bacterial taxonomic composition of the postpartum cow

Journal of Animal Science, 2019, 4305–4313

doi:10.1093/jas/skz212Advance Access publication June 28, 2019Received: 8 June 2019 and Accepted: 26 June 2019Reproduction

4305

© The Author(s) 2019. Published by Oxford University Press on behalf of the American Society of Animal Science. All rights reserved. For permissions, please e-mail: [email protected].

Reproduction

Bacterial taxonomic composition of the postpartum cow uterus and vagina prior to artificial insemination1

Taylor B. Ault,* Brooke A. Clemmons,* Sydney T. Reese,*,† Felipe G. Dantas,* Gessica A. Franco,*,† Tim P. L. Smith,‡ J. Lannett Edwards,* Phillip R. Myer,* and Ky G. Pohler*,†,2

*Department of Animal Science, University of Tennessee, Knoxville, TN 37996, †Department of Animal Science, Texas A&M University, College Station, TX 77843-2471, and ‡U.S. Meat Animal Research Center, Agricultural Research Service, United States Department of Agriculture, Clay Center, NE 68933

1The authors would like to thank the Angus Foundation for providing funding (Award A16-1356-001), USDA-NIFA Hatch/Multistate Project W3112-TEN00506—Reproductive performance in domestic animals, Brandon Beavers and the East Tennessee Research and Education Center for housing and caring for the animals, and Dr Liesel Schneider for statistical consulting.

2Corresponding author: [email protected]

ORCiD number: 0000-0002-1980-2105 (Phillip R. Myer).

AbstractThe current study characterized the taxonomic composition of the uterine and vaginal bacterial communities during estrous synchronization up to timed artificial insemination (TAI). Postpartum beef cows (n = 68) were subjected to pre-synchronization step 21 d prior to TAI (day −21), followed by an industry standard 7 Day Co-Synch on day −9 and TAI on day 0. Uterine and vaginal flushes were collected on days −21, −9, and −2 of the protocol and pH was immediately recorded. Pregnancy was determined by transrectal ultrasound on day 30. Bacterial DNA was extracted and sequenced targeting the V1 to V3 hypervariable regions of the 16S rRNA bacterial gene. Results indicated 34 different phyla including 792 different genera present between the uterus and vagina. Many differences in the relative abundance of bacterial phyla and genera occurred between resulting pregnancy statuses and among protocol days (P < 0.05). At day −2, multiple genera were present in >1% abundance of nonpregnant cows but <1% abundance in pregnant cows (P < 0.05). Uterine pH increased in nonpregnant cows but decreased in pregnant cows (P > 0.05). Overall, our study indicates bacterial phyla and genera abundances shift over time and may potentially affect fertility by altering the reproductive tract environment.

Key words: cow, fertility, reproductive microbiome, uterus, vagina

IntroductionReproductive losses cost the beef and dairy industry over 1 billion dollars every year (Bellows et al., 2002). Fertility is affected by many factors such as nutrition, heat stress, and parity (Richards

et al., 1986; Wolfenson et al., 2000; Meikle et al., 2004; Rodney et al., 2018). In postpartum cows, the effects of these factors are particularly challenging due to the rapid changes during uterine involution that must occur after parturition. Uterine involution involves the shedding of the maternal caruncles and regrowth

Dow

nloaded from https://academ

ic.oup.com/jas/article-abstract/97/10/4305/5525064 by C

olumbia U

niversity user on 29 April 2020

http://orcid.org/0000-0002-1980-2105

mailto:[email protected]?subject=

http://orcid.org/0000-0002-1980-2105

4306 | Journal of Animal Science, 2019, Vol. 97, No. 10

of the uterine endometrium, necessary for the cow to develop another successful pregnancy (Sheldon et al., 2008). During this time, there is a high probability of bacterial contamination that is most often cleared by uterine immune cells (Sheldon et al., 2006). Colonization of pathogenic bacteria that are not cleared can lead to uterine diseases which may result in decreased fertility of beef and dairy cows (Földi et al., 2006; Sheldon et al., 2009; Potter et al., 2010). The presence of commensal bacteria, however, in the reproductive tract of cattle and its effect on health and fertility is relatively unknown.

The human reproductive tract microbiome has been well characterized, with a healthy microbiome consisting of low diversity due to the presence of greater than 90% Lactobacillus species, creating a low pH environment (Rönnqvist et al., 2006). Shifts in normal bacterial communities, reducing the presence of Lactobacillus, have been associated with bacterial vaginosis or preterm birth (Ravel et al., 2011; Moreno et al., 2016). Although the bovine reproductive microbiome is significantly more diverse than humans, similarities exist with the phyla Firmicutes dominating both the uterus and vagina of humans and bovine (Ravel et al., 2011; Laguardia-Nascimento et al., 2015; Clemmons et al., 2017). The abundance of Lactobacillus in the bovine reproductive tract, however, is very low (Swartz et al., 2014; Clemmons et al., 2017). Regarding diversity, our group previously determined that although the bacterial diversity is high in the uterus and vagina compared to previous human studies, the number of species significantly decreases throughout estrous synchronization leading up to the time of artificial insemination (Ault et al., 2019). Phylogenetic diversity of the bacteria also decreased over time, leading to resulting nonpregnant and pregnant cows having significant separation in their overall uterine phylogenetic diversity 2 d prior to prior to timed artificial insemination (TAI; Ault et al., 2019). The decreasing shift of bacterial diversity during the estrous cycle may influence the bacterial taxa present in the uterus and vagina, altering their overall phylogenetic bacterial composition and potentially affecting fertility. Therefore, our objective was to evaluate differences in bacterial relative abundances between cows that successfully established and maintained a pregnancy to day 30 after TAI and cows that were not pregnant at day 30 after TAI. We hypothesized the taxonomic composition of the uterus and vagina will differ between those that are pregnant 30 d after TAI versus cows that are not pregnant 30 d after TAI.

Materials and MethodsAll experimental procedures involving the use of animals for the current study was approved and performed under the Institutional Animal Care and Use Committee of the University of Tennessee, Knoxville. The methods below are similar as described in Ault et al. (2019).

