BAF is a cytosolic DNA sensor that leads to exogenousDNA avoiding autophagyShouhei Kobayashia, Takako Koujina, Tomoko Kojidania,b, Hiroko Osakadaa, Chie Moria, Yasushi Hiraokaa,c,d,and Tokuko Haraguchia,c,d,1

aAdvanced ICT Research Institute Kobe, National Institute of Information and Communications Technology, Nishi-ku, Kobe 651-2492, Japan; bLaboratory ofElectron Microscopy, Faculty of Science, Japan Women’s University, Bunkyo-ku, Tokyo 112-8681, Japan; cGraduate School of Frontier Biosciences, OsakaUniversity, Suita, Osaka 565-0871, Japan; and dGraduate School of Science, Osaka University, Toyonaka 560-0043, Japan

Edited by Jennifer Lippincott-Schwartz, National Institutes of Health, Bethesda, MD, and approved April 28, 2015 (received for review January 20, 2015)

Knowledge of the mechanisms by which a cell detects exogenousDNA is important for controlling pathogen infection, because mostpathogens entail the presence of exogenous DNA in the cytosol, aswell as for understanding the cell’s response to artificially trans-fected DNA. The cellular response to pathogen invasion has beenwell studied. However, spatiotemporal information of the cellularresponse immediately after exogenous double-stranded DNA(dsDNA) appears in the cytosol is lacking, in part because of diffi-culties in monitoring when exogenous dsDNA enters the cytosol ofthe cell. We have recently developed a method to monitor endo-some breakdown around exogenous materials using transfectionreagent-coated polystyrene beads incorporated into living humancells as the objective for microscopic observations. In the presentstudy, using dsDNA-coated polystyrene beads (DNA-beads) incor-porated into living cells, we show that barrier-to-autointegrationfactor (BAF) bound to exogenous dsDNA immediately after itsappearance in the cytosol at endosome breakdown. The BAF+

DNA-beads then assembled a nuclear envelope (NE)-like mem-brane and avoided autophagy that targeted the remnants of theendosome membranes. Knockdown of BAF caused a significantdecrease in the assembly of NE-like membranes and increasedthe formation of autophagic membranes around the DNA-beads,suggesting that BAF-mediated assembly of NE-like membraneswas required for the DNA-beads to evade autophagy. Importantly,BAF-bound beads without dsDNA also assembled NE-like mem-branes and avoided autophagy. We propose a new role for BAF:remodeling intracellular membranes upon detection of dsDNA inmammalian cells.

barrier-to-autointegration factor | DNA-bead | autophagy |nuclear envelope | DNA sensor

Pathogen invasion, such as viral and bacterial infection, causesserious problems in living organisms, including humans. Cell

invasion by several pathogens results in the presence of exoge-nous double-stranded DNA (dsDNA) in the cytoplasm. For ex-ample, vaccinia virus, a member of the poxvirus family, replicatesits genomic dsDNA in the cytoplasm of the host cell (1). In RNAvirus infection, dsDNA generated by reverse-transcription of viralgenomic RNA exists in the cytoplasmic fraction as preintegrationcomplexes that are required for integration of the dsDNA into thehost genome (2, 3). In Listeria infection of macrophages, bacterialdsDNAs released into the cytosol of macrophage cells during bac-teriolysis are recognized by the host cell and trigger inflammasomeactivation and cell death (4). Thus, understanding the mechanismsby which intracellular systems detect exogenous dsDNA in thecytosol is important for controlling pathogen infections.Barrier-to-autointegration factor (BAF) is a conserved multi-

functional protein involved in retrovirus infection (5–7) as well asin nuclear envelope (NE) assembly during mitosis (8–10). BAFbinds sequence nonspecifically to dsDNA in vitro (11) and existsboth in the cytoplasm and in the nucleus in various cell types (12).In retrovirus infection, BAF forms preintegration complexes withthe viral dsDNAmade by reverse transcription in the cytoplasm of

infected cells (7). Based on these facts, it is assumed that BAF ishijacked by retroviruses to effect their infectivity (13). In con-trast, in poxvirus infection, BAF acts as a potent inhibitor ofvirus replication unless its DNA-binding activity is blocked byB1-kinase–mediated phosphorylation (14). The differences ofBAF function in these virus infection processes prompted us tohypothesize that BAF has roles in controlling the fate of exog-enous DNA after it is detected in the cytosol of the cell.We have recently reported a method to monitor endosome

breakdown around transfection reagent-coated polystyrene beads(15). In the present study, we studied cellular responses againstexogenous DNA using dsDNA-coated polystyrene beads (DNA-beads) that were incorporated into living human cells and showthat BAF is a DNA sensor that can avert autophagy of the targetDNA. BAF detects exogenous dsDNA immediately after its ap-pearance at broken endosomes and BAF+ DNA-beads assembleNE-like membranes around them, which may be competitive withsequestration by autophagic membranes. The function of BAFfound in this study provides new insights into the mechanisms bywhich a mammalian cell detects exogenous DNA and responds toit by remodeling intracellular membranes.

ResultsBAF Binds to Exogenous dsDNA Immediately After Endosome Breakdown.To understand how a cell responds to exogenous dsDNA in thecytosol, we developed an experimental system in which dsDNA-bound polystyrene beads (Fig. 1 A and B) (designated “DNA-beads”) are incorporated into HeLa cells expressing GFP-fusedBAF (HeLa/GFP-BAF). DNA-beads were incorporated into

Significance

Rapid detection of invasion of exogenous materials and sub-sequent responses are important for living organisms to survivehazards, such as pathogen infection. Understanding cellular re-sponses against exogenous DNA provides clues not only forcontrolling pathogen infections that bring exogenous DNA intohost cells, but also for designing efficient DNA delivery vectorsfor transgene expression. Here, by monitoring the invasion ofexogenous DNA-coated polystyrene beads into living cells, weshow that barrier-to-autointegration factor detects exogenousDNA immediately after its appearance at endosome breakdownand plays a role in DNA avoiding autophagy. These findingsprovide new insights into the mechanisms by which a cell de-tects and responds to exogenous double-stranded DNA.

