperature. The sHA with bound bacteria was allowed to settle,

washed three times, and transferred to scintillation vials. Radioactivity associated

with sHA was counted with a scintillation counter. Triplicates of each sample

were analyzed. Statistical analysis was performed by using the two-tailed, un-

equal variance t test with comparisons between the values for the wild type and

each mutant.

Sugar induction assay. To analyze whether the expression of the genes en-

coding beta-glucoside metabolism and/or other genes induced during endocar-

ditis can be induced by any beta-glucoside sugars, strains with the pAK36 plasmidreporter gene fusion were tested on Jordan agar plates supplemented with 0.5%

starch and 0.5% cellobiose, arbutin, salicin, esculin, or oligochitosaccharide.

Mid-exponential-phase cultures in THB were diluted 10-fold with THB and

spotted (5 l) onto the starch agar plate. After incubation for 16 h, the plates

were flooded with the iodine solution to detect the expression of amylase. Thewild-type strain V288 was used as a control.

RESULTS

Identification of genes and loci associated with the utiliza-

tion of beta-glucosides. By homology analysis, DNA sequencesof 5 (iviL [new name, bglC], iviJ[escA], iviF[escB], iviG [escR],and iviB [gomA]) of the 13 unique S. gordonii clones induced in

vivo during experimental endocarditis were found to be asso-

ciated with three separate genetic loci encoding the utilization

of beta-glucosides. Additional sequences of these loci were

obtained by searching the partially completed S. gordonii ge-

nome at the TIGR website. The sequence of the gom locus was

not completed by TIGR. Therefore, the inverse PCR tech-

nique was used to synthesize flanking DNA and obtain addi-tional sequences (accession number AY526569). Among 44

S. gordonii IVET clones with genes induced during biofilmformation on sHA, 11 had reporter gene insertions in two

genes of a new beta-glucoside locus (bfbF and bfbR). Among

35 mutants with genes required for biofilm formation on plas-

tic, 9 clones with six unique insertion sites were related tobeta-glucoside metabolism. Four of the unique insertion sites

were within the same locus as the sHA biofilm-associated

genes. The fifth insertion site matched one of the three loci

identified from the IVET studies on heart valves, and the sixthsite was associated with an isolated beta-glucosidase gene.

Therefore, biofilm formation by S. gordonii in different envi-ronments appeared to involve as many as four putative regu-

lons for the utilization of beta-glucoside-like sugars (Fig. 1).

A mutant, CG532, defective in esculin, arbutin, and salicin

fermentation was isolated from the S. gordonii pAK36 plasmid

insertion strain library. Its target gene was sequenced using the

Amy-R primer. The genetic locus was identified from the S.

FIG. 1. Genetic loci encoding beta-glucoside metabolism in S. gordonii. Shown are genes induced specifically in the rabbit heart duringexperimental endocarditis (15), genes induced during biofilm formation on sHA, and genes required for in vitro biofilm formation on plastic,indicated by diamonds, triangles, and circles, respectively. The star indicates the gene induced by shifting S. gordonii from mildly acidic (oral) toneutral (blood) pH (42). The small bending arrows represent promoter-like sequences. U, overlapping reading frames.

4248 KILIC ET AL. J. BACTERIOL.


4/8

gordonii genome and showed high homology to the mercuryresistance gene (merA) of many bacteria.

Nucleotide sequence analysis. (i) The bgllocus. The bgl locusincludes five open reading frames (ORFs). The first two ORFs,separated by 14 nucleotides, encode two putative transcrip-tional regulators, BglD (249 amino acids [aa]) and BglE(322 aa). The remaining three ORFs are highly homologousto genes encoding three components, BglA (107 aa), BglB(109 aa), and BglC (433 aa), of a PTS permease (enzyme II)for transporting beta-glucosides in Streptococcus pyogenes(Q8NZ66) and Streptococcus pneumoniae (Q97SS4). bglA is223 nucleotides downstream of bglE and has its own putativepromoter. The two downstream ORFs, bglB and bglC, areseparated by only 11 and 2 nucleotides, respectively, from theirimmediate upstream ORFs. However, a gene encoding a phos-pho-beta-glucosidase is not found in this locus.

(ii) The esc locus. The esc locus includes six ORFs. The firstORF encodes the PTS permease (enzyme II), EscP (629 aa),for transporting beta-glucosides. The second ORF encodes ahypothetical protein, EscB (420 aa), which is homologous to

the CapA protein associated with capsule synthesis ofStrepto-coccus agalactiae (Q8E4G0). The third and fourth ORFs en-code two conserved hypothetical proteins, EscC (75 aa) andEscD (55 aa). The fifth ORF, transcribed in the oppositedirection, encodes a protein EscR (186 aa) homologous to theStreptococcus mutans regulator BglC (Q9KJ78). The last ORF,escA, encodes a protein (478 aa) homologous to S. mutansphospho-beta-glucosidase BglA (Q9KJ76). These ORFs, ex-cept ORF4, have their own putative promoters. A putativeRNA antiterminator (RAT) sequence, GGATTGTTACTGATCACGCAGGCAAAAC CTA, is located 125 bases upstreamof the initiation codon for the escP gene. It matches the con-sensus sequence of RATs (5).