Experimental Design

Angus beef cows (n = 68) enrolled in this study, were located at the East Tennessee Research and Education Center, averaging 80 ± 2.6 days postpartum (DPP) and 4.6 ± 0.57 yr old at TAI. No cows displayed any clinical signs of disease or reproductive tract abnormalities. Twenty-one days prior to TAI all cows were administered prostaglandin F2α (Lutalyse, 25 mg as 5 mL) IM as a pre-synchronization step. Nine days before TAI (day −9; average of 71 DPP), an industry standard 7 Day Co-Synch Protocol was implemented beginning with gonadotropin-releasing hormone (GnRH; Factrel, 100 μg as 2 mL IM injection). An injection of prostaglandin F2α (Lutalyse, 25 mg as 5 mL) IM was then

administered 2 d before TAI (day −2; average of 78 DPP). On the day of TAI (day 0), cows were administered 100 μg of GnRH IM. In order to reduce variation, a single sire and technician were used for breeding. Transrectal ultrasound occurred 30 d following TAI for pregnancy diagnosis by observation of embryonic heartbeat. Uterine and vaginal flush samples were collected throughout the synchronization protocol at day −21, day −9, and day −2. The perineal area was cleaned and disinfected prior to flush collections to prevent introduction of external bacteria into the reproductive tract. For vaginal flush collection, 60 mL of 0.9% sterile saline (Vetivex; pH = 5.6) was expelled by sterile syringe into the vagina and recovered via vaginal lavage. Following vaginal flush collections, a sterile Foley catheter was placed in the body of uterus to prevent the uterine flush from contamination. A large speculum was used as well as sterile chemise to prevent contamination while placing the catheter in the uterus. Similar to industry standard method for embryo flushing, sterile saline (180 mL) was flushed through the catheter into the uterus and collected. Uterine and vaginal flush pH was measured by UltraBasic pH meter (Denver Instruments, Arvada, CO) and recorded immediately following collection. Samples were flash-frozen in liquid nitrogen and stored at −80 ℃ until analysis. To confirm expected response to the synchronization protocol, blood samples were collected in BD Vacutainer tubes (Becton, Dickinson and Company, Franklin Lakes, NJ) for progesterone (P4) analysis at each time point of the protocol, along with evaluating the presence or absence of ovarian structures by transrectal ultrasound. Twenty (10 pregnant and 10 nonpregnant) cows were selected for sequencing and further analysis. The criteria for cow inclusion in the study included: 1) presence of a corpus luteum (CL) on day −21, day −9 with P4 greater than 1 ng/mL, 2) GnRH response on day −9 assumed by the presence of a CL on day −2, 3) presence of an ovulatory size follicle on the day of TAI (day 0).

DNA Extraction and Sequencing

From the selected 20 cows, 120 flushes were collected resulting in 10 pregnant and 10 nonpregnant cow samples from 3 different time points in both the uterus and vagina. As described in Ault et al. (2019), DNA was extracted and sequenced from all uterine and vaginal flush samples. Once samples were thawed to room temperature (22 °C), 5 mL aliquots were removed and centrifuged (4,696 × g at 4 °C). Sterile saline (180 µL) was added to the resulting pellet. The Qiagen DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) was used for DNA extraction following manufacturer protocol. DNA amplification and library preparation was conducted using polymerase chain reaction (PCR) targeting the V1 to V3 hypervariable regions of the 16S rRNA bacterial gene for identification of bacteria. Modified universal primers 27F (5′-Adapter/Index/AGAGTTTGATCCTGGCTCAG) and 519R (5′-Adapter/Index/GTATTACCGCGGCTGCTG) including TruSeq indices and adapters were used to produce sequencing libraries, using Accuprime Taq high fidelity DNA polymerase (LifeTechnologies, Carlsbad, CA). Conditions for PCR reaction were set at an annealing temperature of 58 °C for 30 cycles. Gel electrophoresis was used to confirm quality and presence of PCR product. Purification and quantification of resulting PCR product was conducted using AmPure beads and Nanodrop 1000 spectrophotometer (Agencourt, Beverly, MA and ThermoScientific, Wilmington, DE) as well as real-time PCR on LightCycler 480 system (Roche Diagnostics, Mannheim, Germany). Libraries were sequenced at the United States Meat Animal Research Center (USDA-ARS-USMARC, Clay Center, NE) by the Illumina MiSeq platform (Illumina, Inc., San Diego, CA)

Dow



olumbia U


Ault et al. | 4307

with the 2 × 300, v3 600 cycle kit. For sequencing controls, PhiX was used as a positive control and sterile saline, used for flush collections, as a negative control.

Sequence Reading and Analysis

Quantitative Insights Into Microbial Ecology (QIIME) version 1.9.1 (Caporaso et al., 2010) and Mothur version 1.36.1 (Schloss et al., 2009) programs were used to process resulting sequence reads. Quality filtering was conducted on the Galaxy server to retain all sequences with quality scores ≥ Q 25. Adapter and index sequences were trimmed from sequences and sequences < 300 bp were removed from analysis. Using the usearch61 command (Edgar, 2010), chimeric sequences were identified and removed. Identified chloroplast and mitochondria sequences were removed from analyses. Samples were then subsampled down to ~30,000 sequences to remove sequence depth bias. In order to perform taxonomic classification, operational taxonomic units (OTUs) were first selected with a pairwise identity threshold of 97% using UCLUST in QIIME. Taxonomy assignment then occurred using UCLUST and the Greengenes v13_8 16S rRNA database (Caporaso et al., 2010).

Progesterone Assay

Progesterone RIA was performed according to the previously described protocol (Pohler et al., 2016) using a double-antibody RIA kit (MP Biomedicals, Santa Ana, CA). A standard curve (ranging from 0 to 50 ng/mL) was generated to determine sample concentrations and in-house controls were used for quality control. Inter- and intra-assay CV were less than 10%.

Statistical Analysis

All analyses were separated between uterine and vaginal data and did not compare the 2 environments. Samples with an

observed OTU value < 10 were removed from analysis. Bacterial taxa abundances were non-normally distributed and could not be transformed to achieve a normal distribution. Nonparametric ANOVA in SAS 9.4 was used for all bacterial abundance data with the independent variables day of protocol or pregnancy status. Significance was determined by Wilcoxon exact test for comparisons between pregnancy statuses and Kruskal–Wallis test for comparisons among days of the protocol, with the Benjamini–Hochberg FDR multiple test correction (Weiss et al., 2017). Days postpartum and age were not included in final model as they were determined to have no significant effect. Correlations were performed in SAS 9.4 using Pearson correlation. Significance was determined by P ≤ 0.05 for all analyses.