Author contributions: S.K., Y.H., and T.H. designed research; S.K., T. Koujin, T. Kojidani,H.O., and C.M. performed research; and S.K., Y.H., and T.H. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Freely available online through the PNAS open access option.1To whom correspondence should be addressed. Email: tokuko@nict.go.jp.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1501235112/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1501235112 PNAS Early Edition | 1 of 6

CELL

BIOLO

GY

HeLa/GFP-BAF cells together with pHrodo, a pH-sensitive fluo-rescent dye, as an indicator of endosome breakdown (15), throughendocytosis using standard transfection reagents. The DNA-beadsinitially became pHrodo-fluorescence–positive and then lost theirfluorescence (Fig. 1C, panels from 0 to 1 min of pHrodo; also seeMovie S1), indicating that the beads were first present in theendosomes and then moved into the cytosol as a result of endosomebreakdown. Immediately after entering the cytosol, a GFP-BAFsignal appeared at the bead (Fig. 1C, arrows). In contrast, no GFP-BAF signal was associated with the DNA-beads before the loss ofthe pHrodo-signal (Fig. 1C, −0.5 min) or with control-beads withoutDNA. These results suggest that BAF can bind to cytosolic DNAimmediately after partial breakdown of the endosome membranearound the beads.We next examined whether DNA-beads induce autophagy be-

cause autophagosomes assemble around uncoated polystyrene-beads after endosome breakdown (15). When DNA-beads wereincorporated into HeLa cells stably expressing GFP-LC3 (HeLa/GFP-LC3), a marker of the autophagosome (16), the beads becameboth BAF+ and GFP-LC3+ by 1 h (Fig. 1D). Interestingly, however,the beads lost their GFP-LC3 signal but retained their BAF signalat 4 h (Fig. 1D); the percentage of BAF+ beads that were positivefor GFP-LC3 decreased gradually from 45 ± 5% at 1 h to 24 ± 2%at 4 h (Fig. 1E). In contrast, when control beads without DNA wereused, the percentage of LC3+ beads increased from about 48 ± 10%at 1 h to 77 ± 7% at 4 h; the control beads were all BAF− because,as shown above, BAF doesn’t bind to beads without DNA. Theseresults suggest that DNA-beads can avoid autophagy.

BAF Is Required for DNA-Beads to Avoid Autophagy. To investigatethe role of BAF in averting autophagy, we performed knock-down experiments using RNAi. In BAF-specific siRNA (siBAF)(12) -treated cells, BAF was decreased to less than 10% of thelevel present in the control cells treated with luciferase siRNA(siControl) (Fig. 1F). In BAF-depleted cells, more than 66 ± 5%of the cytosolic DNA-beads were surrounded by LC3 signals at

2 h, whereas in control cells only about 26 ± 5% of the DNA-beads were LC3+ (Fig. 1 G and H). We also detected DNA onthe DNA-beads by staining with DAPI, a DNA-specific fluo-rescent dye. In BAF-depleted cells, 16 ± 11% of the total beadslost DNA at 4 h, whereas only 5 ± 4% of the beads lost DNA at4 h in the control cells (P = 0.14, t test). These results suggestthat BAF is required for DNA-beads to avoid autophagy.

NE-Like Membranes Form Around BAF+ DNA-Beads. We next de-termined the timing of assembly of BAF and LC3 by live-cellimaging-associated correlative light and electron microscopy(Live CLEM) (Materials and Methods) analyses of DNA-beadsin HeLa cells stably expressing mRFP-BAF and GFP-LC3.Time-lapse imaging revealed that mRFP-BAF associated withDNA-beads earlier than GFP-LC3 (Fig. S1A) and that the BAFsignal covered the surface of the beads, whereas the GFP-LC3signal was present in small, scattered patches (Fig. S1B). Thedifference in the time of association of BAF and LC3 with theDNA-beads was 3.2 ± 1.7 min on average (n = 14 beads). Atearlier time points (e.g., 1 min after endosome breakdown)when BAF, but not LC3, associated with the DNA-beads,double-membrane structures were frequently observed aroundthe DNA-bead (Fig. 2A, arrows in 1 and 2). These membraneswere sometimes continuous to the NE (Fig. 2A, magenta ar-row), suggesting that the origin of these membranes was mainlyNE or its continuous endoplasmic reticulum (ER) (17). Whenboth BAF and LC3 were associated with the DNA-beads (e.g.,4 min after endosome breakdown), both NE/ER-like mem-branes and isolation membranes were observed around thebeads (Fig. 2B, arrows and yellow arrowheads, respectively).Isolation membranes corresponding to GFP-LC3 signals werealmost always observed juxtaposed with a fragment of theendosome membrane (Fig. 2B, black arrowheads). At 1 h afterBAF association with the DNA-beads, the bead was envelopedby an NE/ER-like membrane without being sequestered by GFP-LC3+ membranes (Fig. 2C). These results suggest that rapid

GFP

-LC

3 po

sitiv

e be

ads

(% in

BA

F-po

sitiv

e be

ads)

BDAPI B.F.

ABiotin-dsDNA (linearized; 8 kbp)StreptavidinPolystyrene bead ( 2.8 μμm)

CGFP-BAF

pHrodo

Merged

0.5-0.5 min 1 1.5

B.F.

Enlarged180Overview (-0.5 min)

GFP-BAF/pHrodo/B.F.