(iii) The bfb locus. The bfb locus includes seven ORFs. Thefirst ORF, bfbF, encodes a protein (488 aa) homologous toS. pneumoniae phospho-beta-glucosidase BglA (Q8DR89).The second ORF encodes a putative protein, BfbG (79 aa).The third ORF, bfbB, encodes the B subunit of a beta-glu-coside permease (106 aa; PTS enzyme IIB). The fourth ORF,bfbR, encodes a BglG-like antiterminator (656 aa). The fifthORF, bfbA, encodes the A subunit of a PTS enzyme II (105aa). The sixth ORF, bfbD, encodes a hypothetical protein (161aa), possibly the D subunit of the PTS enzyme II. The seventhORF, bfbC, encodes the C subunit of the PTS permease en-zyme II (451 aa) for transporting beta-glucosides.

(iv) The gom locus. The gom locus has 15 ORFs, includingfucA

(

-1,3/4 fucosidase; 576 aa),manA

(

-1,2-mannosidase;697 aa, in opposite orientation), gomA (hypothetical protein;435 aa), manB (-1,6 mannosidase; 877 aa), gomR (regulator;292 aa), bhsA (N-acetyl-beta-hexosaminidase; 627 aa), gomFand gomG (binding protein-dependent sugar transporter mem-brane components; 311 aa each), gomE (sugar-binding protein;515 aa), gomB (hypothetical protein; 204 aa), gomH (two-component sensor histidine kinase; 529 aa), gomD (two-com-ponent response regulator; 427 aa), bglJ(beta-glucosidase; 461aa), gomL (VirJ-like sensor histidine kinase; 176 aa), and glmS(glucosamine-6-P synthase; 603 aa). An ATP-binding proteinfor the ABC sugar transport cassette is not found in this locus.

(v) The bfr locus. Although the bgl locus does not have abeta-glucosidase, a gene encoding 6-phospho-beta-glucosidase

(BglF; 479 aa) was identified in a separate locus, the bfr locus.Immediately downstream ofbglFare two genes, bfrA and bfrB,encoding a biofilm-related two-component system (44).

Phylogenetic analysis. S. gordonii may use four differentsystems to metabolize beta-glucosides during biofilm forma-tion and/or in vivo growth. To determine their genetic similar-ities and relationships with related proteins of other bacterialspecies, phylogenetic trees were constructed (data not shown).S. gordonii BglJ is more homologous to beta-glucosidases ofS. pneumoniae (BglA2; Q8DRA9) and S. pyogenes (BglA2;Q8K735) than its three other beta-glucosidases, BglF, BfbF,and EscA. Likewise, S. gordonii EscP is more similar to BglP ofS. mutans than to its two other beta-glucoside permeases, BglCand BfbC, which contain three or four subunits. S. gordoniiEscB is highly homologous to capsule synthases of a range ofspecies and genera, including CapA ofS. agalactiae (Q8E4G0).

Phenotypes of various strains. In addition to the reportergene-fusion strains (some also created mutations by splittingtarget genes), insertion or deletion mutants were constructedto assign phenotypes to the genes located in these loci. When

sugar fermentation patterns were compared, the mutants weresimilar to the wild-type except for hydrolysis of two beta-glu-cosides, arbutin and salicin. Most mutants defective in onegene involved in beta-glucoside metabolism appeared to fer-ment these two sugars more slowly. The mutants and wild-typestrains, in contrast, fermented two other beta-glucoside sugars,esculin and cellobiose, similarly. Only two mutants, MG1015(bfr amy cat) and CG532 ( merA amy cat), were defective inarbutin, salicin, and esculin fermentation, suggesting suppres-sion of multiple beta-glucoside regulons in these mutants. Re-gardless of insertion sites, all 13 strains with pAK36 insertionsisolated by in vivo selections and about one-third of randomclones of the pAK36 library displayed glucose inhibition of

esculin hydrolysis, suggesting a possible artifact introduced bythe plasmid. Therefore, strains (all CG strains except CG532)constructed with pSF151 or pVA891 were used to test foresculin hydrolysis. The wild-type and the tested mutant strains,except CG423 (bglJ) and CG495 (gom), fermented esculin inthe presence of glucose.

