b3 study notes

5/17/2018 B3 Study Notes - slidepdf.com

http://slidepdf.com/reader/full/b3-study-notes 1/58

Name __Casey Hindon____

OCR Gateway GCSE Additional Science

B3: Living and growing

1



Molecules of life

DNA code

DNA is a chemical found inside the nucleus. It forms structures called chromosomes.

A section of a chromosome is called a gene. Each gene is a code for making proteins.

Our bodies need to make proteins to grow and repair cells.

Everyone has his or her own unique DNA code.

Question: Why does a cell need to make proteins?

The cell needs protein as Protein provides growth and repair for the cell/organism.

Mitochondria

Cell respiration is carried out inside mitochondria. During respiration energy is

released from glucose in the presence of oxygen.

DNA

2



Question: Complete the text using the words that follow:

DNA consists of two long molecules called polynucleotides wrapped around each

other.

Each polynucleotide strand is made up of small molecules joined together called bases.

Each nucleotide has a ‘sticky’ part to it called a nucleotide base.Bases of two different nucleotides can bond to each other and this is how the two

polynucleotide strand hold together.

Purine type of base bond to Pyridimine type of base

Purine bases are adenine (A) and guanine (G)

Pyrimidine bases are thymine (T) and cytosine (C)

Possible words: Pyrimidine, nucleotide, base,

Question: On the previous diagram, colour the purine bases in red and the pyrimidine

bases in blue. Label them on your diagram.

DNA controls which amino acids are linked together to form proteins. They also

therefore control which proteins are made in a cell and therefore its features.

The structure of DNA helps it to copy itself every time a cell divides. When DNA

makes a copy it is called DNA replication.

In 1985, scientist Alex Jeffreys developed a way of using DNA to identify people called‘DNA fingerprinting’. The process produces a pattern of bands, like a barcode, which

is unique.

3



Question: Suggest one reason why muscle cells have a lot of mitochondria.

Muscle cells have a lot of mitochondria so plenty of respiration can take place can take

place providing the cell with plenty of energy.

Question: From where does the body get its supply of amino acids?

Either from meat or fish (Essential proteins – ones the body cannot make) or it

produces them in the liver.

Question: Explain how DNA can be used to catch a thief.

DNA fingerprinting can be used to compare the DNA from the suspects with the DNA

found at the crime scene.

Question: What is a gene and what does it code for?

A gene is the chemical compound which makes up a person. They are found in the

nucleus made up of DNA and the chromosomes.

DNA replication

Question: Complete the following text using the words that follow:

4



When DNA replicates, the two polynucleotide strands unwrap. This exposes strands of

the nucleotides.

Floating about in the nucleus are free nucleotides. The bases of these free floating

nucleotides bonds to the exposed bases on the two strands.

Complementary bases pairing occurs, guanine bonds to cytosine and adenine bonds to

thymine.

A new polynucleotide strand is formed around each of the original strands which wraps

around them forming two double helical DNA molecules.

Possible words: wrap, cytosine, thymine, unwrap, bases, nucleotides, strands

Protein synthesis

The order of bases in a section of DNA is called the base code. Each three bases code

for an amino acid. For example the sequence ‘CAA’ codes for an amino acid called

valine. Cells use these base codes to join amino acids together in the correct order. If an amino acid is missing from the diet, the liver can change other amino acids into

those that are needed.

Question: The body needs 20 different amino acids to make proteins. Explain why we

do not need to eat all 20.

The liver also produces some amino acids which means that we do not need to eat all of

the 20 required amino acids.

Question: How many amino acids are coding for the following section of DNA?

AAATATCTCCCCTCAACCGGGCGGTAAATG

Three bases make up one amino acid, there are 30 bases which would therefore make

10 amino acids.

5



Question: Write down the complementary base sequence for the section of DNA shown

in the previous question.

TTTATAGAGGGGAGTTGGCCCGCCATTTAC

Making cheese

When making cheese from milk.

• First milk is allowed to turn sour using an enzyme called rennin. Rennin is an

enzyme.

• The milk separates into a solid called ‘curd’ and a liquid called ‘whey’.

• The curds are then turned into cheese.

Did you know?

Clothes washing detergents use enzymes to speed up the break down of stains. Lipase

enzymes break down fat stains. Protease enzymes break down protein stains.

An enzyme is a biological catalyst. It is a protein that speeds up a biological reaction.

Enzymes catalyse most chemical reactions occurring within cells, such as respiration,

photosynthesis and protein synthesis. Each enzyme is specific to a substrate.

In an enzyme-catalysed reaction, substrate molecules are changed into product

molecules.

The effect of temperature on the rate of an enzyme controlled reaction

The graph below shows how the rate of a typical enzyme catalysed reaction varies with

temperature.

Question: Match up the half sentences appropriately. The first has been done for you

6



Stage 1: label this stage on your graph

Stage 2: label this stage on your graph

Stage 3: label this on your graph after completing the text below.

As temperature continues to increase, the speed of movement of the substrate andenzyme molecules also continues to increase. However, the enzyme molecule is also

vibrating more and more energetically. Above a certain temperature called the

optimum temperature, bonds between R groups of amino acids holding together the

tertiary structure of the active site, begin to break down. The first of these bonds to

break are the hydrogen bonds.

As this continues, substrate molecules bind into the active site and form product less

efficiently. Eventually, a point will be reached when the enzyme-substrate complex can

no longer be formed because of the extremely deformed nature of the active site. The

enzyme is then said to be denatured . (label this on the graph on page 12).

An enzyme catalyses a reaction at a maximum rate when at the optimum temperature.

Most human enzymes have an optimum temperature of about 40 degrees Celsius.

Homeostatic mechanisms within our bodies try to ensure that our body temperature

does not exceed this temperature.

Enzymes from other organisms may have different optimum temperatures. Some

enzymes, such as those found in bacteria which live in hot springs, have much higher

optimum temperatures. Some plant enzymes have lower optimum temperatures,

depending on their habitat. The optimum temperature of enzymes in an organism

therefore limit where it can live on this planet.