0

D anti-BAF

1 h

4 h

DAPI GFP-LC3 Merged

0

60 50

20

40

10

30

Time (h)31 42

F

-tubulin-BAF - 10 k

- 50 k

H60

100

40

80

20 0

LC3-

posi

tive

bead

s

(% in

bea

ds in

the

cyto

sol)

E

siB

AF

siC

ontr

ol

G DAPI anti-BAF anti-LC3 Merged DAPI anti-BAF anti-LC3 Merged

Fig. 1. DNA-beads detected by cytosolic BAF avoid autophagy. (A) Diagram of a DNA-bead used in this study. (B) Fluorescence (Left) and bright-field(Right) images of DNA-beads fluorescently stained with DAPI. (Scale bar, 5 μm.) (C) Fluorescence images of DNA-beads incorporated into HeLa/GFP-BAFcells. The left “Overview” image represents a merged image at a single time point. Yellow dotted lines in the FM images represent the outline of the bead-incorporated cell. The right images represent time-lapse images of the bead boxed in the left “Overview” image. Time-lapse observation was carried outevery 0.5 min, as indicated (Movie S1). Zero minutes represents ∼3 h after removal of the unattached beads. Arrows and arrowheads indicate the timewhen GFP-BAF and pHrodo signals started to increase and decrease, respectively. (Scale bars, 5 μm.) (D) Indirect immunofluorescence staining of en-dogenous BAF around DNA-beads in HeLa/GFP-LC3 cells. BAF was stained with an anti-BAF antibody (PU38143). GFP-LC3 was observed by GFP fluorescence.Typical images of BAF+ beads at 1 h and at 4 h after removal of unattached beads are shown. [Scale bars, 10 μm (overview); 5 μm (enlarged).] (E ) Per-centages of BAF+ DNA-beads that were also GFP-LC3+. GFP-LC3 and BAF were detected at the indicated time points after removal of unattached beads. Thedata are the means of triplicate assays ± SD. At least 50 beads were tested in each experiment at each time point. (F) Western blotting of cell extracts fromsiBAF-treated or siControl-treated HeLa cells using anti-BAF (PU38143). α-Tubulin was also detected as a loading control. (G) Indirect immunofluorescencestaining of DNA-beads in HeLa cells treated with siRNA specific for BAF (siBAF) or luciferase (siControl). At 2 h after removal of unattached beads, cells werefixed and stained with anti-BAF antibody (PU38143), anti-LC3 antibody, and DAPI. [Scale bars, 20 μm (upper rows) and 5 μm (lower rows).] (H) Percentagesof cytosolic DNA-beads that were LC3+ in HeLa cells treated with siRNA specific for BAF (siBAF) or luciferase (siControl) at 2 h. The data are the means oftriplicate assays ± SD.

2 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1501235112 Kobayashi et al.

detection of DNA-beads by cytosolic BAF and subsequent for-mation of an NE/ER-like membrane around the beads may beimportant in the avoidance of autophagy by the DNA-beads.We next examined the origin of the NE/ER-like membranes that

formed around the DNA-beads in HeLa/GFP-BAF cells. Live-cellimaging-associated immunostaining showed that emerin, a nuclearmembrane protein (18), started to localize around the bead at 5 minafter the association of BAF with the bead, and that it completelyenveloped the bead within another 5–7 min (Fig. S2). Moreover,indirect immunofluorescence staining showed that more than 90%of the BAF+ DNA-beads were emerin-positive throughout the timeperiods tested (Fig. 2 D and E). Depletion of BAF by treating cellswith siBAF (Fig. S3) caused a significant decrease of emerin-posi-tive beads compared with the control cells treated with luciferasesiRNA (siControl) (Fig. S3), suggesting that BAF is required for theformation of emerin-containing NE-like membranes. Consideringthe ability of BAF to assemble emerin into the NE that reformsaround chromosomes at the end of mitosis (8)—thus protectingchromosomes from autophagy—these results support the proposi-tion that rapid detection of DNA-beads by cytosolic BAF, andsubsequent formation of emerin-containing NE-like membranesmay be important in averting autophagy.We also investigated the role of emerin in averting autophagy

because it is known that loss of emerin causes nucleophagy, anucleus-specific autophagy, in Emery-Dreifuss muscular dystro-phy patients who natively lack emerin (19). Depletion of emerinwith siEmerin in HeLa cells did not change the ratio of LC3+

beads compared with the control cell treated with luciferasesiRNA. This result suggests that emerin is not a critical factor inthe avoidance of autophagy. It is possible that other BAF-bind-ing NE proteins might be critical factors, but this remains tobe examined.

BAF, Not a Complex with dsDNA, Is Sufficient to Avoid Autophagy. Toexamine whether BAF itself, not a complex with dsDNA, is suffi-cient to allow the DNA-beads to avoid autophagy, we used anti-GFP antibody-conjugated polystyrene beads (anti–GFP-beads)to assemble GFP fusion proteins onto the beads (Fig. 3A).As expected, GFP-BAF accumulated onto anti–GFP-beads

incorporated into HeLa/GFP-BAF cells. Accumulation of GFP-BAF onto the beads was through interaction with anti-GFP an-tibodies on the beads (Fig. S4A) because no GFP-BAF signalwas associated with the beads without antibodies. In HeLa/GFP-BAF cells, the number of GFP-BAF+ anti–GFP-beads increasedwith time (Fig. S4B). Immunostaining revealed that emerin lo-calized around anti–GFP-beads in HeLa/GFP-BAF cells (Fig. 3B and C), but it did not localize around the anti–GFP-beads in thecontrol GFP-expressing HeLa (HeLa/GFP) cells. These observa-tions suggest that GFP-BAF rapidly accumulated around the anti–GFP-beads after endosome breakdown and that BAF-mediatedassembly of emerin-containing NE-like membranes occurredaround these anti–GFP-beads, analogous to the results with theDNA-beads described above.Live CLEM analyses revealed that when anti–GFP-beads were