The wild-type strain did not ferment 1-2- or 1-3-D-man-nobiose, 1-3-1-6-D-mannopentose, heparin, chondroitin sul-fate, or lichenan, but it fermented Lewis-X oligosaccharide,N,N,,N-triacetylchitotriose (chitin oligosaccharides), -1,6-D-mannobiose, and GlcNAc-1-2 mannose. All mutants ferment-ed Lewis-X oligosaccharide and chitin oligosaccharides. Mu-tants defective in manB, gomH, or gomR showed reduced

fermentation of GlcNAc-

1-2-D

-mannose and no fermentationof 1-6-D-mannobiose.To determine if selected genes were induced by any -glu-

coside sugars, -amylase activities of the reporter gene-fusedclones were detected in agar containing starch (Fig. 2). Basedon amylase reporter activities, cellobiose, arbutin, and salicindid not induce expression of any genes tested. Esculin andoligochitosaccharides induced genes in the esc system but notany of the other three systems for -glucoside metabolism.

Also, by testing other genes induced during endocarditis (15)or required for biofilm formation (44), four additional geneticloci were induced by the same two sugars. These were iviE(located upstream of dnaX), iviH (an amino acid transporter),iviK (msrA, peptide methionine sulfoxide reductase), and



5/8

bfrAB. Interestingly, mutants defective in these esculin-induc-ible genes showed iodophilic polysaccharide (IPS), as detectedon plates containing glucose and starch. IPS was not seen inthe wild type or strains with plasmid insertions in other beta-glucoside regulons. The escA (CG420 and CG425) and escP(CG421 and CG426) mutants constructed with plasmidspSF151 or pVA891 without the amy-cat reporter gene alsoshowed IPS on agar containing glucose and starch (data notshown). This ruled out the possibility that IPS accumulation inthese strains was an artifact introduced by the amy reporter

gene.To ascertain if genes in these loci were associated with func-

tions in vitro, adhesion to sHA, biofilm formation on plastic,and growth rates of these strains were analyzed in vitro (Table2). Mutation of many genes in these four presumptive regulonsresulted in decreased biofilm formation and/or growth rate.Remarkably, mutation in escA, escR, or gomHand deletion ofthe gom regulon resulted in cells with defective abilities toadhere to sHA in buffer. In some cases, these mutations wereaccompanied by defects in growth rate or in vitro biofilm for-mation (bglC and escA). Other genes associated with defectiveadhesion did not manifest defects in biofilm formation orgrowth rate (gomH and gom). While defective in adhesion,

the escR mutant formed biofilm and showed a growth ratesimilar to that of wild type. Mutation in escB2 showed noadhesion defect, but biofilm formation was substantially re-duced.

DISCUSSION

Several S. gordonii surface components probably mediateadhesion to the tooth surface, including sialic acid-bindingadhesin (37), amylase-binding protein (30), CshA/B (23),SspA/B (6), and ScaA (16). While genes for these adhesinproteins may contribute to colonization in vivo, none are wellestablished at this time. Recently described genes associated

with S. gordonii biofilm formation encode putative proteins

involved in signal transduction, peptidoglycan biosynthesis,

manganese homeostasis, and fructose PTS (1820). Further-more, S. gordonii cells forming biofilms in vivo on heart valves(15) or in vitro on sHA (17) induced genes associated with

beta-glucoside metabolism at unexpected frequencies.

To survive in vivo and colonize as a biofilm, S. gordonii mustseek a carbon source for growth. Available nutrients, especially

sugars, will differ from those found in laboratory growth media.

Due to variations in available sugars in nature, bacteria have

developed highly controlled sugar metabolism systems. If mul-

tiple sugars exist in the environment, bacteria would first con-sume primary sugars, such as glucose. When primary sugars

are exhausted or unavailable, bacteria induce genes for metab-

olizing secondary sugars (29), including beta-glucosides. Ex-

pression of these genes is often subject to carbon catabolite

repression by primary sugars (32). Exceptions exist. For exam-

ple, S. mutans has two systems to metabolize beta-glucoside

sugars (35). One system is inhibited by glucose, while theother is not.

Induced in vivo during experimental endocarditis (15) and in

vitro during biofilm formation on sHA (17), and also requiredfor biofilm formation on plastic microtiter plates (44), fournovel transport and metabolism systems for beta-glucosides

have been identified. Three are PTS, and the fourth is a bind-ing protein-dependent sugar uptake system for metabolizing

multiple sugars including beta-glucosides. Because each of

these systems consists of multiple transcriptional units, they

appear to organize and function as regulons, rather than oper-

ons.