Possible words: energetically, denatured, temperature, bacteria, breakdown, plant

Questions

7

(1) At low temperature molecules are moving relatively

slowly

(2) This is because the billions of the reaction takes place only slowly

(3) Substrate molecules will not

often collide with the active site

and so binding between substrate and

enzyme is a rare event

(4) As temperature rises, the enzyme and substrate molecules

bind faster

(5) Collisions happen more

frequently

so that the reaction can occur

(6) Moreover, when they do

collide, they do so

so substrate molecules enter the active

site more often.

(7) This makes it easier for the

bonds to be broken

with more energy



(a) A boy has a very high fever. How might this be dangerous?

If he has a very high temperature, it is a sign of an infection which could be passed on

to other people.

(b) How would a protease remove a bloodstain on clothes?

Protease is an enzyme which digests proteins and since blood is mainly made out of

proteins, the stain should be easily removed.

© Most biological washing powders are recommended for use at low washingtemperatures. Why is this?

The enzymes may work best in those particular conditions due to their own optimum

temperature.

(d) Washing powder manufacturers have produced proteases that can work at higher

temperatures than 40 degrees Celsius. Where do these enzymes come from and why is

this useful?

These enzymes may have been engineered to work at a particular temperature eg. 40

degrees Celsius. These would be useful so that you would not have to specify a

temperature in the wash.

pH and enzyme activity

Most enzymes work fastest at pH of somewhere around 7 i.e. fairly neutral

conditions.

Questions: Which enzyme works fastest in acidic conditions?

The enzyme in your stomach.

The graph above shows the rate of reaction of an enzyme such as salivary amylase. If

the pΗ becomes too alkaline or acidic, the bonding between R groups of amino acidsholding together the active site (particularly hydrogen bonds), are broken. If this

becomes extreme, then the enzyme will no longer convert substrate to product and will

become denatured.

Question: Label the optimum pΗ and the pΗ , which causes the enzyme to become

denatured, on the above graph.

How enzymes work – the lock and key theory

8

Optimum pH

Denaturing pH



Question: Colour the above diagram as follows:

(a) enzyme = green (b) substrate = blue (c) product = red

It can be seen from the diagram that the enzyme is unchanged after it produces product

molecule/s. The rate of an enzyme controlled reaction is dependent on the rate at which

substrate can (a) enter and then bind to the active site to form an enzyme-substrate

complex (b) form product and then (c) leave to allow another substrate molecule to gain

access. This can be very rapid e.g. an enzyme of catalase can split hydrogen peroxide

into water and oxygen at a rate of 7

10 molecules of hydrogen peroxide / second.

The enzyme is like a lock and the substrate a keyQuestion: What could increase the rate at which this happens?

The amount of substrate, if increased would also make the rate of the lock and key

mechanism increase.

Denaturing enzymes

If the shape of an enzyme changes it can no longer catalyse a reaction. The enzyme has

become denatured. The substrate can no longer fit into the active site. An enzyme can

be denatured by the follow:

• Extremes of pH: Each enzyme has an optimum pH at which it works most

efficiently. At this pH, the active site and the molecule are a perfect fit. The

further away from this pH, the more the enzyme molecule distorts and the less

perfect the fit is. Eventually the substrate can no longer fit and the enzyme is

denatured.

• High temperatures: As the temperature increases, the molecules gain more

energy. More collisions occur / second and the rate of the reaction increases.

Above the optimum temperature, the enzyme denatures and the reaction stops.

Question: Biological washing powders contain enzymes. Explain why the washing

powders may become inefficient at high temperatures.

9



At high temperatures, the enzyme may become denatured and will not work.

Question: Pepsin is an enzyme found in the stomach. It breaks down proteins into

amino acids. Draw a diagram to explain why pepsin cannot break down starch.

Diffusion

Moving substances in the body

To stay alive the body needs to move lots of different substances in and out of cells

across the cell membrane.

• When we breathe in, oxygen moves from the lungs into red blood cells. It then

moves from the red blood cells into body tissue.

• Carbon dioxide moves from body tissue into the blood. Then it moves from the

blood into the lungs.

• After eating, digested food molecules move from the small intestine into the

blood. They then leave the blood and go into body tissue.

10



Question: Substances move in and out of different parts of the body. What do

substances have to pass across to get in and out of cells?

Substances have to pass synapses to reach other parts of cells.

Question: Consider a red blood cell. Describe its journey from lungs to body tissue and back. Explain what it does.

What is diffusion?

Diffusion is the movement of a substance from a region of high concentration to a

region of low concentration.

Diffusion in the body


11



Molecules enter and leave cells because of diffusion. The molecules travel across the

semi-permeable membrane from a high concentration to a lower concentration.

• Alveoli in the lungs have a higher concentration of oxygen than the blood that

surrounds them. The oxygen diffuses into the blood. Carbon dioxide diffuses

from the blood into the alveoli (why?). We breathe in an out using muscles and

it maintains these concentration gradients to allow gaseous exchange to

precede.

• After eating there will be a high concentration of digested food molecules in thesmall intestine. This causes the small digested food molecules to diffuse

through the cells of the small intestine wall into the blood.

Possible words: wall, digested, precede, cells, concentration, oxygen, diffuses.

Question: What is meant by diffusion gradient?

The diffusion gradient is the rate at which diffusion occurs according to many different

variables eg. Diffusion distance.

Question: What is meant by gaseous exchange?

Gaseous exchange takes place in the alveoli and is the exchange of oxygen and carbon

dioxide being taken in or expelled from the body.

Question: Why should oxygen continue to diffuse from alveoli to blood and whyshould carbon dioxide diffuse from blood to alveoli?

12

Breathing makes sure that there is always a highconcentration of oxygen in the alveoli.

A good blood supply ensures that as soon as the oxygen

diffuses into the blood it is replaced with blood containingvery little oxygen.

The alveolus wall is only one cell thick so the gases do not

have to travel far.

Alveoli membrane is permeable to gases and is also moist,which helps to speed up diffusion.

There are large numbers of alveoli; this increases the

surface area so moremolecules can move across at

an one t me.



This is needed so the oxygen that is needed is taken into the body whilst diffusing

through the blood to the alveoli ready for the gaseous exchange.

Question: Explain why fibre molecules do not diffuse through the small intestine wall.

Fibre molecules are too large for diffusion and are not needed to pass through to the

small intestine.