incorporated into HeLa/GFP-BAF cells, NE-like membranesstarted to assemble around the GFP-BAF+ beads at the regionexposed to the cytosol at 5 min after GFP-BAF accumulationonto the bead (Fig. 3D, GFP-BAF, black arrows and arrow-heads), and over time the beads became enveloped by the NE-like membranes (Fig. 3E, GFP-BAF, black arrows). In contrast,in the control HeLa/GFP cells, no such membranes were ob-served associated with the beads (Fig. 3D, Control), whereasisolation membranes typical of autophagy were frequently ob-served (Fig. 3E, Control, magenta arrowheads). Time-courseimmunostaining also showed that the percentages of LC3+ beadsgreatly decreased over time, from 60% at 1 h to 3% at 4 h, inHeLa/GFP-BAF cells (Fig. 3F, GFP-BAF), but it remainedrelatively unchanged in the control HeLa/GFP cells (Fig. 3F,Control). Three other autophagy factors, p62 (20–22), ubiquitin(20–22), and UNC-51–like kinase-1 (ULK1) (23) were also vi-sualized. The percentages of the GFP-BAF+ beads that werepositive for p62 and ubiquitin beads also decreased slightly overtime, from ∼95% at 2 h to ∼80% at 4 h. In contrast, theautophagy upstream factor ULK1 did not assemble on the GFP-BAF-beads. These results suggest that although p62 and ubiquitincould recognize the endosome membrane fragments closely as-sociated with GFP-BAF-beads, this recognition was insufficientto target the BAF-conjugated beads to the autophagosome.

B1

2

24 m

in

Hoe

chst

GFP

- LC

3m

RFP

- B

AF

Mer

ged

1 h

Overview/DiagramC FM EM

Overview

D EDAPI

anti- BAF

anti- emerin Merged

Emer

in-p

ositi

ve D

NA

-bea

ds

(% o

f BA

F-po

sitiv

e

DN

A-b

eads

)

Time (h)

100

4060

0

80

20

31 42

FM EMEnlargedOverview

1

2

2

1 N

1 m

in

A

Hoe

chst

GFP

- LC

3m

RFP

- B

AF

Mer

ged

Hoe

chst

GFP

- LC

3m

RFP

- B

AF

Mer

ged

1

Diagram

Fig. 2. Formation of NE-like membranes around DNA-beads. (A–C) Live CLEM analyses of DNA-beads in HeLa/GFP-LC3/mRFP-BAF cells. Representative FMand EM images of the DNA-beads fixed at (A) 1 min, (B) 4 min, and (C) 1 h after the beads became GFP-BAF+. “Overview” image of the bead and an enlargedimage of the boxed region in the “Overview” are shown. “Diagram” panels are drawings of the “Enlarged” image. Black lines represent membranes. Arrowsand black arrowheads indicate NE-like/ER-like membranes (filled with red) that formed around the beads and fragments of endosome membranes, re-spectively. Yellow arrowheads indicate isolation membranes (filled with green) typical of autophagy. [Scale bars, 5 μm (FM), 1 μm (Overview in EM), and200 nm (Enlarged in EM).] (D) Indirect immunofluorescence staining using anti-BAF and anti-emerin antibodies. Representative fluorescence images of theDNA-beads in HeLa cells at 2 h after removal of unattached beads are shown. The lower panels show enlarged images of the boxed regions in the upperpanels. Blue, green, and red colors in the merged images represent DAPI, BAF and emerin, respectively. [Scale bars, 20 μm (Upper) or 5 μm (Lower).](E) Percentages of BAF+ DNA-beads that are also emerin-positive. BAF and emerin were stained at the indicated time points after removal of unattached beads.The data are the means of triplicate assays ± SD. At least 50 beads were examined in each experiment except for the results at 1 h; at 1 h, only 21 beads were BAF+

among 9,000 cells examined in a total of three experiments.

Kobayashi et al. PNAS Early Edition | 3 of 6

CELL

BIOLO

GY

Collectively, our results suggest that BAF is a critical factor in-volved in the avoidance of autophagy by DNA-beads.To eliminate the possibility of an artifact caused by polystyrene

beads, we performed microinjection analyses using dsDNA with-out beads. When circular dsDNA was microinjected into the cy-toplasm of HeLa/GFP-BAF cells, GFP-BAF accumulated at theinjected site immediately after microinjection (Fig. 4A). LiveCLEM analyses revealed that NE-like membranes, similar tothose that formed around the DNA-beads, appeared around theinjected dsDNA 10 min after injection [Fig. 4B, arrows in FM(fluorescence microscopy), and black lines in Diagram]. Similarresults were obtained when linearized dsDNA or circulardsDNA complexed with transfection reagents was microinjectedinto HeLa/GFP-BAF cells: BAF associated with the injectedDNA and the NE-like membranes formed around the BAF-associated DNA (Fig. S5). These results suggest that DNA is aneffector to assemble NE-like membranes through the function ofBAF. Notably, isolation membranes did not form around theinjected dsDNA, consistent with our previous data that autophagy

is not induced around exogenous materials introduced into thecytoplasm by a method that does not cause endosome breakdown(15). These results indicate that assembly of NE-like membranesaround exogenous DNA-beads, which starts during the first fewminutes after the appearance of the DNA-beads in the cytosol, isnot an artifact caused by the beads but a natural response inliving cells.

DiscussionThe present findings provide new insights into our knowledgeabout cellular responses to exogenous dsDNA, which have beenintensively discussed but remain debatable (24–26). Our resultshave demonstrated a new role for BAF, linking the detection ofexogenous dsDNA in the cytosol to intracellular membraneremodeling, including NE-like membrane formation around ex-ogenous dsDNA (Fig. S6). Intriguingly, this BAF-dependent NE-like membrane assembly protects the DNA from autophagy.Because BAF is known to act as a potent host defense in the cy-toplasm by suppressing DNA replication and viral gene expression

A B

DAPI GFP anti-emerin Merged

DAPI GFP-BAF anti-emerin Merged

GFP

-BA

FC

ontr

ol

HeLa/GFP-BAF (GFP-BAF)

HeLa/GFP (Control)

Incorporated by Effectene

Anti-GFP antibodyBead (φ 3 μm)

GFP-BAF

Anti-GFP-bead

GFP

604020

0

10080

Emer

in-p

ositi

ve

anti-

GFP

-bea

ds

(% o

f GFP

-pos

itive

bea

ds)C

FControl

1 2 43Time (h)