The first putative regulon, bgl, has five genes in two tran-scriptional groups. The first group encodes two putative tran-scriptional regulators. The second group encodes three sub-

units of a PTS enzyme II permease. Since the bgl locus does

not have a beta-glucosidase gene, this gene may be at a sepa-

rate locus. The bfr locus has a gene encoding a beta-glucosi-

dase (BglF). Whether this gene is related to the bgl regulon is

FIG. 2. Esculin induction of reporter gene-fused S. gordonii strains. The reporter amylase activity was disclosed on starch agar platessupplemented with the sugars indicated after incubation with an iodine solution. (A) Esculin only; (B) esculin plus glucose; (C) glucose only. Theidentities and locations of these strains are as follows: top, KG202; second row (from left to right) KG206, KG207, KG210, and KG212; third row,MG1006, MG1007, MG2025, and MG2026. Note the esculin induction and glucose inhibition of amylase activities in the three mutant strains ofthe esc regulon, KG206, KG207, and KG210. Interestingly, these three strains presented diminishing amylase activities, as indicated by a dark coloron agar in the presence of glucose, suggesting the accumulation of IPS (35). These plates contained TET to maintain the inserted plasmid. The

wild-type strain V288 was on three separate plates without TET. Its results were the same as those for KG202 (data not shown).



6/8

unknown. The two different regulators may be responsible forcontrolling the two separate loci. bglC is induced in vivo during

experimental endocarditis (15), but it is not induced by any ofthe commercially available beta-glucoside sugars in vitro. Yet,inactivation ofbglC reduced the S. gordonii growth rate (Table2) and its ability to hydrolyze arbutin and salicin. Nonetheless,the reduction in adhesion to sHA and biofilm formation onplastic might be associated with its defective growth.

The second putative regulon, esc, which is induced by thebeta-glucoside esculin and oligochitosaccharides, includes sixgenes. Three genes encode proteins for transport (EscP), me-tabolism (EscA), and regulation (EscR) of a PTS. Althoughthe functions of the remaining three genes (escB, escC, andescD) are unknown, escB may encode a capsule (polygluta-mate) synthase, because it is homologous to the capA gene of

other bacteria, especially group B streptococci. Three genes ofthe regulon, escA, escR, and escB, are induced in vivo in theheart during experimental endocarditis (15) and also wereinduced in vitro by esculin and oligochitosaccharides (Fig. 2A).

Although repressed by glucose (Fig. 2B), induction was attrib-utable to the specific presence of esculin rather than the ab-sence of glucose in the esculin medium, because other beta-glucosides, cellobiose, salicin, and arbutin did not induce genesin this regulon. Hence, the sensor system shows considerablespecificity for esculin and mammalian cognate sugars.

When the wild-type S. gordonii strain grew in a glucose-containing medium, IPS accumulated (data not shown). En-dogenous amylase was induced when the cells were grown in amedium containing both glucose and starch, and IPS was not

seen (Fig. 2C). When mutants defective in esculin-induciblegenes were grown in the presence of glucose and starch, how-

ever, intracellular -amylase appeared to be repressed (35)and IPS accumulated in the cells (Fig. 2B and C). How thesegenes affect the accumulation of IPS in S. gordonii is unknown.In S. mutans, the accumulation of IPS is regulated by the cell

wall synthesis-associated dlt operon (36). Similarly, esculin-inducible genes may play a role in S. gordonii cell wall and/orsurface polysaccharide synthesis, because mutation in thesegenes caused defects in in vitro adhesion to sHA, biofilm for-mation on plastic, and/or the growth rate (Table 2).

The esc regulon may be highly conserved, because esc-likeregulons exist in many bacteria, including S. mutans (3). Incomparison with the S. mutans bgl (5), the S. gordonii esc alsohas a RAT site upstream of escP, but it does not have alicT-

like gene nearby. Moreover,escB

, the gene immediatelydownstream of escP, is not homologous to S. mutans bglB.Although both S. gordonii esc and S. mutans bgl are induced byesculin, the former is repressed by glucose while the latter isnot (4). It is unknown why esculin and oligochitosaccharidesalso induce several other genes, including msrA. Interestingly,

when S. gordonii is shifted from the oral pH (slightly acidic) toblood pH (neutral), both msrA and escR (previous name,SGp1224) are induced (42).

The third putative regulon, bfb, encodes proteins apparentlyinvolved in biofilm-associated beta-glucoside metabolism. Itincludes seven ORFs, which encode four subunits (BfbA, -B,-C, and -D) of a PTS enzyme II permease, a phospho-beta-glucosidase, and a bglG-like antiterminator. Although unin-

TABLE 2. Phenotypes of various S. gordonii beta-glucoside metabolism-related mutants

Strain (genotype)Physiological functiona Carbohydrate fermentationd Esculin hydrolysise Inductionf

Adhesion Biofilm Growth rate Arbutin Salicin Man2 GlcN-Man Glu Glu Esculin Chito

V288 (wild type) 100 100 100 KG212 (bglC-amy-cat) 72b 70 65 KG206 (escB1-amy-cat) 91 82 65