Results

Sequence Information

As reported in Ault et al. (2019), 10,448,316 total sequences resulted after chimera removal and quality control. An average of 92,463 ± 2,976 sequences were present per sample with number of sequences ranging from 42 to 232,160 among individual samples.

Phylum Level Taxonomic Composition

Among all samples, 34 total phyla were detected. Figure 1 presents the phyla relative abundance in the uterus and vagina of pregnant or nonpregnant cows over time.

Between resulting pregnant and nonpregnant cowsFirmicutes was the most abundant phyla across all samples, but no significant differences in the relative abundance was

Figure 1. Relative abundance of phyla. A total of 34 phyla were detected among all samples. Samples were grouped by day, uterus or vagina, and pregnancy status. O

represents nonpregnant cows and P represents pregnant cows.

Dow



olumbia U



observed between pregnant and nonpregnant cows in the uterus or vagina. The most significant differences in relative abundance of phyla between resulting pregnant and nonpregnant cows occurred at day −9 in the uterus with Bacteroidetes (P = 0.05), Actinobacteria (P = 0.05), Spirochaetes (P = 0.05), Fusobacteria (P = 0.009), and unassigned taxa (P = 0.03; Table 1). Only 3 phyla were significantly different at day −21 and day −2 in the uterus between pregnant and nonpregnant cows with Thermi (P = 0.005), Acidobacteria (P = 0.03), and FBP (P = 0.05) at day −21, and Actinobacteria (P = 0.005), Fibrobacteres (P = 0.02), and unassigned taxa (P = 0.009) at day −2 (Table 1). In the vagina, only 2 phyla were significantly different with Verrucomicrobia (P = 0.01) and Fusobacteria (P = 0.03) at day −9 and Tenericutes (P = 0.03) and Acidobacteria (P = 0.05) at day −2 between resulting pregnant and nonpregnant cows (Table 1); no significant differences between pregnant and nonpregnant cows in phyla relative abundance were detected at day −21.

Days of the TAI protocolThe most abundant phyla, Firmicutes, significantly decreased over time in the uterus of pregnant (P = 0.04) and nonpregnant (P = 0.0002) cows as well as in the vagina of nonpregnant cows over time (P = 0.03; Table 2). When observing the change in phyla relative abundance over time of the synchronization protocol, numerous differences occurred in the uterus and vagina of resulting pregnant and nonpregnant animals (Table 2).

Genus Level Taxonomic Composition

At the genus level, 792 total genera were detected among all samples. Figure 2 presents the genera relative abundance in the uterus or vagina of resulting pregnant or nonpregnant cows over time.

Between resulting pregnant and nonpregnant cowsRelative abundances for each significantly different genera between pregnant and nonpregnant cows in the uterus and vagina at each day of the protocol are listed in Supplementary Tables 1–6. The undetermined genus of the family Ruminococcaceae had the greatest abundance of all samples, differing between pregnant and nonpregnant cows only at day −21 in the vagina. The most differences in genera relative abundance between pregnant and nonpregnant cows, occurred at day −2. The

genera in the uterus at day −2 in pregnant cows with relative abundance greater than 1%, other than the undetermined genus of the family Ruminococcaceae, included the classified genera of Ureaplasma, Helcococcus, Bacteroides, 5-7N15, and Oscillospira, as well as unassigned genera of order Burkholderiales, order Clostridiales, family Bacteroidaceae, family Lachnospiraceae, order Bacteroidales, and family Rikenellaceae. In nonpregnant cows, Corynebacterium had the greatest abundance in the uterus at day −2 (9.62 ± 4.97%) and a significantly lower relative abundance (0.50 ± 0.36%) in the uterus of pregnant cows (P = 0.003). Genera with relative abundance greater than 1% in the uterus at day −2 of nonpregnant cows that significantly differed from pregnant cows, other than Corynebacterium, included classified genera Staphylococcus (P = 0.0002), Prevotella (P = 0.03), Microbacterium (P = 0.01), Butyrivibrio (P = 0.05), Ralstonia (P = 0.01), and unassigned genera from family Alcaligenaceae (P = 0.0001), and family Comamonadaceae (P = 0.02; Table 3). Interestingly, these genera in resulting nonpregnant cows with greater than 1% relative abundance had a relative abundance less than 1% in resulting pregnant cows (Table 3). Fewer differences in the relative abundances of genera occurred between pregnant and nonpregnant cows in both the uterus and vagina at day −21 (Supplementary Tables 1 and 4) and day −9 (Supplementary Tables 2 and 5) compared to day −2 in the uterus (Table 3; Supplementary Table 3)

Days of the TAI protocolThe most abundant genera detected, undetermined from the family Ruminococcaceae, significantly changed over time in the uterus and vagina of both pregnant and nonpregnant animals (P < 0.05). Numerous other genera relative abundances significantly changed over the duration of the protocol (Supplementary Tables 7–10).

Circulating Progesterone Concentrations and Relative pH Correlation to Bacteria Phyla

As reported in Ault et al. (2019), day −21 (2.34 ± 0.62 ng/mL vs. 2.2 ± 0.74 ng/mL), day −2 (6.11 ± 1.81 ng/mL vs. 4.76 ± 1.77 ng/mL), and day 0 (0.83 ± 0.31 ng/mL vs. 0.31 ± 0.09 ng/mL) circulating progesterone concentrations were not significantly different between resulting pregnant and nonpregnant animals as expected. At day −9, however, progesterone was greater in

Table 1. Percent relative abundance of significant phyla (mean ± SEM) between nonpregnant and pregnant cows in the uterus and vagina at each day1,2

Type Day Phylum Nonpregnant Pregnant P-value

Uterine −21 Thermi 0.003 ± 0.001 0.025 ± 0.014 0.005Acidobacteria 0.002 ± 0.001 0.011 ± 0.006 0.029

Uterine −9 Bacteroidetes 18.257 ± 0.636 16.449 ± 0.832 0.047Actinobacteria 2.346 ± 0.717 3.800 ± 0.698 0.047Spirochaetes 0.029 ± 0.004 0.026 ± 0.009 0.049Unassigned 0.003 ± 0.001 0.010 ± 0.003 0.027Fusobacteria 0.002 ± 0.001 0.010 ± 0.009 0.009

Uterine −2 Actinobacteria 14.403 ± 7.360 1.338 ± 0.761 0.005Fibrobacteres 0.271 ± 0.213 0.041 ± 0.034 0.018Unassigned 0.009 ± 0.004 0.001 ± 0.001 0.009

Vaginal −9 Fusobacteria 0.019 ± 0.015 ND 0.029Verrucomicrobia 0.005 ± 0.003 0.019 ± 0.005 0.010

Vaginal −2 Tenericutes 2.547 ± 1.195 1.010 ± 0.167 0.032Acidobacteria 0.009 ± 0.005 0.002 ± 0.001 0.053

1Significance determined by P ≤ 0.05. No significant differences were detected at day −21 in the vagina.2ND: not detectable at current depth.