60

40

20

0

80GFP-BAF

LC3-

posi

tive

anti-

GFP

-bea

ds

(% in

GFP

-pos

itive

bea

ds)

D FM EM

5 m

inG

FP-B

AF

Con

trol

B

B

Overview Enlarged Diagram

1 h

BGFP

-BA

FC

ontr

ol

B

E FM EMOverview Enlarged Diagram

Fig. 3. BAF is sufficient for invading beads to avoid autophagy. (A) Schematic diagram of experimental procedures. The anti–GFP-beads were incorporatedinto HeLa/GFP-BAF or HeLa/GFP cells as a control. (B) Representative images of anti–GFP-beads in HeLa/GFP-BAF or control cells at 2 h after removal ofunattached beads. Endogenous emerin was stained with an anti-emerin antibody (ED1). Arrows and arrowheads indicate the position of emerin-positive oremerin-negative beads, respectively. (Scale bars, 10 μm.) (C) Percentages of emerin-positive anti–GFP-beads in B. The data are the means of triplicate assays ±SD 50 beads were examined in each experiment. (D and E) Live CLEM data of anti–GFP-beads in HeLa/GFP-BAF or control cells. Representative images of anti–GFP-beads fixed at (D) 5 min or (E) 1 h after the beads became GFP-BAF or GFP signal-positive. FM images represent localization of GFP-BAF (in GFP-BAF) orGFP (in Control) around the beads. Enlarged images (Enlarged) of the boxed region in the “Overview” are shown. “Diagram” panels are drawings of the“Enlarged” images. Black lines and black areas (labeled “B”) represent membranes and the beads, respectively. Gray areas, indicated by unfilled arrows,indicate the area where effector proteins exist. Black arrows indicate NE/ER-like membranes (filled with red) assembled around the beads. Black arrowheadsindicate a fragment of endosome membrane. Magenta arrowheads indicate an isolation membrane (filled with green). [Scale bars, 2 μm (FM), 1 μm(Overview), and 100 nm (Enlarged).] (F) Percentages of GFP+ beads that are also LC3+ in HeLa/GFP-BAF (black bars) or HeLa/GFP (white bars) cells at theindicated times after removal of unattached beads. The data are the means of triplicate assays ± SD 50 beads were examined in each experiment.

A

0 min1

2

3

Hoechst33342 GFP-BAF Merged

Tim

e af

ter i

njec

tion

Before injection

B FM

Hoe

chst

33

342

GFP

- B

AF

Mer

ge

Overview DiagramEM

Enlarged Overview

D D D

Fig. 4. Microinjection of exogenous dsDNA induces both BAF accumulation and NE-like/ER-like membrane assembly. (A) Time-lapse images of GFP-BAFbefore and after the injection of exogenous circular dsDNA (pGADT7, 4 μg/μL). Both exogenous dsDNA and endogenous DNA were prestained withHoechst33342. Green and red colors in the merged images represent GFP-BAF and DNA, respectively. Arrows indicate injected dsDNA. (Scale bar, 20 μm.)(B) Live CLEM analysis of the cells fixed at 10 min after injection of circular dsDNA (2 μg/μL). (Left) FM images of injected dsDNA. Enlarged represents enlargedimages of the boxed regions in the “Overview” images. Yellow dotted lines in the FM images represent the outline of the dsDNA-injected cell. Arrows in the“Enlarged” image indicate the positions of injected dsDNA. An “EM” image of the boxed region in the FM panels containing the injected DNA indicated bythe arrows is shown in the EM panel. The “Diagram” panel is a drawing of the EM image. Cyan area (labeled “D”) and black lines represent electron-lucentregions where dsDNA exists and membranes formed around the dsDNA, respectively. [Scale bars, 10 μm (Overview in the FM image), 1 μm (Enlarged), and200 nm (Overview in the EM image).]

4 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1501235112 Kobayashi et al.

(27, 28), this BAF-mediated avoidance of autophagy seemssomewhat contrary to the host defense function of BAF. Onepossible explanation is that BAF-dependent NE-like membraneassembly on the dsDNA may function as a stronger host defensesystem than autophagy by isolating the exogenous dsDNA from thecytosol. The fact that the NE acts as a potent structural barrier forexogenous dsDNA located in the cytoplasm to translocate into thenucleus in nondividing cells (29, 30) supports this idea. It is alsopossible that the BAF-dependent membrane assembly may un-expectedly neutralize the defense activity of BAF, similarly to BAFassisting genomic integration of virus DNA by blocking its suicidalautointegration (5, 6). Further studies will be required to elucidatethe physiological significance of this phenomenon.It will also be critical to understand cross-talk between autophagy

and innate immune responses against exogenous dsDNA (31, 32).We have shown that this phenomenon is a general cellular reactionto exogenous DNA and not specifically induced by invading path-ogens. Moreover, our fluorescence imaging data revealed thatemerin-containing NE-like membranes began assembling aroundthe DNA-bead surface shortly (about 5–12 min) after endosomebreakdown (Fig. S2), and the morphologies observed by electronmicroscopy of these NE-like membranes and autophagic mem-branes are clearly distinct (compare Fig. 3D, Upper and Fig. 2B, EMpanels). Given the analogy between DNA-beads and DNA viruses,our results support the previous report indicating that inhibitionof B1 kinase-mediated BAF phosphorylation causes assembly ofemerin around vaccinia viral DNA (27). Thus, the bead-mediatedmethods established here can be used not only to investigate cel-lular responses upon the entry of exogenous materials into a cell,mimicking pathogen invasion or transgene introduction, but also toexamine intracellular assembly of specific molecules of interest us-ing the beads as artificial reaction templates in living cells, providingnew methodologies to dissect complicated intracellular phenomenain cell biology.