MG1021 (escB2-amy-cat) 95 47 107 KG207 (escR-amy-cat) 50b 98 112 KG210 (escA-amy-cat) 79b 78 109 MG1006 (bfbF1) 113 23 95 MG1007 (bfbB) 84 30 49 MG2025 (bfbF2-amy-cat) 70 59 55 MG2026 (bfbR-amy-cat) 75 69 103 CG422 (gomG) 88 101 103 CG423 (bglJ) 88 103 119 CG427 (gomF) 97 101 97 CG480 (fucA) 97 99 99 CG482 (manB) 81 99 104 CG484 (gomH) 60b 98 100 CG486 (gomR) 108 96 102 CG495 (gom) 67c 101 114 CG532 (merR-amy-cat) 58 97 116

MG1015 (bfrA-amy-cat) 36 65 87 aAs percentage of the wild-type activity. Each value represents the average of three sample measurements. Note: several strains showed significant growth reduction,

which may have proportionally affected their adhesion and/or biofilm formation. The phenotypes of three mutants, MG2026 (bfbR), CG427 (gomF), and CG486 (gomR),might have polar effects on their downstream genes (Fig. 1).

bP 0.05.cP 0.001.d Fermentation of all other sugars tested, including cellobiose, was not different from that of the wild type. Fermentation results of the four listed sugars are shown.

Man2, -1,6-D-mannobiose; GlcN-Man, GlcNAc-1-2 mannose. , , and indicate strong, medium, and weak positive results; indicates a negative result.e Esculin hydrolysis was detected on the esculin ferrous salt agar with or without glucose (Glu).f Induction was performed on agar plates with 0.5% starch for detection of expression of the in-frame fused amy gene. Only strains constructed with the reporter

gene-fusion plasmid, pAK36, were tested. In addition to the five strains induced by esculin and chitin oligosaccharides, three additional strains from our previous study(15), KG205 (iviE-amy-cat), KG208 (iviH-amy-cat), and KG211 (msrA-amy-cat), were also induced by the same two sugars.



7/8

duced in vivo during experimental endocarditis, this regulon was induced during in vitro S. gordonii biofilm formation onsHA. As expected, mutants with mutations in several bfb genesshowed reduced biofilm formation on plastic in vitro. Likewise,a fructose PTS operon has been recently linked to S. gordoniibiofilm formation (20).

The fourth putative regulon, gom, is for glycoprotein-derivedoligosaccharide metabolism. It includes 15 genes encoding abinding protein-dependent sugar transport module, a two-com-ponent system, a regulator, and fi ve sugar-degrading enzymes(a fucosidase, two mannosidases, an N-acetyl-beta-hexosamini-dase, and a beta-glucosidase). The regulon may encode a bind-ing protein-dependent system for transport and the metabo-lism of multiple sugars, like the msm system in S. mutans (31,39). However, an msmK-like gene encoding an ATP-bindingprotein is absent in the gom locus. It may be located elsewhere,as is the case in Streptococcus equisimilis (24). Since the sub-strate sugars, such as fucosides, mannosides, N-acetyl-beta-hexosamines, and beta-glucosides, are commonly found inmammalian glycoprotein-derived oligosaccharides, it is not

surprising that this regulon was induced only in vivo in therabbit and not under in vitro growth conditions. Due to thepresence of a two-component regulatory system, gomH andgomI, expression of the gom regulon may also be more sensi-tive to environmental changes than other binding protein-de-pendent sugar metabolism systems, such as the S. mutans msmoperon (39). The gomA gene was expressed in vivo and was aninsertion site of the IVET plasmid pAK36, but its function iscurrently unknown. Mutants defective in manB, gomH, or gomRshowed reduced or negative fermentation of GlcNAc-1-2-mannose and 1-6-D-mannobiose, but the wild-type strain fer-mented both disaccharides. Hence GlcNAc-1-2-mannose and1-6-D-mannobiose may be substrates of gom, which may be

the sole system for hydrolysis of the latter.Controlling expression of the gom regulon, gomR may en-

code a positive transcriptional regulator, and gomH and gomImay encode a two-component system. Both gomR and gomHare downstream of manB (1-6 mannosidase), and the gomRand gomH mutants were defective in fermentation of 1-6-D-mannobiose. This suggested that the gom regulon for themetabolism of 1-6-D-mannobiose was under the control ofthe two-component system. Moreover, the gom regulon mayalso control, in part, cell wall biosynthesis, since it containsglmS, which encodes glucosamine-6-phosphate synthase (9). Itcatalyzes the first step of N-acetylglucosamine biosynthesis,providing a critical constituent for cell wall peptidoglycan. AglmS-

related gene,glmM

(phosphoglucosamine mutase), inS. gordonii has been associated with the biofilm phenotype(18). Since the gom locus deletion, gomH, and manB mutantsshowed reduced adhesion to sHA (Table 2), the putative gomregulon may contribute to the integrity of the cell wall and thefidelity of expression of surface adhesin molecules.