Dow



olumbia U


http://academic.oup.com/jas/article-lookup/doi/10.1093/jas/skz212#supplementary-data











Ault et al. | 4309

nonpregnant cows than pregnant cows (P = 0.01; 7.58 ± 1.30 ng/mL vs. 3.83 ± 0.68 ng/mL), but no day × status was observed. In addition, correlation of circulating progesterone concentration to the relative abundance of phyla indicated significance with Firmicutes. In the vagina of nonpregnant cows, as circulating progesterone concentration decreased, the relative abundance of Firmicutes increased at both day −9 (r = −0.79, P = 0.02) and day −2 (r = −0.81, P = 0.004). At day −2, however, an increase in progesterone was significantly correlated to an increase in relative abundance of Proteobacteria in the vagina of nonpregnant cows (r = 0.70, P = 0.03).

Regardless of the day of the TAI protocol, the uterus had a lower relative pH, with means ranging from 5.86 ± 0.11 to 6.06 ± 0.09, compared to the vagina with means ranging from 6.31 ± 0.09 to 7.04 ± 0.17. In the uterus, no effect of day or status was detected on relative uterine pH. Although no significant day × status occurred, uterine relative pH numerically increased in resulting nonpregnant cows from 5.86 ± 0.11 at day −21 to 6.06 ± 0.09 at day −2 and decreased in resulting pregnant cows from 6.04 ± 0.20 at day −21 to 5.92 ± 0.13 at day −2. In the vagina, no overall effect of status or day × status on relative pH was detected (P > 0.05) between resulting nonpregnant and pregnant cows at day −21 (7.04 ± 0.17 vs. 6.76 ± 0.24), day −9 (6.31 ± 0.09

vs. 6.29 ± 0.11), or day −2 (6.69 ± 0.14 vs. 6.58 ± 0.14). Regardless of pregnancy status, vaginal pH changed significantly overtime (P < 0.0001) with the lowest relative pH on day −9 (6.30 ± 0.07) compared to day −21 (6.90 ± 0.15; P = 0.0002) and day −2 (6.63 ± 0.10; P = 0.0009). Additionally, pH values were tested for correlation with genera abundances in the uterus and vagina. In the uterus, genera Mogibacterium (r = −0.25, P = 0.057) and unassigned genera from the family Lachnospiraceae (r = −0.35, P = 0.008) and family Clostridiaceae (r = −0.27, P = 0.04) were negatively correlated with pH. As the abundances of these genera increased, uterine pH decreased. In the vagina, however, genera Clostridium (r = 0.28, P = 0.04), unassigned genera from the family Lachnospiraceae (r = 0.31, P = 0.02), and 2 different genera from the unassigned from the order Clostridiales (r = 0.30, P = 0.02 and r = 0.36, P = 0.007) were positively correlated to pH with an increase in abundance associated with an increase in pH.

DiscussionThe uterine and vaginal bacterial communities of cattle have been determined to contain greater diversity compared to the human reproductive microbiome (Swartz et al., 2014; Ault et al.,

Table 2. Percent relative abundance of significant phyla (mean ± SEM) among protocol days in the uterus and vagina of nonpregnant and pregnant cows1,2

Type Status Phylum Day −21 Day −9 Day −2 P-value

Uterine Nonpregnant Firmicutes 61.301 ± 4.691 74.312 ± 2.225 36.020 ± 5.970 0.001Proteobacteria 5.444 ± 2.101 3.336 ± 1.646 27.676 ± 9.456 0.013Tenericutes 2.264 ± 0.541 0.932 ± 0.161 7.395 ± 6.402 0.027Verrucomicrobia 0.221 ± 0.058 0.015 ± 0.003 0.115 ± 0.034 0.011Fusobacteria 0.015 ± 0.005 0.002 ± 0.001 0.027 ± 0.015 0.033Thermi 0.003 ± 0.001 0.069 ± 0.024 0.032 ± 0.013 0.043OD1 0.001 ± 0.001 ND 0.014 ± 0.008 0.008FBP ND 0.003 ± 0.002 ND 0.047

Uterine Pregnant Firmicutes 65.182 ± 3.127 69.480 ± 3.272 45.544 ± 9.283 0.043Actinobacteria 3.709 ± 0.992 3.800 ± 0.698 1.338 ± 0.761 0.011Lentisphaerae 0.514 ± 0.081 0.452 ± 0.064 0.255 ± 0.148 0.014Fibrobacteres 0.301 ± 0.126 0.054 ± 0.016 0.041 ± 0.034 0.004Spirochaetes 0.134 ± 0.035 0.026 ± 0.009 0.127 ± 0.079 0.037Chloroflexi 0.034 ± 0.005 0.057 ± 0.015 0.018 ± 0.010 0.015Unassigned 0.010 ± 0.004 0.010 ± 0.003 0.001 ± 0.001 0.006WPS-2 0.005 ± 0.003 0.002 ± 0.001 ND 0.044Armatimonadetes 0.002 ± 0.001 ND ND 0.015OD1 ND ND 0.005 ± 0.003 0.047

Vaginal Nonpregnant Firmicutes 81.663 ± 1.533 79.483 ± 2.291 70.667 ± 3.842 0.032Proteobacteria 1.248 ± 0.377 0.898 ± 0.283 6.626 ± 3.384 0.045TM7 0.105 ± 0.034 0.025 ± 0.008 0.285 ± 0.078 0.001Thermi 0.001 ± 0.001 0.016 ± 0.006 0.016 ± 0.007 0.033Spirochaetes 0.051 ± 0.019 0.016 ± 0.005 0.126 ± 0.035 0.004Acidobacteria ND 0.001 ± 0.001 0.009 ± 0.005 0.004Planctomycetes 0.037 ± 0.018 0.008 ± 0.003 0.081 ± 0.011 0.005Verrucomicrobia 0.180 ± 0.138 0.005 ± 0.003 0.175 ± 0.065 0.001Fibrobacteres 0.043 ± 0.018 0.019 ± 0.008 0.121 ± 0.048 0.034OD1 ND ND 0.071 ± 0.050 0.027