Materials and MethodsCell Culture. HeLa cells were obtained from the Riken Cell Bank (Tsukuba) andmaintained in DMEM containing 10% (vol/vol) calf serum. HeLa cells stablyexpressing EGFP-BAF (HeLa/GFP-BAF) (8) were maintained in DMEM containing10% (vol/vol) FBS. HeLa cells stably expressing EGFP-LC3 [HeLa/GFP-LC3; a giftfrom N. Mizushima (Tokyo University, Tokyo, Japan)] and HeLa cells expressingor GFP alone (HeLa/GFP) were cultured in DMEM containing 10% (vol/vol) FBSand 200 μg/mL of Geneticin (Life Technologies, 11811-031). To obtain HeLa cellsexpressing both GFP-LC3 and mRFP-BAF (HeLa/GFP-LC3/mRFP-BAF), HeLa/GFP-LC3 cells were transfected with plasmid DNA encoding mRFP-BAF and incubatedin the presence of Geneticin and Zeocin (Life Technologies, R250-01). The plas-mid encoding mRFP–BAF was prepared as follows: The coding region of BAF wasexcised from the pECFP-C1 vector (Clontech, 6076-1) carrying CFP-BAF by SalI andBamHI, and inserted into a pCMV-mRFP-C1 vector, which was prepared byexchange of the GFP-coding sequence of a pEGFP-C1 vector (Clontech, 6084-1)with mRFP. Then the CMV promoter region was replaced with an EF1α pro-moter for efficient establishment of stable cell lines. One day before beadincorporation, cells were seeded onto 35-mm glass-bottom culture dishes(MatTek, P35G-1.5-10-C) without antibiotics.

Antibodies and Beads. Commercially available antibodies against the followingproteins were used in this study. Mouse monoclonal antibodies: BANF1(Abnova, H00008815-M01), emerin (Santa Cruz Biotechnology, sc-25284), LC3(MBL, PD014), and ubiquitin (Enzo Life Science, PW8810, clone FK2). Rabbitmonoclonal antibody: ULK1 (Abcam, ab128859). Rabbit polyclonal antibody:anti-p62 (MBL, PM045). Rabbit anti-emerin polyclonal antibody (ED1) (33)was agift from Hiroshi Yorifuji, National Defense Medical College, Saitama, Japan;present affiliation, Gunma University, Gunma, Japan and Kiichi Arahata, Na-tional Center of Neurology and Psychiatry, Tokyo, Japan; deceased. Affinity-purified anti-BAF polyclonal antibody (PU38143) was prepared as describedpreviously (12). Alexa Fluor 594-conjugated secondary antibodies (goat anti-mouse IgG and goat anti-rabbit IgG) were purchased from Invitrogen.

The beads used in this study were Dynabeads M270 Streptavidin (2.8 μm indiameter; Invitrogen, 65305), anti–GFP-beads (3 μm in diameter; MBL, D153-9),andMagnosphereMs300/carboxyl (3 μm in diameter; TakaraBio, 5324), used asthe control for the anti–GFP-beads.

Preparation of DNA-Beads. The pGADT7 vector (8.0 kbp; Clontech, 630442)was digested by ClaI and EcoRI, and the 5′-overhangs filled in with Klenowpolymerase using biotin-14-dATP (Life Technologies, 19524-016), α-thio-dCTP (GLEN Research, 80-1010-01), α-thio-dGTP (GLEN Research, 80-1020-01),and α-thio-dTTP (GLEN Research, 80-1030-01) to protect the ends from cel-lular exonuclease activity, as previously described (34). Then the largerfragment, including biotinylated dsDNA, was purified by gel-filtration spincolumn (CHROMA SPIN TE-100, TakaraBio). Immobilization of biotinylateddsDNA on Dynabeads M270 Streptavidin was performed using a DynabeadsKilobase BINDER kit (Invitrogen, 60101) according to the manufacturer’sinstruction. Approximately 20 μg of biotinylated dsDNA was immobilizedonto 50 μg of the beads (∼75 pmoles of dsDNA per milligram beads).

Bead Incorporation into Living Cells. One day before bead incorporation, cellswere seeded onto 35-mm glass-bottom culture dishes (MatTek) at a concen-tration of 2 × 105 cells per dish. DNA-beads were incorporated into HeLa cellsusing the Effectene-mediated method (15), with the minor modification ofusing the “enhancer regent” equipped with the Effectene transfection re-agent kit (Qiagen, 301425). Anti–GFP-beads were incorporated into HeLa cellsusing Effectene without enhancer reagent. In all experiments, cells on the35-mm glass-bottom dish were treated with growth medium containing Effec-tene-coated beads and incubated for 1 h in a CO2 incubator. Then the cellswere washed twice with fresh growth medium to remove unattached beads,and further incubated for the period indicated in each experiment. Dis-crimination between incorporated and unincorporated beads was per-formed by staining the sample with EZ-link Sulfo-NHS-LC-biotin (Pierce,21335) followed by rhodamine-conjugated streptavidin, as described pre-viously (15). Rhodamine-positive beads were counted as unincorporated andrhodamine-negative beads were counted as incorporated. At least 50 beadswere examined in each experiment and the data are shown as the means oftriplicate assays ± SD.

For visualization of endosome breakdown using pHrodo-dextran (Invitrogen,P10361), Lipofectamine2000 transfection reagent (Invitrogen, 11668-027) wasused for bead incorporation instead of Effectene. pHrodo-dextran was added tothe DNA-bead suspension and then mixed with Lipofectamine2000 and loadedonto cells, as described above.

Live Cell Imaging. HeLa cells expressing transgeneswere seeded on 35-mmglass-bottom culture dishes (MatTek) at a concentration of 1.5–2 × 105 cells per dish.The next day, beads were incorporated into cells as described above. Afterremoval of unattached beads, the medium was changed to growth mediumwithout phenol red for fluorescence microscopy. Time-lapse images wereobtained through an Olympus oil-immersion objective lens UApo/340 (40×,NA = 1.35) on the DeltaVision Core microscope system (Applied Precision)placed in a temperature-controlled room (37 °C).