Except for the gom regulon, pathways for beta-glucosidemetabolism in S. gordonii may be inhibited by the presence ofthe catabolite, glucose. In the presence of glucose, esculin hy-drolysis was repressed in the gom deletion mutant (data notshown). Therefore, other pathways for beta-glucoside metab-olism appear to be sensitive to catabolite repression by glucose.

A post hoc analysis, however, shows that about one-third of thereporter gene-fusion strains constructed by random-site pAK36

insertion showed complete glucose-mediated catabolite re-pression. The reporter amy gene fused in frame with any genemay enable the expressed amylase to hydrolyze intracellularglycogen to release glucose (35). The internally released glu-cose may in turn repress beta-glucoside regulons. This explains

why all amy-cat report gene-fusion strains isolated by induction(KG201 to -213) displayed glucose-mediated inhibition of es-culin hydrolysis, while strains isolated due to defects in bio filmformation (MG1006 and MG1007) did not, probably becausethe reporter amy gene in these mutants was inserted off frameand thus was not expressed (Table 2). Since wild-type S. gor-donii showed esculin hydrolysis in the presence of glucose, atleast one regulon, gom, is not subject to catabolite repressionby glucose. Internally released glucose also appears to be apotent catabolite repressor. It can repress multiple regulonsfor beta-glucoside metabolism. Arbutin and esculin were notfermented by the amy-cat reporter gene-fusion strains,MG1015 (bfr) and CG532 (merA), in the presence or absenceof glucose. In wild-type cells, therefore, conditions favoringhydrolysis of stored polysaccharides may promote strong ca-

tabolite repression of several beta-glucoside regulons as animportant mechanism for survival during sugar starvation.

Based on currently available genomic data published byTIGR, S. gordonii has four different beta-glucosidases. Phylo-genetic analysis showed that the S. gordonii beta-glucosidasesof the three PTS are related, but the one in the gom regulon,bglJ, is relatively different. The four different beta-glucosidasesdo differ more in amino acid sequences from one another,however, than from their respective homologues in other spe-cies, reflecting different conserved functions and substratespecificities. Because mammalian-derived beta-glucosides areunknown, we tested multiple commercially available beta-glu-coside sugars, cellobiose, arbutin, salicin, esculin, and oligochi-

tosaccharides, to identify possible preferred substrates for eachsystem. Only the esc regulon was induced by esculin and oli-gochitosaccharides. The several beta-glucoside-related genesexpressed specifically in vivo may require natural substratesthat are embedded in the mammalian oligosaccharides on theheart valve. Interestingly, the bfb genes were not induced in

vivo but were induced during biofilm formation on sHA. Thissuggested that bfb may have a different function from the threeother regulons. Since Streptococcus exopolysaccharide has be-ta-linked repeating disaccharides (7, 43) and its capsule resem-bles a typical GAG, hyaluronan (34), the expression of thesegenes in S. gordonii may be needed for the synthesis, remod-eling, and/or recycling of cell surface adhesins (glycoproteins)

and/or capsule-like polysaccharides.The amy gene as a reporter might have introduced artifactdue to possible amylase degradation of intracellular glycogen.There might be still-other-undetected artifacts, but the isola-tion of beta-glucoside genes could not be attributed to one ofthem because both the in vivo and in vitro selections were doneby the induction of cat gene expression (chloramphenicol re-sistance). Moreover, Gahan and Hill (10), using listerolysin asan IVET reporter, have also identified an in vivo-induced geneencoding beta-glucoside permease in Listeria.

In summary, four different beta-glucoside metabolic systemshave been identified in S. gordonii. These systems are inducedin vivo and/or contribute to in vitro adhesion and biofilm for-mation. Not only could they metabolize sugars to provide en-



8/8

ergy and a carbon source for S. gordonii survival in the host, butalso they may be involved in other physiological processes,such as the synthesis of cell surface glycoproteins and/or poly-saccharides involved in adhesion and biofilm formation. Tounderstand their preferred substrates and potential roles instreptococcal virulence, further studies of these systems will benecessary.

ACKNOWLEDGMENTS

This work was supported by U.S. Public Health Service grantsDE08590 and DE11400.

We thank TIGR for its publication of the partially completedS. gordonii genomic sequence.

REFERENCES

1. Baddour, L. M. 1994. Virulence factors among gram-positive bacteria inexperimental endocarditis. Infect. Immun. 62:21432148.