Vaginal Pregnant Proteobacteria 0.959 ± 0.152 1.048 ± 0.354 1.968 ± 0.358 0.014TM7 0.084 ± 0.023 0.046 ± 0.019 0.317 ± 0.118 0.020Planctomycetes 0.014 ± 0.006 0.006 ± 0.003 0.076 ± 0.016 0.001Verrucomicrobia 0.079 ± 0.038 0.019 ± 0.005 0.202 ± 0.094 0.026Unassigned 0.012 ± 0.003 0.003 ± 0.001 0.003 ± 0.001 0.018SR1 0.012 ± 0.011 ND ND 0.047Synergistetes 0.002 ± 0.001 ND ND 0.015

1Significance determined by P ≤ 0.05.2ND: not detectable at current depth.

Dow



olumbia U



2019). Throughout the estrous cycle, the diversity of bacterial communities significantly decreases as the reproductive tract environment prepares for pregnancy (Ault et al., 2019). The shift occurring in the diversity of the bacteria present leads to differences in the taxonomic composition of these communities, potentially affecting fertility. In the current study,

multiple genera that have previously been determined to be commonly pathogenic differed between resulting pregnant and nonpregnant cows. These genera were determined to be present in the uterus at day −2 with abundances greater than 1% in cows that did not become pregnant, but these same bacteria were present in less than 1% in cows that became pregnant. Clemmons et al. (2017) found Corynebacterium as the most abundant genus in the uterus 2 d prior to TAI in nonpregnant cows. Previously, Corynebacterium was determined to be highly abundant in postpartum cows that had developed uterine infections and led to negative effects on the ability to conceive another pregnancy (Ruder et al., 1981). The present study found significantly lower abundances of Corynebacterium in postpartum cows that were able to develop a pregnancy, supporting previous evidence of Cornyebacterium's potential negative effects on fertility. In addition, results indicated Staphylococcus as the second most abundant genus detected in the uterus of nonpregnant cows at day −2, which was also significantly less in the uterus of pregnant cows at day −2. Staphylococcus is often found to be present in the uterus of postpartum cows that develop acute metritis and known as the most common pathogen causing mastitis (Vasudevan et al., 2003; Otero and Nader-Macías, 2006). Unexpectedly, Ureaplasma and Helcococcus genera had the greatest abundance detected in the uterus of pregnant cows at

Table 3. Significantly different genera between nonpregnant and pregnant cows at day −2 in the uterus with a relative abundance greater than 1%1

Genus Nonpregnant Pregnant P-value

Corynebacterium 9.623 ± 4.974 0.499 ± 0.358 0.003Family Alcaligenaceae 9.491 ± 9.407 0.013 ± 0.011 0.001Staphylococcus 3.283 ± 2.895 0.024 ± 0.018 0.001Prevotella 2.819 ± 2.613 0.032 ± 0.019 0.031Microbacterium 2.219 ± 2.185 0.009 ± 0.007 0.009Butyrivibrio 1.363 ± 0.433 0.789 ± 0.388 0.049Ralstonia 1.353 ± 0.780 0.041 ± 0.023 0.007Family

Comamonadaceae1.130 ± 0.482 0.341 ± 0.214 0.023

1All genera relative abundances that significantly differ between nonpregnant and pregnant cows at day −2 in the uterus are presented in Supplementary Table 5.

Figure 2. Relative abundance of genera. A total of 792 genera were detected among all samples. The top 30 most abundant genera are presented with the Other

category including all genera below the top 30 most abundant genera detected. Samples were grouped by the day, uterus or vagina, and pregnancy status. O represents

nonpregnant cows and P represents pregnant cows

Dow



olumbia U



Ault et al. | 4311

day −2 but did not significantly differ between pregnant and nonpregnant cows. Previously, these bacteria have been shown to have infectious potential and are a factor in the development of uterine metritis with the potential to lead to reproductive issues such as infertility or abortion in cattle (Vasconcellos Cardoso et al., 2000). Similar results to the current study were found by Jeon et al. (2015) with increased Ureaplasma correlated to a healthier uterine environment than those that developed metritis after calving. Further research needs to be conducted to determine the specific species level differences and how they relate to the development of uterine disease or presence in the healthy uterus. It is important to note that the current study cannot rule out effects of repeated flushing of the reproductive tract prior to TAI. A recent study by Martins et al. (2018), reported repeated flushing of the reproductive tract prior to embryo transfer, led to decreased pregnancy rates. Further, there is the possibility that the observed bacterial communities may be a result of bacteria introduced from previous pregnancies since all animals in the current study were multiparous; however, these experiments were designed to minimize these effects.

The indicated presence of pathogenic bacteria in the reproductive tract may have negative effects on the development and maintenance of pregnancy; however, other present bacteria may be contributing to a healthy or optimal reproductive tract environment. The unassigned genera from the family Ruminococcaceae was determined to have the greatest abundance in the reproductive tract in the current study. Although the specific species present has yet to be classified, the Ruminococcaceae family of bacteria is known to be highly abundant in the gastrointestinal tract of healthy humans and cattle (Flint et al., 2012; Rajilić-Stojanović and de Vos, 2014; Mao et al., 2015). These bacteria contribute to carbohydrate degradation resulting in the production of short-chain fatty acids (SCFA) such as butyrate (Forbes et al., 2016; Zheng et al., 2017). Butyrate has been previously determined to prevent local inflammation by increasing the population of regulator T cells (Tregs; Smith et al., 2013; Zhang et al., 2016). As the regulation of inflammation in the reproductive tract by Tregs has been demonstrated to be important for the establishment of pregnancy (Shima et al., 2010) and to prevent rejection of the fetus, the high abundance of bacteria from the family Ruminococcaceae may be contributing fermentation products to regulate immune cell populations in the reproductive tract to maintain the proper inflammatory environment (Aluvihare et al., 2004). Additionally, other bacteria present in lower abundances may also have positive effects on the reproductive tract environment. Although Lactobacillus abundance is low in the reproductive tract of cattle, as confirmed by the current study, these bacteria may be beneficial to the reproductive tract environment. Genís et al. (2018) used strains of Lactobacillus as a probiotic administered into the vagina and uterus of dairy cows prior to calving. They found cows treated with Lactobacillus had a lower incidence of metritis, suggesting lactic acid-producing bacteria may provide benefits to the reproductive tract health and fertility (Genís et al., 2018).