Changing the rate of diffusion

When molecules in a liquid or gas spread out as they move in all directions. This isknown as the random movement of molecules. However most of the molecules will

move from a high concentration to a low concentration.

Hence, diffusion is the net movement of particles from an area of high concentration to

an area of low concentration due to the random movement of individual particles.

The rate of diffusion can be increased by:

• Increasing the surface area

• Decreasing the diffusion distance

• A greater concentration difference

Adapted for diffusion

Diffusion takes place in villi in the small intestine and alveoli in the lungs. Both have

special adaptations to increase the rate of diffusion.

13



Question: Colour cells of the wall of the villus in yellow and the blood vessels in red.

Question: Explain why an increase in the surface area of the small intestine increases

the rate of diffusion.

An increase in the surface area to volume ratio in the small intestine means that you

can diffuse quicker as there is a larger area to spread the diffusion around the areas.

Question: Explain how carbon dioxide is removed from the body. Include the

following words in your answer: diffusion, concentration, and breathing.

Whist breathing you need oxygen for many life processes. The oxygen diffuses into the

alveolus and with respiration; carbon dioxide is a waste product. This is needed to be

expelled from the system and due to the large concentration of it, it is needed to take

out of the system by using gaseous exchange. The carbon dioxide is then expelled by

breathing out.

14



More on moving substances

Diffusion is important when it comes to moving substances into and out of the whole

organism.

Keeping a foetus alive

A foetus growing inside the mother’s uterus needs food and oxygen to stay alive. Food

and oxygen pass from the mother’s blood by diffusion.

The foetus makes carbon dioxide and other wastes. These wastes pass from the foetus

into the mother’s blood.

Movement of substances in plant leaves

Plants use carbon dioxide for photosynthesis. They get carbon dioxide from the air by

moving it in through the leaves. At the same time, oxygen moves out of the leaves.

Plants also lose water. This is lost by evaporation from the surface of the leaves.

Question: Name two substances that move from a foetus into the mother’s blood.

Carbon dioxide and waste.

Question: Name two substances that move from the mother’s blood into a foetus.

Oxygen and food and nutrients.

Question: Why do plants need carbon dioxide?

Plants need carbon dioxide for respiration and the CO2 is also needed for

photosynthesis to create their own energy source.

15



Diffusion and the placenta

The diagram above shows how closely the mother’s blood vessels are close to those of

the foetus. Notice how the blood does not mix since mother and foetus often have

different blood groups.

Question: Shade over that part of the diagram, which belongs to the foetus with a

yellow coloured pencil

Question: Label the arrow / s that show dissolved food and oxygen passing into the

foetus’ blood by diffusion.

Question: Label the arrow / s that show carbon dioxide and waste products passing out

of the foetus’ blood by diffusion into the mother’ lymphatic system which then drains

into her blood system.

Question: Why is diffusion both ways possible?

It is possible as the mothers blood vessels are close to those of the foetus and therefore

the close of either diffusion is possible due to this fact.

Question: Why would it be dangerous for the mother’s blood and foetus’ blood to mix?

If their bloods mixed and they had different blood groups, the mother or the foetus

could be killed due to the foreign blood.

16



Diffusion and the leaf

Plants use up carbon dioxide during photosynthesis. The concentration of carbon

dioxide inside a leaf is low during photosynthesis. The higher concentration of carbon

dioxide in the air around the plant causes the gas to move into the leaf by diffusion. It

diffuses through the small pores called stomata. During photosynthesis, oxygen levels

increase inside the leaf. This causes oxygen to diffuse out of the leaf into the air.

Inside a leaf, there are lots of air spaces. Water vapour collects inside the air spaces,

diffuses out of the leaf through the stomata and evaporates. More water, brought to the

leaf in the xylem vessels from the roots, replaces the lost water .

Possible words: water, stomata, diffuses, diffuse, pores, oxygen

Question: The diagram above shows the different tissues in the leaf.

(a) Label (and colour where appropriate) this diagram as follows

(1) waxy cuticle (light green) (2) palisade mesophyll cells (label the internal

structure of one of these cells in detail i.e. cell wall (light green), membrane,

chloroplasts (dark green), cytoplasm (yellow), vacuole (3) spongy mesophyll cells

(4) stoma (5) guard cells (6) phloem cells (7) xylem cells (cell wall colour dark

green) (8) air space

Question: Show with labelled arrows the direction of the gases previously mentioned.Remember to also include the movement of water vapour as it enters the air spaces by

evaporation from surrounding cells.

17



Question: Explain why the placenta is so important to a developing foetus.

The placenta is a protective cushion for the foetus and allows for diffusion to happen

between the mother and the foetus otherwise the foetus would not get the

nutrients/oxygen that it needs or get rid of the waste products eg. CO2.

Adapted for diffusion

The placenta

It is important to move substances across the placenta as quickly as possible. To speed

up movement the placenta has:

• A very large surface area

• A very thin wall so substances only have a short distance to diffuse.

The leaf

To increase the rate of gaseous exchange, the leaf has a large surface area. The under

surface of the leaf also has many stomata through which the gases can diffuse.

Synapses

A synapse is a gap between two neurones (nerve cells). To carry a signal from one

neurone to the next, the synapse releases a transmitter substance. This is a special

chemical that can diffuse across the gap between the two neurones. When it reaches the

other side of the synapse, it causes an impulse to travel along the neurone.

Question: Using the above diagram, explain how a signal transmits from one neurone

to another.

The electrical impulse, is carried by a neurotransmitter substance, acetylcholine. This

diffuses across the synapse from the Synaptic vesicle and then passes through to the

postsynaptic membrane.

Question: During pregnancy, part of the placenta could break away from the uteruswall. Explain why this could harm the foetus.

The foetus could become deprived of the substances that are crucial for its growth and

healthy development of the foetus.

18



Question: Explain why there is less diffusion of gases through the upper surface of a

leaf compared with the lower surface.

The upper surface is waxy and therefore is unable to diffuse well, also, there is no

stomata (gaps) in the top of the leaf so that not as much water is lost through normal

matters.

Question: Transmitter substance is only made on one side of a synapse. Suggest one

reason for this. It is only made on one side so that the electrical impulses can travel faster to its

maximum efficiency as diffusion is the net movement of particles from an area of high

concentration to an area of low concentration.