2. Caetano-Anolles, G. 1993. Amplifying DNA with arbitrary oligonucleotideprimers. PCR Methods Appl. 3:8594.

3. Cote, C. K., D. Cvitkovitch, A. S. Bleiweis, and A. L. Honeyman. 2000. Anovel beta-glucoside-specific PTS locus form Streptococcus mutans that is notinhibited by glucose. Microbiology 146:15551563.

4. Cote, C. K., and A. L. Honeyman. 2002. The transcriptional regulation of the

Streptococcus mutans bgl regulon. Oral Microbiol. Immunol. 17:18.5. Cote, C. K., and A. L. Honeyman. 2003. The LicT protein acts as both a

positive and a negative regulator of loci within the bgl regulon of Strepto- coccus mutans. Microbiology 149:13331340.

6. Demuth, D. R., Y. Duan, W. Brooks, A. R. Holmes, R. McNab, and H. F.Jenkinson. 1996. Tandem genes encode cell-surface polypeptides SspA andSspB which mediate adhesion of the oral bacterium Streptococcus gordonii tohuman and bacterial receptors. Mol. Microbiol. 20:403413.

7. Deng, L., D. L. Kasper, T. P. Krick, and M. R. Wessels. 2000. Character-ization of the linkage between the type III capsular polysaccharide and thebacterial cell wall of group B Streptococcus. J. Biol. Chem. 275:74977504.

8. Durack, D. T. 1995. Prevention of infective endocarditis. N. Engl. J. Med.332:3844.

9. Fernandez-Herrero, L. A., M. A. Badet-Denisot, B. Badet, and J. Berenguer.1995. glmS of Thermus thermophilus HB8: an essential gene for cell-wallsynthesis identified immediately upstream of the S-layer gene. Mol. Micro-biol. 17:112.

10. Gahan, C. G., and C. Hill. 2000. The use of listeriolysin to identify in vivo

induced genes in the gram-positive intracellular pathogen Listeria monocy-togenes. Mol. Microbiol. 36:498507.

11. Gong, K., L. Mailloux, and M. C. Herzberg. 2000. Salivary film expresses acomplex, macromolecular binding site for Streptococcus sanguis. J. Biol.Chem. 275:89708974.

12. Herzberg, M. C. 1996. Platelet-streptococcal interactions in endocarditis.Crit. Rev. Oral Biol. Med. 7:222236.

13. Jordan, H. V., R. J. Fitzgerald, and A. E. Bowler. 1960. Inhibition of exper-imental caries by sodium metabisulfite and its effect on the growth andmetabolism of selected bacteria. J. Dent. Res. 39:116123.

14. Keyhani, N. O., and S. Rosemann. 1997. Wild-type Escherichia coli grows onthe chitin disaccharide, N,N-diacetylchitobiose, by expressing the celoperon. Proc. Natl. Acad. Sci. USA 94:1436714371.

15. Kilic, A. O., M. C. Herzberg, M. W. Meyer, X. Zhao, and L. Tao. 1999.Streptococcal reporter gene-fusion vector for identification of in vivo ex-pressed genes. Plasmid 42:6772.

16. Kolenbrander, P. E., R. N. Andersen, and N. Ganeshkumar. 1994. Nucleo-tide sequence of the Streptococcus gordonii PK488 coaggregation adhesin

gene, scaA, and ATP-binding cassette. Infect. Immun. 62:44694480.17. Lei, Y., Y. Zhang, A. O. Kilic, and M. C. Herzberg. 2002. Streptococcusgordonii gene expression during adhesion and biofilm formation in an in vitromodel. J. Dent. Res. 81(Spec. Iss. A):A117.

18. Loo, C. Y., D. A. Corliss, and N. Ganeshkumar. 2000. Streptococcus gordoniibiofilm formation: identification of genes that code for biofilm phenotypes.J. Bacteriol. 182:13741382.

19. Loo, C. Y., K. Mitrakul, I. B. Voss, C. V. Hughes, and N. Ganeshkumar.2003. Involvement of the adc operon and manganese homeostasis in Strep-tococcus gordonii biofilm formation. J. Bacteriol. 185:28872900.

20. Loo, C. Y., K. Mitrakul, I. B. Voss, C. V. Hughes, and N. Ganeshkumar.

2003. Involvement of an inducible fructose phosphotransferase operon inStreptococcus gordonii biofilm formation. J. Bacteriol. 185:62416254.

21. Macrina, F. L., R. P. Evans, J. A. Tobian, D. L. Hartley, D. B. Clewell, andK. R. Jones. 1983. Novel shuttle plasmid vehicles for Escherichia-Streptococ-cus transgeneric cloning. Gene 25:145150.

22. Masuda, H. 1984. The preparation of heparan sulfate from the mitral valveof the human heart. Int. J. Biochem. 16:99103.