Live CLEM. Live CLEM observations were performed as described previously(10, 15). Briefly, at the desired time point during time-lapse imaging of cellscarrying beads, cells were fixed with glutaraldehyde at a concentration of2.5% (wt/vol) for 1 h and then subjected to fluorescence microscopy to obtain3D images (typically 40–60 focal planes at 0.2-μm intervals) of the cells usingan Olympus oil-immersion objective lens PLAPON60xO SC (NA = 1.40) on aDeltaVision Core microscope system. The images were subjected to decon-volution to remove out-of-focus images using the software equipped withthe microscope system. The samples were postfixed with 1% OsO4 (NisshinEM, 3002), stained with 2% (wt/vol) uranyl acetate (Merk, 8473–1M), andthen embedded in Epon812 (TAAB, T024). The cell observed by fluorescencemicroscopy was identified in the block. Ultra-thin sections with a thickness of80 nmwere prepared and further stained with 2% uranyl acetate followed bya commercial ready-to-use solution of lead citrate (Sigma-Aldrich, 18-0875-2). EMimages were acquired using a JEM-2000EX electron microscope (80 kV;JEOL). The EM images were correlated with the fluorescence images.

Indirect Immunofluorescence Staining-Based Counting of Signal “Positive” Beads.Indirect immunofluorescence staining was performed as described previously(15). Fluorescence images were obtained through an Olympus oil-immersionobjective lens PLAPON60xOSC (NA = 1.40) on a DeltaVision Core microscopesystem. Z-stack optical images (typically 40–60 focal planes at 0.2-μm intervals)were obtained and subjected to deconvolution. When more than 25% of thearea of the bead surface in a central plane of optical z-sections of the bead wascovered with fluorescent signals, the bead was counted as “positive.” At least50 beads were examined in each experiment unless otherwise noted. Data aregiven as the means of triplicate assays ± SD.

Kobayashi et al. PNAS Early Edition | 5 of 6

CELL

BIOLO

GY

Live Imaging-Associated Indirect Immunofluorescence Staining. This methodwas basically performed as described previously (35). At the indicated timepoint during time-lapse imaging of GFP-BAF around DNA-beads, glutaral-dehyde was added to the dish to a final concentration of 0.25% and the dishwas incubated for 3 min in a temperature-controlled room (37 °C). Then thesample was further incubated for 12 min at room temperature. After rinsingthree times with PBS (pH7.4), the cells were permeabilized with 0.1% TritonX-100 in PBS for 5 min at room temperature and washed with PBS threetimes. The cells were then treated with 1% BSA in PBS (pH 7.4) for 1 h atroom temperature. After removal of the blocking solution, the cells werestained by incubation with an anti-emerin antibody (ED1) followed by anAlexa Fluor-conjugated secondary antibody.

Microinjection. Linearized DNA with biotin (prepared as described above) orplasmid DNA (pGADT7 without digestion) was prestained with Hoechst33342in distilled water for 5 min on ice (concentrations of DNA and Hoechst33342were adjusted to 8 μg/μL and 0.5 μg/μL, respectively). After twofold dilutionwith distilled water, the DNA solution was injected into HeLa/GFP-BAF orHeLa/GFP cells using an Eppendorf Microinjector 5242 equipped with aFemtotip capillary (Eppendorf, #930000035). For plasmid DNA/Effectenecomplex preparation, 2 μL of plasmid DNA (4 μg/μL), 0.32 μL of enhancerreagent and 1 μL of Effectene were mixed and incubated according to themanufacturer’s instructions. Then the DNA/Effectene complexes were mixed

with Hoechst33342 and injected into cells (final DNA concentration was1.85 μg/μL).

Knockdown of the Target Protein Using siRNA. Cells were seeded in a 35-mmculture dish (1 × 105 cells per dish) and cultured in growth medium for 24 hbefore use. Next, 2.5 μg of double-stranded RNA oligonucleotides (Qiagen)targeting BAF (AAGAAGCTGGAGGAAAGGGGT) (12) or luciferase (AACG-TACGCGGAATACTTCGA) (12) were transfected into the cells using Lipo-fectamine RNAiMAX transfection reagent (Life Technologies, 13778075)according to the manufacturer’s instructions. After incubation for 24 h, eachsample was transfected a second time and incubated for a further 24 h.Knockdown efficiency was confirmed by Western blotting as describedpreviously (12) with the minor modification of using ImmunoStar LD reagent(Wako, 296-69901). Chemiluminescent signals were detected by ChemiDocXRS+ system (Bio-Rad), and the signal intensity of each band was determinedusing the equipped software.

ACKNOWLEDGMENTS. We thank Dr. David B. Alexander for critical readingof the manuscript; the DNA construct encoding mRFP gene was a gift fromDr. Roger Tsien. This study is supported by Core Research for EvolutionaryScience and Technology of the Japan Science and Technology Agency (T.H.),and by Japan Society for the Promotion of Science Kakenhi Grants 22770205and 25650073 (to S.K.), 26116511 (to Y.H.), and 21370094 (to T.H.).

1. Tolonen N, Doglio L, Schleich S, Krijnse Locker J (2001) Vaccinia virus DNA replicationoccurs in endoplasmic reticulum-enclosed cytoplasmic mini-nuclei. Mol Biol Cell 12(7):2031–2046.

2. Farnet C-M, Haseltine W-A (1990) Integration of human immunodeficiency virus type1 DNA in vitro. Proc Natl Acad Sci USA 87(11):4164–4168.

3. Lin C-W, Engelman A (2003) The barrier-to-autointegration factor is a component offunctional human immunodeficiency virus type 1 preintegration complexes. J Virol77(8):5030–5036.

4. Sauer J-D, et al. (2010) Listeria monocytogenes triggers AIM2-mediated pyroptosisupon infrequent bacteriolysis in the macrophage cytosol. Cell Host Microbe 7(5):412–419.