Keep it moving

Scientists have now cloned genetically engineered pigs. They hope these pigs will

provide new hearts for humans without the risk of rejection.

Is blood really red?

Question: Complete the following table showing the different parts of blood and their

functions using the text boxes that follow:

Part of blood Function

Red blood cells

White blood cells

Platelets

Plasma

Red blood cells do not have a nucleus. This leaves more room to carry oxygen. They

are disc shaped and have a dent on both sides. This helps them to absorb a lot of

oxygen by increasing their surface area.

Red blood cells are very small so they can carry oxygen to all parts of the body.

19

This is the liquid part of the blood, which transports substances. It ismainly water containing dissolved substances such as hormones, glucose,

amino acids, antibodies, wastes such as carbon dioxide and urea.

These cells are adapted to change shape. They can wrap around microbes

and engulf them. They can squeeze through capillary walls to reachmicrobes.

These cells are adapted to carry as much oxygen as possible. Their red

colour comes from haemoglobin. Oxygen joins to haemoglobin, whichallows it to be trans orted around the bod .

These are tiny cell fragments, which help to clot the blood when we cutourselves.



Blood vessels

Arteries transport blood away from the heart.

Veins transport blood to the heart

Capillaries join arteries to veins. Materials such as oxygen are exchanged between the

capillaries and the body tissue.

White blood cell engulfing bacteria.

Question: Explain the ways that blood cells are adapted to their function.

The blood cells can change their shape to engulf pathogens or bacteria and they have

many different uses as there is red and white blood cells.

Question: Explain why white blood cells need to be able to change shape.

They need to change shape otherwise they’ll only be able to kill select bacteria’s and

they need to kill all of them.

Did you know?

Red blood cells are so small 5 000 000 000 will fit into 1 cm cube!

Urea is carried in the Plasma of the blood, along with Carbon Dioxide. (Colour the

blood vessels carrying O2 RED, those carrying CO2 colour blue)

Question: What passes from the capillaries into cells?Oxygen would pass from the capillaries in to the cells as the cells needed to be fuelled

with a substance.

Question: What passes from the cells into the capillaries?

20



Carbon dioxide as it needs to be expelled from the system and is now of no further use.

More on red blood cells


The shape of a red blood cell means it has a large surface area compared to its volume.

This enables it to absorb a lot of oxygen.

Haemoglobin found in red blood cells, reacts with oxygen in the lungs to form

oxyhaemoglobin. When it reaches tissue it separates into haemoglobin and oxygen.

The oxygen diffuses into the tissue cells and the red blood cells return to the lungs to

pick up more oxygen.

Possible words: lungs, haemoglobin, surface, oxygen

Adaptation of blood vessels

Question: complete the following table:

Table showing the main structural differences between a small artery, a small veinand a capillary

Small artery Small vein Capillary

21



Tunica externa Contains collagen and

some elastic fibres

Mostly collagen fibres

Tunica media Contains elastic and

collagen fibres and

smooth muscle

Very thin containing

some smooth muscle and

collagen fibres

Tunica intima Made of endothelium

resting on a thin layer

of elastic fibres

Thinner than artery

Lumen Relatively narrow Relatively large Big enough for a red

cell to squeeze through

Arteries

The function of the arteries is to transport blood swiftly at high pressure to the tissues.

The structure of the artery wall enables arteries to do this for the following numbered

reasons:

Question: In what ways is the artery designed to aid the flow of blood?

The elastic recoil of the artery walls propels blood along the artery allows the blood to

flow through the arteries with ease and at a good pace.

Question: Why is oxyhaemoglobin such an important molecule and where does it come

from?

Oxyhaemoglobin is made of the haemoglobin in the red blood cells and oxygen. It is

important as it can only be transported around the body when it has been bonded together.

Question: Why are the walls of capillaries permeable?

22



The walls of capillaries are permeable as the red blood cells need to get through them

well and with maximum efficiency.

What does the heart do?

Question: complete the text using the words from the previous diagram

The mammalian cardiovascular system consists of large veins, which are collectively

termed the transport system. These carry deoxygenated blood from the cells in the

body and deliver it to the right atrium. This contracts forcing this blood into the right

ventricle. The right ventricle contracts and forces the deoxygenated blood into the

lungs through the pulmonary artery. Carbon dioxide is removed from this blood andreplaced with oxygen.

This oxygenated blood then passes back to the heart through the pulmonary vein.

It enters into the left atrium of the heart. The circulation of blood from heart to lungs

and back again is called the pulmonary circulation.

The left atrium contracts and forces oxygenated blood into the left ventricle. This is a

very muscular chamber which contracts forcing this oxygenated blood all around the

body through a major artery called the aorta. The circulation of blood from heart to

body and back again is called the systemic circulation.

This combination of pulmonary circulation and systemic circulation makes a

double circulatory system

The circulatory system in the fish comprises of a single systemic system with a single

ventricle pumping deoxygenated blood to all cells in the organism including the

respiratory surface (which then becomes oxygenated) and a single atrium receiving all

the blood after it has been deoxygenated by the body’s cells.

The advantage of a double circulatory system is that:

(1) There are four muscular chambers helping to force blood around the bodyrather than two, so the overall pressure on the blood will be higher

23



(2) The left ventricle is only acting on that volume of the blood which being

forced to the body cells excluding the lungs. This makes the systemic

pressure that it generates so much greater.

Question: How might a greater systemic blood pressure (and therefore a faster rate of

delivery of blood to cells) be an advantage to an organism that has a double blood

circulatory system (reptiles, birds, mammals)?

It is an advantage as the greater blood pressure will allow the oxygen, waste products

and nutrients able to pass through the system quicker and with better efficiency.

The vessels making up the blood system are of three main types. These vessels are

shown previously in transverse section. Vessels carrying blood away from the heart are

known as arteries, while those carrying blood towards the heart are veins. Linking

arteries and veins, taking blood close to almost every cell in the body, are tiny vessels

called capillaries.

Question: Arteries normally carry oxygenated blood and veins deoxygenated blood.

What are the exceptions?

The capillaries, as they link the arteries and veins together.

Question: colour all blood vessels carrying deoxygenated blood in blue and vessels

carrying oxygenated blood in red.