The overall environment of the uterus plays a critical role in proper sperm transport for successful fertilization. The present study indicated a decrease in uterine pH leading up to TAI in cows that became pregnant, but an increase in pH in those who failed to conceive. These results support evidence that a lower uterine pH at the time of sperm deposition may be beneficial to fertilization. Studies in cattle have shown that sperm motility is increased in higher pH environments and inhibited by a lower pH environment, leading to an increased life span (Jones and

Bavister, 2000). In the current study, vaginal pH was greater than uterine pH prior to breeding which may allow for a favorable environment for sperm ascension into the uterus during natural breeding as sperm is deposited into the vagina. Additionally, a decrease in uterine pH at estrus has been shown to lead to a favorable environment for sperm to reside prior to fertilization of the oocyte, contributing to increased pregnancy rates (Perry and Perry, 2008a, 2008b). The relationship between the change in pH and bacterial communities in the reproductive tract has not previously been evaluated in bovine. Interestingly, our study found significant correlations of bacterial genera associated with increased relative vaginal pH, with other bacteria associated with decreased relative uterine pH. Although the current study does not report true pH measurements, rather the relative change in pH, the decreased species number and phylogenetic diversity with the change in abundances of bacteria occurring in the uterus leading to TAI may contribute to the change in pH. Previous studies in humans determined estrogen stimulates epithelial cells of the reproductive tract to produce glycogen, a fuel source for Lactobacillus, which dominates the reproductive microbiota (Boskey et al., 1999; Lamont et al., 2011; Ravel et al., 2011; Brotman et al., 2014). Boskey et al. (1999) indicated the glycogen produced is sufficient for Lactobacillus to produce a high concentration of lactic acid to maintain a low pH environment, suggesting the microbiota are the major contributor to the pH of the reproductive tract to potentially protect against pathogen colonization (Eschenbach et al., 1989; Boskey et al., 1999). Future studies may be able to use bacteria known to lower pH, such as Lactobacillus, in probiotic form to manipulate the microbiome of the bovine reproductive tract and evaluate the effect on improving pregnancy establishment.

In addition to pH, hormone concentrations have been suggested to affect the presence of some bacterial species (Sandrini et al., 2015; Org et al., 2016). Otero et al. (1999) found greater abundances of bacteria in bovine bacterial cultures in the presence of high estrogen, or low progesterone, suggesting bacterial community abundances shift through different phases of the estrous cycle. Similarly, our results indicated the shift of Firmicutes in the vagina was correlated to progesterone concentration, with decreased progesterone indicating an increase in Firmicutes. In contrast, an increase in Proteobacteria relative abundance in the vagina was correlated to an increase in progesterone, suggesting the response to hormonal concentrations may differ by species. No differences in progesterone concentration were detected in the current study between pregnant and nonpregnant cows at day −21, day −2, or day 0 indicating a physiological response to the protocol prior to breeding and no effect on the bacteria differences observed at each day. The shifts in hormonal concentrations throughout the estrous cycle, however, may influence the change in bacterial abundances over time. Further research is necessary to determine the mechanisms contributing to the fluctuations in the reproductive tract microbiome and circulating or local hormone concentrations.

In conclusion, the taxonomic composition in the uterus and vagina shifts in the relative abundance of bacteria throughout the TAI synchronization protocol. The bacterial diversity was previously determined to change over time in the uterus (Ault et al., 2019), resulting in differences in phyla and genera relative abundances. Although various factors may affect the development and maintenance of pregnancy, our study suggests differences in bacterial abundances prior to breeding may affect the reproductive tract environment potentially affecting fertility outcomes. Future research should determine potential causes of altered bacterial abundances shifting toward a pathogenic

Dow



olumbia U



microbiome preventing the development and maintenance of pregnancy, or toward a healthy microbiome supporting a successful pregnancy. Additional research may evaluate the use of probiotics to potentially maintain a healthy microbiome in the reproductive tract to reduce fertility issues and help producers improve their herd's reproductive efficiency.

Supplementary DataSupplementary data are available at Journal of Animal Science online.

Literature CitedAluvihare, V. R., M. Kallikourdis, and A. G. Betz. 2004. Regulatory

T cells mediate maternal tolerance to the fetus. Nat. Immunol. 5:266–271. doi:10.1038/ni1037

Ault, T. B., B. A. Clemmons, S. T. Reese, F. G. Dantas, G. A. Franco, T. P. L. Smith, J. L. Edwards, P. R. Myer, and K. G. Pohler. 2019. Uterine and vaginal bacterial community diversity prior to artificial insemination between pregnant and non-pregnant postpartum cows. J. Anim. Sci. doi:10.1093/jas/skz210

Bellows, D. S., S. L. Ott, and R. A. Bellows. 2002. Review: cost of reproductive diseases and conditions in cattle. Prof. Anim. Scient. 18:26–32. doi:10.15232/S1080-7446(15)31480-7

Boskey, E. R., K. M. Telsch, K. J. Whaley, T. R. Moench, and R. A. Cone. 1999. Acid production by vaginal flora in vitro is consistent with the rate and extent of vaginal acidification. Infect. Immun. 67:5170–5175.

Brotman, R. M., J. Ravel, P. M. Bavoil, P. E. Gravitt, and K. G. Ghanem. 2014. Microbiome, sex hormones, and immune responses in the reproductive tract: challenges for vaccine development against sexually transmitted infections. Vaccine 32:1543–1552. doi:10.1016/j.vaccine.2013.10.010

Caporaso, J. G., J. Kuczynski, J. Stombaugh, K. Bittinger, F. D. Bushman, E. K. Costello, N. Fierer, A. G. Peña, J. K. Goodrich, J. I. Gordon, et al. 2010. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7:335–336. doi:10.1038/nmeth.f.303

Clemmons, B. A., S. T. Reese, F. G. Dantas, G. A. Franco, T. P. L. Smith, O. I. Adeyosoye, K. G. Pohler, and P. R. Myer. 2017. Vaginal and uterine bacterial communities in postpartum lactating cows. Front. Microbiol. 8:1047. doi:10.3389/fmicb.2017.01047

Edgar, R. C. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26:2460–2461. doi:10.1093/bioinformatics/btq461

Eschenbach, D. A., P. R. Davick, B. L. Williams, S. J. Klebanoff, K. Young-Smith, C. M. Critchlow, and K. K. Holmes. 1989. Prevalence of hydrogen peroxide-producing Lactobacillus species in normal women and women with bacterial vaginosis. J. Clin. Microbiol. 27:251–256.