5. Lee M-S, Craigie R (1998) A previously unidentified host protein protects retroviralDNA from autointegration. Proc Natl Acad Sci USA 95(4):1528–1533.

6. Chen H, Engelman A (1998) The barrier-to-autointegration protein is a host factor forHIV type 1 integration. Proc Natl Acad Sci USA 95(26):15270–15274.

7. Suzuki Y, Craigie R (2002) Regulatory mechanisms by which barrier-to-auto-integration factor blocks autointegration and stimulates intermolecular in-tegration of Moloney murine leukemia virus preintegration complexes. J Virol76(23):12376–12380.

8. Haraguchi T, et al. (2001) BAF is required for emerin assembly into the reformingnuclear envelope. J Cell Sci 114(Pt 24):4575–4585.

9. Segura-Totten M, Kowalski A-K, Craigie R, Wilson K-L (2002) Barrier-to-auto-integration factor: Major roles in chromatin decondensation and nuclear assembly.J Cell Biol 158(3):475–485.

10. Haraguchi T, et al. (2008) Live cell imaging and electron microscopy reveal dynamicprocesses of BAF-directed nuclear envelope assembly. J Cell Sci 121(Pt 15):2540–2554.

11. Zheng R, et al. (2000) Barrier-to-autointegration factor (BAF) bridges DNA in a dis-crete, higher-order nucleoprotein complex. Proc Natl Acad Sci USA 97(16):8997–9002.

12. Haraguchi T, et al. (2007) Nuclear localization of barrier-to-autointegration factor iscorrelated with progression of S phase in human cells. J Cell Sci 120(Pt 12):1967–1977.

13. Margalit A, Brachner A, Gotzmann J, Foisner R, Gruenbaum Y (2007) Barrier-to-au-tointegration factor—A BAFfling little protein. Trends Cell Biol 17(4):202–208.

14. Wiebe M-S, Traktman P (2007) Poxviral B1 kinase overcomes barrier to auto-integration factor, a host defense against virus replication. Cell Host Microbe 1(3):187–197.

15. Kobayashi S, et al. (2010) Artificial induction of autophagy around polystyrene beadsin nonphagocytic cells. Autophagy 6(1):36–45.

16. Kabeya Y, et al. (2000) LC3, a mammalian homologue of yeast Apg8p, is localized inautophagosome membranes after processing. EMBO J 19(21):5720–5728.

17. Watson M-L (1955) The nuclear envelope; its structure and relation to cytoplasmicmembranes. J Biophys Biochem Cytol 1(3):257–270.

18. Berk J-M, Tifft K-E, Wilson K-L (2013) The nuclear envelope LEM-domain proteinemerin. Nucleus 4(4):298–314.

19. Park Y-E, et al. (2009) Autophagic degradation of nuclear components in mammaliancells. Autophagy 5(6):795–804.

20. Yoshikawa Y, et al. (2009) Listeria monocytogenes ActA-mediated escape from au-tophagic recognition. Nat Cell Biol 11(10):1233–1240.

21. Zheng Y-T, et al. (2009) The adaptor protein p62/SQSTM1 targets invading bacteria tothe autophagy pathway. J Immunol 183(9):5909–5916.

22. Fujita N, et al. (2013) Recruitment of the autophagic machinery to endosomes duringinfection is mediated by ubiquitin. J Cell Biol 203(1):115–128.

23. Mizushima N (2010) The role of the Atg1/ULK1 complex in autophagy regulation. CurrOpin Cell Biol 22(2):132–139.

24. Keating S-E, Baran M, Bowie A-G (2011) Cytosolic DNA sensors regulating type I in-terferon induction. Trends Immunol 32(12):574–581.

25. Kawasaki T, Kawai T, Akira S (2011) Recognition of nucleic acids by pattern-recog-nition receptors and its relevance in autoimmunity. Immunol Rev 243(1):61–73.

26. Barber G-N (2011) Cytoplasmic DNA innate immune pathways. Immunol Rev 243(1):99–108.

27. Ibrahim N, Wicklund A, Wiebe M-S (2011) Molecular characterization of the hostdefense activity of the barrier to autointegration factor against vaccinia virus. J Virol85(22):11588–11600.

28. Jamin A, Wicklund A, Wiebe M-S (2014) Cell- and virus-mediated regulation of thebarrier-to-autointegration factor’s phosphorylation state controls its DNA binding,dimerization, subcellular localization, and antipoxviral activity. J Virol 88(10):5342–5355.

29. Zhou R, Geiger R-C, Dean D-A (2004) Intracellular trafficking of nucleic acids. ExpertOpin Drug Deliv 1(1):127–140.

30. Lechardeur D, Verkman A-S, Lukacs G-L (2005) Intracellular routing of plasmid DNAduring non-viral gene transfer. Adv Drug Deliv Rev 57(5):755–767.

31. Saitoh T, Fujita N, Yoshimori T, Akira S (2010) Regulation of dsDNA-induced innateimmune responses by membrane trafficking. Autophagy 6(3):430–432.

32. Liang Q, et al. (2014) Crosstalk between the cGAS DNA sensor and Beclin-1 autophagyprotein shapes innate antimicrobial immune responses. Cell Host Microbe 15(2):228–238.

33. Yorifuji H, et al. (1997) Emerin, deficiency of which causes Emery-Dreifuss musculardystrophy, is localized at the inner nuclear membrane. Neurogenetics 1(2):135–140.

34. Sandaltzopoulos R, Blank T, Becker P-B (1994) Transcriptional repression by nucleo-somes but not H1 in reconstituted preblastoderm Drosophila chromatin. EMBO J13(2):373–379.

35. Haraguchi T, et al. (2000) Live fluorescence imaging reveals early recruitment ofemerin, LBR, RanBP2, and Nup153 to reforming functional nuclear envelopes. J CellSci 113(Pt 5):779–794.

6 of 6 | www.pnas.org/cgi/doi/10.1073/pnas.1501235112 Kobayashi et al.