Heart problems

Blood flows through arteries at high pressure. Saturated animal fats such as cholesterol

can stick to the walls of arteries. As it builds up it forms a plaque that restricts the flow

of blood. Some of this cholesterol can break away and block the artery completely.

This can slow down or block the flow of blood. If this happens in a main blood vessel

it can cause a heart attack or a stroke.

Mending the heart

The heart or parts of the heart can either be replaced mechanically or biologically.

• Mechanically: Sometimes the heart valves do not work properly or they wear

out. Special mechanical valves are used as replacements

• Biologically: If the heart breaks down completely, a heart transplant is needed.

Question: Which side of the heart pumps blood to the (a) lungs (b) rest of body?The right side pumps blood to the lungs and the right side to the rest of the body as the

right side is more muscular and able to do so.

Question: Describe how cholesterol can cause a heart attack and what can be done in

these circumstances.

Cholesterol can be built up in the veins and arteries over time and this can raise blood

pressure to dangerous levels. This would then cause a heart attack. This can be helped

be decreasing the amounts of unhealthy foods in your diet and if exercised more often.

Structure and function of the heart

Humans have a double circulatory system of arteries, veins and capillaries

• One circuit links the heart and lungs (pulmonary)

24



• One circuit links the heart and the body (systemic)

Did you know?

Even though a human heart weighs only 300g it beats about 2500 million times in a

lifetime!

Colour the oxygenated blood in red and the deoxygenated blood in blue on the

diagram.

25



Use the previous

diagrams to help you complete the following text:-

Starting with the cells in the head and the rest of the body, much Carbon Dioxide is

produced by the process of R espiration. This is a poison and can kill cells. It is

therefore carried away with the blood through Veins back to the heart. The major vein

in the body is called the Vena Cava (show this on the diagram).

The Vena Cava drains deoxygenated blood (oxygen has been removed by the cells and

replaced with CO2) into the R ight Atrium of the heart (show this on your diagram).

By the way veins are incredible blood vessels. They have to return blood all the way up

from the legs to the heart against the pull of gravity! Why doesn’t the blood just fall

back downward to the legs? Well, the reason is that veins contain a series of Valves.

Valves allow the blood to flow to the heart but close up and prevent backflow!

The valve that ensures that the deoxygenated blood travels in one direction from right

atrium to right ventricle is called the tricuspid valve (show this on the diagram). Once

the deoxygenated blood is in the R ight Atrium of the heart, then this chamber contracts.

It forces this blood into the R ight Ventricle of the heart (show this on your diagram).The heart is able to contract because it is made up of contractible Muscle fibres. Now

the Right Ventricle is a strong muscular chamber (thick muscular walls). When it

contracts, it forces the deoxygenated blood through the Pulmonary Artery to the lungs.

A valve in the pulmonary artery called the semi lunar valve (show this on the diagram)

prevents backflow into the right atrium.

In the lungs the carbon dioxide in the blood is removed from the blood and replaced by

O xygen. It then passes back to the left atrium through the Pulmonary Vein. The left

atrium contracts, forcing oxygenated blood through the bicuspid valve (show this on

your diagram) into the left ventricle. This then pumps oxygenated blood around the

body through the aorta.

26

Valve allows blood

flow upwards

Veins (e.g. vena Cava)

have thinner walls than

Arteries

Valves close up to prevent backflow!



Now the aorta carries the Oxygenated blood to all the cells in the body. There therefore

are two blood circulatory systems:

1) Blood travels from the heart to the lungs and back again. This is the pulmonary

blood circulatory system.

2) Blood travels from the heart to the rest of the body and back again.

Blood flows to the digestive system (intestines). The blood vessels surround the small

intestine and permeate into the villi. The cells of the small intestine use up the oxygenin respiration and the digested food (glucose, amino acids) pass into the blood vessels.

This food is then carried to the Lungs.

Question: Hang on! When the Right Ventricle contracts - blood is forced through the

pulmonary artery BUT what prevents backflow into the right atrium?

The valves inside the chambers in the heart, the tricuspid and bicuspid valves.

Once the blood has been oxygen in the lungs (and CO2 removed) it is sent back to the

heart through the Pulmonary Vein

Question: An artery carries blood away from the heart. What is so different about the

blood in the Pulmonary Artery compared to the blood in all other arteries?

It takes blood from the heart into the lungs.

Question: Why should the right ventricle wall be thinner than the left ventricle wall?

As it has to pump blood to the rest of the body rather than only to the lungs.

Question: A Vein carries blood towards the heart. What is so different about the blood

in the pulmonary vein compared to all the other veins?

It takes blood from the lungs to the heart.

Treating heart disease


Coronary arteries (which extend away from the aorta) supply the heart with food and

oxygen (show this on the diagram of the double circulatory system). Too much

cholesterol in the diet can lead to the blockage of a coronary artery. This can cause

serious heart problems and even the need for a heart transplant. There are problems

with heart operations.

In heart transplants the donor heart needs to be a close match in size, age and tissue

type. As the supply of donor hearts is limited and irregular, the chances of getting a

27



suitable heart are low. After a transplant there is the possibility of rejection and the

patient must take drugs to stop their immune system attacking their new heart.

Mechanical replacement valves are very small and difficult to fit. Pacemakers can be

attached to the heart to help it beat. However, they need internal batteries that have to

be replaced. There is also the chance of rejection.

Words: batteries, rejection, mechanical, heart, donor, supply, operations, heart, food,

cholesterol

Question: List the structures that blood passes through as it travels from the vena cava

to the aorta.

Blood passes from the vena cava into the pulmonary vein and into the heart where it is

then passed to the lungs. Out the lungs then into the pulmonary artery and into the

aorta.

Question: Name three different valves found in the heart and describe the function of

each.

The bicuspid valve helps keep the blood moving as does the tricuspid valves. The semi-

lunar valve prevents backflow into the right atrium.Question: Explain the problems of eating a diet rich in cholesterol.

The cholesterol can build up and can cause a heart attack which will then cause many

future problems possibly even death.

Question: Suggest two ways to reduce cholesterol in blood.

Eat a healthier diet and exercise more often for longer/more frequent intervals.