Flint, H. J., K. P. Scott, S. H. Duncan, P. Louis, and E. Forano. 2012. Microbial degradation of complex carbohydrates in the gut. Gut Microbes 3:289–306. doi:10.4161/gmic.19897

Földi, J., M. Kulcsár, A. Pécsi, B. Huyghe, C. de Sa, J. A. C. M. Lohuis, P. Cox, and G. Huszenicza. 2006. Bacterial complications of postpartum uterine involution in cattle. Anim. Reprod. Sci. 96:265–281. doi:10.1016/j.anireprosci.2006.08.006

Forbes, J. D., G. Van Domselaar, and C. N. Bernstein. 2016. The gut microbiota in immune-mediated inflammatory diseases. Front. Microbiol. 7:1081. doi:10.3389/fmicb.2016.01081

Genís, S., R. L. A. Cerri, À. Bach, B. F. Silper, M. Baylão, J. Denis-Robichaud, and A. Arís. 2018. Pre-calving intravaginal administration of lactic acid bacteria reduces metritis prevalence and regulates blood neutrophil gene expression after calving in dairy cattle. Front. Vet. Sci. 5:135. doi:10.3389/fvets.2018.00135

Jeon, S. J., A. Vieira-Neto, M. Gobikrushanth, R. Daetz, R. D. Mingoti, A. C. Parize, S. L. de Freitas, A. N. da Costa,

R. C. Bicalho, S. Lima, et al. 2015. Uterine microbiota progression from calving until establishment of metritis in dairy cows. Appl. Environ. Microbiol. 81:6324–6332. doi:10.1128/AEM.01753-15

Jones, J. M., and B. D. Bavister. 2000. Acidification of intracellular pH in bovine spermatozoa suppresses motility and extends viable life. J. Androl. 21:616–624. doi:10.1002/j.1939-4640.2000.tb02128.x

Laguardia-Nascimento, M., K. M. Branco, M. R. Gasparini, S. Giannattasio-Ferraz, L. R. Leite, F. M. Araujo, A. C. Salim, J. R. Nicoli, G. C. de Oliveira, and E. F. Barbosa-Stancioli. 2015. Vaginal microbiome characterization of Nellore cattle using metagenomic analysis. PLoS One 10:e0143294. doi:10.1371/journal.pone.0143294

Lamont, R. F., J. D. Sobel, R. A. Akins, S. S. Hassan, T. Chaiworapongsa, J. P. Kusanovic, and R. Romero. 2011. The vaginal microbiome: new information about genital tract flora using molecular based techniques. BJOG 118:533–549. doi:10.1111/j.1471-0528.2010.02840.x

Mao, S., M. Zhang, J. Liu, and W. Zhu. 2015. Characterising the bacterial microbiota across the gastrointestinal tracts of dairy cattle: membership and potential function. Sci. Rep. 5:16116. doi:10.1038/srep16116

Martins, T., G. Pugliesi, M. Sponchiado, A. M. Gonella-Diaza, O. A. Ojeda-Rojas, F. D. Rodriguez, R. S. Ramos, A. C. Basso, and M. Binelli. 2018. Perturbations in the uterine luminal fluid composition are detrimental to pregnancy establishment in cattle. J. Anim. Sci. Biotechnol. 9:70. doi:10.1186/s40104-018-0285-6

Meikle, A., M. Kulcsar, Y. Chilliard, H. Febel, C. Delavaud, D. Cavestany, and P. Chilibroste. 2004. Effects of parity and body condition at parturition on endocrine and reproductive parameters of the cow. Reproduction 127:727–737. doi:10.1530/rep.1.00080

Moreno, I., F. M. Codoñer, F. Vilella, D. Valbuena, J. F. Martinez-Blanch, J. Jimenez-Almazán, R. Alonso, P. Alamá, J. Remohí, A. Pellicer, et al. 2016. Evidence that the endometrial microbiota has an effect on implantation success or failure. Am. J. Obstet. Gynecol. 215:684–703. doi:10.1016/j.ajog.2016.09.075

Org, E., M. Mehrabian, B. W. Parks, P. Shipkova, X. Liu, T. A. Drake, and A. J. Lusis. 2016. Sex differences and hormonal effects on gut microbiota composition in mice. Gut Microbes 7:313–322. doi:10.1080/19490976.2016.1203502

Otero, M. C., and M. E. Nader-Macías. 2006. Inhibition of Staphylococcus aureus by H2O2-producing Lactobacillus gasseri isolated from the vaginal tract of cattle. Anim. Reprod. Sci. 96:35–46. doi:10.1016/j.anireprosci.2005.11.004

Otero, C., C. Silva de Ruiz, R. Ibañez, O. R. Wilde, A. A. P. de Ruiz Holgado, and M. E. Nader-Macias. 1999. Lactobacilli and Enterococci isolated from the bovine vagina during the estrous cycle. Vet. Micro. 5:305–307. doi:10.1006/anae.1999.0245

Perry, G. A., and B. L. Perry. 2008a. Effect of preovulatory concentrations of estradiol and initiation of standing estrus on uterine pH in beef cows. Domest. Anim. Endocrinol. 34:333–338. doi:10.1016/j.domaniend.2007.09.003

Perry, G. A., and B. L. Perry. 2008b. Effects of standing estrus and supplemental estradiol on changes in uterine pH during a fixed-time artificial insemination protocol. J. Anim. Sci. 86:2928–2935. doi:10.2527/jas.2008-1181

Pohler, K. G., M. H. C. Pereira, F. R. Lopes, J. C. Lawrence, D. H. Keisler, M. F. Smith, J. L. M. Vasconcelos, and J. A. Green. 2016. Circulating concentrations of bovine pregnancy-associated glycoproteins and late embryonic mortality in lactating dairy herds. J. Dairy Sci. 99:1584–1594. doi:10.3168/jds.2015-10192