23. McNab, R., H. Forbes, P. S. Handley, D. M. Loach, G. W. Tannock, and H. F.Jenkinson. 1999. Cell wall-anchored CshA polypeptide (259 kilodaltons) in

Streptococcus gordonii forms surface fibrils that confer hydrophobic andadhesive properties. J. Bacteriol. 181:30873095.

24. Mechold, U., K. Steiner, S. Vettermann, and H. Malke. 1993. Genetic orga-nization of the streptokinase region of the Streptococcus equisimilis H46Achromosome. Mol. Gen. Genet. 241:129140.

25. Nyvad, B., and M. Kilian. 1990. Comparison of the initial streptococcalmicroflora on dental enamel in caries-active and in caries-inactive individu-als. Caries Res. 24:267272.

26. Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of aninverse polymerase chain reaction. Genetics 120:621623.

27. OToole, G. A., and R. Kolter. 1998. Flagellar and twitching motility arenecessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol.30:295304.

28. OToole, G. A., L. A. Pratt, P. I. Watnick, D. K. Newman, V. B. Weaver, andR. Kolter. 1999. Genetic approaches to study of biofilms. Methods Enzymol.310:91109.

29. Pardee, A. B., F. Jacob, and J. Monod. 1959. The genetic control andcytoplasmic expression of inducibility in the synthesis of -galactosidase by

E. coli. J. Mol. Biol. 1:165178.30. Rogers, J. D., R. J. Palmer, Jr., P. E. Kolenbrander, and F. A. Scannapieco.

2001. Role ofStreptococcus gordonii amylase-binding protein A in adhesionto hydroxyapatite, starch metabolism, and biofilm formation. Infect. Immun.69:70467056.

31. Russell, R. R., J. Aduse-Opoku., I. C. Sutcliffe, L. Tao, and J. J. Ferretti.1992. A binding protein-dependent transport system in Streptococcus mutansresponsible for multiple sugar metabolism. J. Biol. Chem. 267:46314637.

32. Saier, M. H. Jr., S. Chauvaux, G. M. Cook, J. Deutscher, I. T. Paulsen, J.Reizer, and J. J. Ye. 1996. Catabolite repression and inducer control ingram-positive bacteria. Microbiology 142:217230.

33. Sarphie, T. G. 1985. Anionic surface properties of aortic and mitral valveendothelium from New Zealand White rabbits. Am. J. Anat. 174:145160.

34. Scott, J. E., A. M. Thomlinson, and P. Prehm. 2003. Supramolecular orga-nization in streptococcal pericellular capsules is based on hyaluronan tertiarystructures. Exp. Cell Res. 285:18.

35. Simpson, C. L., and R. R. Russell. 1998. Intracellular alpha-amylase ofStreptococcus mutans. J. Bacteriol. 180:47114717.

36. Spatafora, G. A., M. Sheets, R. June, D. Luyimbazi, K. Howard, R. Hulbert,D. Barnard, M. Janne, and M. C. Hudson. 1999. Regulated expression of theStreptococcus mutans dlt genes correlates with intracellular polysaccharideaccumulation. J. Bacteriol. 181:23632372.

37. Takahashi, Y., K. Konishi, J. O. Cisar, and M. Yoshikawa. 2002. Identifi-cation and characterization ofhsa, the gene encoding the sialic acid-bindingadhesin of Streptococcus gordonii DL1. Infect. Immun. 70:12091218.

38. Tao, L. 1998. Streptococcal-integration vectors for gene inactivation andcloning. Methods Cell Sci. 20:5964.

39. Tao, L., I. C. Sutcliffe, R. R. Russell, and J. J. Ferretti. 1993. Cloning andexpression of the multiple sugar metabolism (msm) operon ofStreptococcusmutans in heterologous streptococcal hosts. Infect. Immun. 61:11211125.

40. Terleckyj, B., N. P. Willett, and G. D. Shockman. 1975. Growth of severalcariogenic strains of oral streptococci in a chemically defined medium. In-fect. Immun. 11:649655.

41. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position specific gap penalties and weight matrix choice.

Nucleic Acids Res. 22:46734680.42. Vriesema, A. J., J. Dankert, and S. A. Zaat. 2000. A shift from oral to bloodpH is a stimulus for adaptive gene expression of Streptococcus gordonii CH1and induces protection against oxidative stress and enhanced bacterialgrowth by expression of msrA. Infect. Immun. 68:10611068.

43. Xu, D. Q., J. Thompson, and J. O. Cisar. 2003. Genetic loci for coaggrega-tion receptor polysaccharide biosynthesis in Streptococcus gordonii 38. J. Bac-teriol. 185:54195430.

44. Zhang, Y., Y. Lei, A. Khammanivong, and M. C. Herzberg. 2004. Identifi-cation of a novel two-component system in Streptococcus gordonii V288involved in biofilm formation. Infect. Immun. 72:34893494.


beta glucosie metabolism

Documents