Question: Some babies are born with a hole between the two ventricles in their heart.

Suggest why their muscles would receive less oxygen.

The blood could become back-flowing and could prevent the blood flowing correctly

which would interrupt the amount of blood that is oxygenated and travels to the organs

correctly.

Question: Describe the advantages and disadvantages of a pacemaker and heart valves

over a heart transplant.

A pacemaker isn’t as reliable and you need replacements every so often at regular

intervals however, they are a good way to prevent any further medical conditions.

Replacement heart valves are good in the short term but do need to be replaced. Heart

transplants are good in long terms but you would need to take immunosuppressant’s

and it is not guaranteed that you would get a suitable donor for your heart

replacement.

Divide and rule

Using a plastic frame under the skin of a mouse to provide a growing frame and a blood

supply, scientists can grow human cartilage and skin cells into the shape required. The

ability to grow something that looks like an ear can now help accident victims who

need cosmetic surgery.

28



Every day thousands of skin epidermal cells are lost from the skin. They are

continuously rubbed off. All of these cells need to be replaced. To make new cells the

body carries out cell division. Cells divide whenever the body needs to:

• Grow

• Replace worn out cells

• Repair damaged tissue.

Question: Find out what dust is made of.

Dust is made of dead skin particles and dirt molecules.

The more cells the better

Question: Complete the table using the text boxes that follow:

Organism Advantage DisadvantageSingle-celled

29

Simple requirements to maintain life Size is limited and so too is their complexityand ability to be aware of surroundings and

res ond to stimuli



Multicellular

Dividing cells

What is the relationship between alleles and chromosomes?

Now remember, alleles are genes and genes are long strands of DNA, coding for a

particular feature in an organism (protein), and they are found next to each other in long

strands called chromosomes. Chromosomes can be paired together, if they have the

same length and shape, and contain similar pairs of alleles as shown below:

Question: Consider the pair of chromosomes above with pairs of alleles coding for

similar features shown above (B =brown eye allele, b = blue eye). What is the

phenotype that this genotype will code for?

_____________________________________________________________________

30

Can grow large. Cells become differentiated totake on specialised roles. They work together

performing particular function (tissue) andtissues work together in a major role (organs).

Organs cooperate together in organ systems.Thereby organisms become more (1) aware of

surroundings (2) respond to stimuli moreeffectively.

Need to develop mechanisms to transport

food, water and oxygen faster becausediffusion alone cannot supply them fast

enough.



Pairs of chromosomes containing pairs of alleles that code for the same feature are

called homologous chromosomes. A cell that contains the full complement of all the

chromosomes and therefore genes, which can code for all the features in that organism

is called a diploid cell. When diploid cells divide into two daughter diploid cells, we

say that a type of cell division called mitosis has occurred.

Question: Every human cell has thousands of genes (and therefore alleles), located on

46 chromosomes in their nuclei. How many pairs of homologous chromosomes does

every human cell contain?

This depends on whether the person ahs dominant or recessive characteristics.

Question: If a nerve cell, eye cell, foot cell, all contain the same number of

chromosomes and genes, why then do they look different to each other?

They have been specialised to their own purpose not the purpose of the similar cell

depending on where they are within the body.

Question: Which type of human cell does not have chromosomes?

Stem cells

All living cells require a supply of nutrients, such as glucose. Most living cells also

need a constant supply of oxygen. There will also be waste products, such as carbon

dioxide, to be disposed of. Very small organisms, such as Paramecium, can meet their

requirements for the supply of nutrients and oxygen, and the removal of waste products,

by means of diffusion. The very small distances across which substances have to

diffuse, means that the speed of supply or removal is sufficient for their needs. These

tiny organisms have a large surface area compared to their total volume, so there is a

relatively large area of membrane across which gases can diffuse in and out of their bodies. However, what happens when organisms get larger? Will they still have a

relatively large enough outer surface area over which gases can diffuse sufficiently

quickly enough to reach all parts of their increased volume (and mass)?

31



Question: Consider a 1cm cube. Lets pretend that it is a small organism. Calculate its

surface area, volume and surface area: volume ratio. Now lets double its dimensions to

produce a larger cube whose sides are 2cm in length (a larger organism). Calculate its

surface area, volume and surface: area volume ratio. What do you notice?

______________________________________________________________________

______________________________________________________________________

______________________________________________________________________

______________________________________________________________________

______________________________________________________________________ ________________________________________________________________

Question: The following diagrams show the different stages of mitosis. Copy the

correct text box next to each diagram.

32

The chromosomes get much

shorter and fatter, so they can

now be seen with a light

microscope. Each chromosomeis made up of two threads of

DNA joined by a centromere.

Before the cell divides, the

chromosomes in the nucleusare very difficult to see because

they are very long and thin.

The threads make up two

groups and a nuclear

membrane forms around each

group. The cell splits into two.Later each thread will make an

exact copy of itself to form

chromosomes made of two

threads again.

The chromosomes line up

along the centre of the cell.Their two threads split apart,

and move to opposite ends of

the cell.



Question: Does an elephant or a mouse have a smaller surface area to volume ratio?

A mouse.

Question: Suggest why a large surface area to volume ratio is an advantage to an

amoeba.

It needs to photosynthesise to its maximum efficiency.

Question: Give examples of the types of human cell that will undergo (a) mitosis (b)

meiosis. Mitosis could happen in a large cut where the skin needs to be replaced. Meiosis

happens in the male testis to make sex cells.

Sunny-side up

The diagram below shows an unfertilised hen’s egg.

Question: Complete the following table using the labelled hen diagram to help you.

Part of hen’s egg Function

Yolk Fatty food full of energy for developing embryo

Chalaza Holds the yolk in place. This is a strand of twisted albumin

Shell Hard outer structural substance that protects the entire egg

Germinal diso Protein food for developing embryo

33



Question: During Years 7 and 8 we learned a little about the principles of sexual

reproduction. To help us to recap this, complete the following text using the words that

follow.

During sexual reproduction, special types of cell called sex cells or gametes must fuse

together. This joining of gametes is called fertilisation and produces a fertilised egg

called a zygote. This zygote then divides many times to form a ball of cells and then

either an embryo (animal) or a seed (plant).