Potter, T. J., J. Guitian, J. Fishwick, P. J. Gordon, and I. M. Sheldon. 2010. Risk factors for clinical endometritis in postpartum dairy cattle. Theriogenology 74:127–134. doi:10.1016/j.theriogenology.2010.01.023

Dow



olumbia U


Ault et al. | 4313

Rajilić-Stojanović, M., and W. M. de Vos. 2014. The first 1000 cultured species of the human gastrointestinal microbiota. FEMS Microbiol. Rev. 38:996–1047. doi:10.1111/1574-6976.12075

Ravel, J., P. Gajer, Z. Abdo, G. M. Schneider, S. S. K. Koenig, S. L. McCulle, S. Karlebach, R. Gorle, J. Russell, C. O. Tacket, et al. 2011. Vaginal microbiome of reproductive-age women. Proc. Natl. Acad. Sci. USA 108(Suppl. 1):4680. doi:10.1073/pnas.1002611107

Richards, M. W., J. C. Spitzer, and M. B. Warner. 1986. Effect of varying levels of postpartum nutrition and body condition at calving on subsequent reproductive performance in beef cattle. J. Anim. Sci. 62:300–306. doi:10.2527/jas1986.622300x

Rönnqvist, D. J., B. Forsgren-Brusk, and E. Grahn-Hkansson. 2006. Lactobacilli in the female genital tract in relation to other genital microbes and vaginal pH. Acta Obstet. Gynecol. Scand. 85:726–735. doi:10.1080/00016340600578357

Rodney, R. M., P. Celi, W. Scott, K. Breinhild, J. E. P. Santos, and I. J. Lean. 2018. Effects of nutrition on the fertility of lactating dairy cattle. J. Dairy Sci. 101:5115–5133. doi:10.3168/jds.2017-14064

Ruder, C. A., R. G. Sasser, R. J. Williams, J. K. Ely, R. C. Bull, and J. E. Butler. 1981. Uterine infections in the postpartum cow. Theriogenology 15:573–580. doi:10.1016/0093-691X(81)90060-1

Sandrini, S., M. Aldriwesh, M. Alruways, and P. Freestone. 2015. Microbial endocrinology: host-bacteria communication within the gut microbiome. J. Endocrinol. 225:R21–R34. doi:10.1530/JOE-14-0615

Schloss, P. D., S. L. Westcott, T. Ryabin, J. R. Hall, M. Hartmann, E. B. Hollister, R. A. Lesniewski, B. B. Oakley, D. H. Parks, C. J. Robinson, et al. 2009. Introducing Mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75:7537–7541. doi:10.1128/AEM.01541-09

Sheldon, I. M., G. S. Lewis, S. LeBlanc, and R. O. Gilbert. 2006. Defining postpartum uterine disease in cattle. Theriogenology 65:1516–1530. doi:10.1016/j.theriogenology.2005.08.021

Sheldon, I. M., S. B. Price, J. Cronin, R. O. Gilbert, and J. E. Gadsby. 2009. Mechanisms of infertility associated with clinical and subclinical endometritis in high producing dairy cattle. Reprod. Domest. Anim. 44(Suppl. 3):1–9. doi:10.1111/j.1439-0531.2009.01465.x

Sheldon, I. M., E. J. Williams, A. N. Miller, D. M. Nash, and S. Herath. 2008. Uterine diseases in cattle after parturition. Vet. J. 176:115–121. doi:10.1016/j.tvjl.2007.12.031

Shima, T., Y. Sasaki, M. Itoh, A. Nakashima, N. Ishii, K. Sugamura, and S. Saito. 2010. Regulatory T cells are necessary for implantation and maintenance of early pregnancy but not late pregnancy in allogeneic mice. J. Reprod. Immunol. 85:121–129. doi:10.1016/j.jri.2010.02.006

Smith, P. M., M. R. Howitt, N. Panikov, M. Michaud, C. A. Gallini, M. Bohlooly-Y, J. N. Glickman, and W. S. Garrett. 2013. The microbial metabolites, short-chain fatty acids, regulate colonic Treg cell homeostasis. Science 341:569–573. doi:10.1126/science.1241165

Swartz, J. D., M. Lachman, K. Westveer, T. O'Neill, T. Geary, R. W. Kott, J. G. Berardinelli, P. G. Hatfield, J. M. Thomson, A. Roberts, et al. 2014. Characterization of the vaginal microbiota of ewes and cows reveals a unique microbiota with low levels of Lactobacilli and near-neutral pH. Front. Vet. Sci. 1:19. doi:10.3389/fvets.2014.00019

Vasconcellos Cardoso, M., A. Blanchard, S. Ferris, R. Verlengia, J. Timenetsky, and R. A. Florio Da Cunha. 2000. Detection of ureaplasma diversum in cattle using a newly developed PCR-based detection assay. Vet. Microbiol. 72:241–250. doi:10.1016/S0378-1135(99)00203-5

Vasudevan, P., M. K. Nair, T. Annamalai, and K. S. Venkitanarayanan. 2003. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet. Microbiol. 92:179–185. doi:10.1016/S0378-1135(02)00360-7

Weiss, S., Z. Z. Xu, S. Peddada, A. Amir, K. Bittinger, A. Gonzalez, C. Lozupone, J. R. Zaneveld, Y. Vázquez-Baeza, A. Birmingham, et al. 2017. Normalization and microbial differential abundance strategies depend upon data characteristics. Microbiome 5:27. doi:10.1186/s40168-017-0237-y

Wolfenson, D., Z. Roth, and R. Meidan. 2000. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim. Reprod. Sci. 60–61:535–547. doi:10.1016/S0378-4320(00)00102-0

Zhang, M., Q. Zhou, R. G. Dorfman, X. Huang, T. Fan, H. Zhang, J. Zhang, and C. Yu. 2016. Butyrate inhibits interleukin-17 and generates Tregs to ameliorate colorectal colitis in rats. BMC Gastroenterol. 16:84. doi:10.1186/s12876-016-0500-x

Zheng, H., M. Chen, Y. Li, Y. Wang, L. Wei, Z. Liao, M. Wang, F. Ma, Q. Liao, and Z. Xie. 2017. Modulation of gut microbiome composition and function in experimental colitis treated with Sulfasalazine. Front. Microbiol. 8:1703. doi:10.3389/fmicb.2017.01703

Dow



olumbia U


bacterial taxonomic composition of the postpartum cow

Documents