The male gamete in animals is called a sperm and in plants it is called a pollen grain.

The female gamete in animals is called an ovule and plants is called an egg .

Possible words: Ovule, egg, sperm, pollen, gametes, fertilisation, seed.

Egg

• An egg is much larger than a sperm because it contains food for the developing

embryo

• The nucleus of an egg contains genes, which are instructions to make new cells.

Sperm

• A sperm is much smaller than an egg.

• It has a tail to help it to move

• A male releases millions of sperm to increase the chance of one reaching an

egg.

• The nucleus of a sperm contains genes, which are instructions to make new

cells.

Question: Highlight the key differences between a male gamete (sperm) and a female

gamete (egg).

The male gamete is much smaller and is released in massive numbers as for more

chances of fertilisation. The female gamete is much larger and is only released one at a

time, once each month.

Lets now see how fertilisation enables alleles to come together within a zygote!

34



Fertilisation and the restoration of the haploid genotype back to the diploid

genotype


The cells in the testes, which eventually make sperm, and the cells in the ovaries, which

eventually make eggs, have the same number of chromosomes as every other cell in the

human body (except sperm and egg themselves). This number is 46 and correlates to

23 pairs of homologous chromosome. This is called the diploid number of chromosomes and this number of chromosomes contains all the genes necessary to

make a complete human being.

These cells will eventually divide and produce gametes that contain half this diploid

number. We say that gametes contain the haploid number of chromosomes. The

process whereby cells divide to produce gamete cells is called meiosis.

A single sperm or egg does not therefore contain all the genes and therefore genetic

information on their own to make a human being. Sperm and egg must fuse or join

together ( fertilisation) to restore the diploid number back again in a new type of cell

called the fertilised egg or zygote which is derived, partly from the father and partlyfrom the mother. This ensures that new combinations of genes arise in offspring, some

from the father and some from the mother. This produces different features in offspring

causing variation.

Once this new cell has been produced, it must divide into a ball containing countless

billions of cells, which will produce the embryo. However, this type of cell division

must arise in new cells which all have the diploid number of chromosomes so that they

have sufficient information to make the new baby. This type of cell division is called

mitosis.

Possible words: mitosis variation fertilisation zygote, meiosis, haploid, diploid

Question: Explain what is meant by mitosis.

Mitosis is the exact replication of cells so they are produced genetically identical to al

of the other cells in the body.

Question: Explain what is meant by meiosis.

Meiosis is the change of the genetic code in four daughter cells to increase variation in

people/siblings.

Moving sperm

Sperm have to travel a long way and then get inside an egg. They are specially adapted

to do this.

• A sperm has large numbers of mitochondria to release energy for motion.

• A structure called an acrosome on the sperm head releases enzymes that digest

the cell membrane of an egg allowing the sperm inside.

35



In the middle piece there are many mitochondria to release energy.

Question: Where in the body does (a) meiosis take place (b) mitosis take place?

Meiosis takes place in the testis or in the ovaries/womb. Mitosis takes place all over the

body to repair the body eg. A large cut on your leg.

Question: If sperm and egg were diploid how many chromosomes would the human

zygote have?

23 pairs, 46 chromosomes.

Question: Explain the function of the following parts of a sperm cell:

(a) mitochondria

The energy source in the sperm cell.

(b) acrosome

Contains enzymes to digest the outer shell of the ovum before fertilisation.

Meiosis and chromosomes

36



Gametes are made when diploid cells divide by meiosis to produce haploid cells:

• Firstly each chromosome (and its genes) replicate. The two replicated strands

are held together at a structure called a centromere (yellow).

• The cell divides into two (meiosis 1) and half the chromosomes go into one

daughter cell and half the chromosomes pass into the other daughter cell.

• Each chromosome splits down its length and each strand (called a sister

chromatid) passes into one of two new daughter cells following another cell

division. Four daughter cells in total are now produced each with half the

original number of genes (haploid number).

Remember, sperm and eggs are produced by meiosis.

Question: Describe in your own words the stages involved when sperm is made inside

the testes.

Each chromosome and its genes replicate. The replicated strands are then held together by the centromere. The cell divides in two and half of the chromosomes go into

one cell and the other half into the other. Each chromosome splits down its length and

each strand passes into one of the new daughter cells following another cell division

immediately afterwards. Four daughter cells have now been made with genetic

differences.

Question: Describe two ways in which meiosis is different to mitosis.

Meiosis creates 4 daughter cells, mitosis only creates 2. Mitosis creates genetically

different cells, meiosis creates cells with different genes (variation).

37



Growing up

If a person damages their nerve cells their body cannot make new ones. However

scientists have found a way to grow human nerve cells in chickens.

They have taken stem cells from human bone marrow and put them into chicken

embryos. Stem cells can develop into other types of cell. Normally stem cells from

bone marrow turn into blood cells. Scientists have found that these cells can turn into

nerve cells in chicken embryos.

However, scientists are still a long way off from using this to replace damaged nerve

cells in the human body.

Changing cells

For a fertilised egg to grow into an embryo and a foetus, the cells need to divide and

change. The cells change so they can carry out different jobs. Some cells turn intonerve cells. Others change into bone cells. This change is called cell differentiation.

Question: Match up each part of a cell with the job it does.

Part of cell Job

Vacuole absorb light energy for photosynthesis

Cell wall contains cell sap and provides support

Chloroplast provides support

Question: What happens to a cell during cell differentiation?

The cell changes its purpose to suit a different part of the inhabiting body.

Question: What are the differences between plant and animal cells?

Animal cells are simpler and only have a cell wall. Plant cells have chloroplasts for

photosynthesis and have the cell wall and membrane.

Animal and plant growth

Animals tend to grow to a certain size and then stop. This is usually faster than plants.

A Blue whale calf can have a mass of 26 tonnes before it is a year old. If a stick insect

grew too much it could be crushed by the weight of its own skeleton.

Question: Why is the delivery of food and oxygen to cells in multicellular animals

faster than that in plants? How is it achieved?

38



The cells are more developed and specialised whereas in plants the cells are all stem

cells without differentiation.

Tissues cooperate together to produce structures that perform major functions e.g.nervous tissue, lymphatic tissue, blood vessels = brain.

Other stem cells are found in the adult. Bone marrow stem cells differentiate into white

blood cells and red blood cells.

Question: What is a stem cell?

They are cells which haven’t differentiated.

Question: What is the difference between differentiated and undifferentiated cells?

Differentiated cells are specialised to d a job whereas undifferentiated cells have no

exact purpose.

Animal cell and plant cell growth

The cells of animals and plants cause them to grow in different ways:

Plant Animal

Most growth is due to cells elongating

(growing longer not dividing)

Growth is due to cells dividing

Cell division only normally occurs at the

tips of shoots and roots

Cell division occurs all over the body

Many cells never lose the ability to

differentiate

Most animal cells lose the ability to

differentiate very early on

Stem cell research

Scientists have found ways of making stem cells develop into other specialised cells in

the hope of replacing damaged cells. However, many people object to stem cell

research because it can involve human embryos. Scientists use embryo stem cells

because they are easier to grow than adult stem cells.

39



This photograph shows the root tip of an onion. The black dots represent the

chromosomes of the root cells in different stages of mitosis.

Question: Describe how growth in a finger is different to growth in a root.

The growth in a root is positively geotropic and can only grow one way; growth in

fingers is more developed and uses mitosis slower but grows in many ways.

Question: What do scientists do with embryo stem cells? Should scientists be allowed

to use embryo stem cells? Give one reason for your answer.

Scientists can study them and use IVF. Scientists should use them as they can help our

understanding of them.

Human growth

There are five main stages of human growth:

(1) Infancy(2) Childhood

(3) Adolescence (puberty)

(4) Adulthood (maturity)

(5) Old Age

Gestation

Gestation is the length of time from gestation to birth – longer in larger animals because

more time is needed to develop and so survive outside the uterus. An elephant has a

gestation period of 700 days and a rat has a gestation of 22 days.

Growth of a baby

Different parts of the foetus and baby grow at different rates. The brain and head

develop quickly to coordinate the complex human structure and chemical activity.

40



Growth curves

After a baby is born it has a regular growth check. The baby’s weight and head size are

recorded. These measurements show if the baby is growing at a normal rate.

Age in

months0 3 6 9 12 15 18 21 24 27 30

Weight in

kg2.5 5.0 6.4 7.5 8.8 9.6 9.8 10.0 10.1 10.4 10.7

Head sizein cm

36.0 41.2 43.6 45.2 46.4 47.2 47.8 48.2 48.6 49.0 49.2

Question: Explain why the gestation period of an elephant is longer than that of a rat.

The organism is larger and heavier and is more developed.

Question: Which parts of a foetus grow quickest and why?

The head would grow quickest as it is where the brain is situated.

Question: Plot a graph of the previous table showing growth rate. Stick your graph in

the space below. Use the graph to determine when the growth rate is fastest.

Question: Girls on average show a rapid increase in height at about 12 indicative of the

onset of puberty. This is evident in boys at about 13, a year later. When girls and boys

reach adulthood at about 18, there is on average no further increase in height.

Suggest what might happen to the height of adults as they reach old age.

Adults can get conditions in old age which causes their posture to weaken and their

backs to keel over in a hump.

Growth problems

Measuring the weight and head size of a baby is very important. The results can be

plotted on a graph and compared with graphs expecting growth.

41



• Poor weight can indicate problems with a baby’s digestive system

• Larger than normal head size can indicate fluid collection on the brain or

separate skull bones not fusing together.

Question: Why should digestive problems affect weight?

Digestive problems would restrict the amount of food being digested and the amount of

energy which gets passed onto the rest of the body.

Question: Which condition relating to abnormal head size could directly affect brain

function?

Fluid on the brain

Controlling plant growth

At the end of the summer many gardeners are faced with handfuls of unripe green

tomatoes. Most gardeners either throw them away or make tomato chutney.

The alternative is to put the tomatoes in a bag with a ripe banana. Over-ripe bananas

release a hormone that ripens fruit.

Plant hormones

Plants make special chemicals called hormones. Hormones control different processes

in a plant:

• Growth of shoots towards light

• Growth of roots downwards into the soil in response to gravity• Growth of flowers

• Ripening of fruit

Plants are sensitive to light, moisture and gravity.

Question: Join lines connecting the first and second statements together:

• Shoots grow towards moisture

• Shoots grow in the direction of the force of gravity

• Roots grow towards light

• Roots grow against (away) from the force of gravity

In order to produce these growth responses, plant cells produce growth hormones called

auxins. These are produced near the growing tips of plants (tips of shoot or tips of

root). They are unequally distributed, moving from one cell to another and accumulate

in specific regions of the plant. There they stimulate more rapid cell division and

growth causing the shoot or root to bend and grow towards or away from the stimulus

in an appropriate manner.

42



Question: Explain what a stimulus is and what stimuli plants respond to.

A stimulus is a environmental condition which causes you to act in a certain way.

Plants respond to gravity and light.

Question: Explain why roots are negatively phototropic.

Roots are negatively phototropic as they need to respond to moisture and gravity, light

isn’t underground so being phototropic would be a pointless quality.

Question: Explain why plant shoots are negatively geotropic Plant shoots need to grow towards light to grow quicker to photosynthesise.

Question: Explain one advantage of a plant shoot growing towards the light.

It would be able to photosynthesise quicker and therefore grow quicker.

Question: Explain one advantage of a plant root growing down into the soil.

It can get more nutrients.

Question: What effect does auxin have on plant cells?

Auxin makes plant cells elongate and stretch towards the light.

Question: Describe a simple experiment to show that cress seeds are positively

phototropic.

43



Plant many cress seeds at different places around a room in different lights and see

which face which way towards the light.

Question: If the tip of a broad bean shoot was cut off and a light source placed to one

side, would the shoot grow towards the light? Explain.

The shoot would grow towards the light as it is needed to grow and photosynthesise to

produce its own food.

Speeding up growth

Farmers can use hormones to either

(a) Make plants grow fruit

(b) Slow down growth. This stops the fruit from falling off the tree before the

harvest.

Question: Highlight all aspects of the previous flow diagram that show the applications

of synthetic auxin with a yellow coloured pencil.

44



B3: hormones

Across

2. Plant hormone produced in the tips of shoots and roots that

stimulate mitosis.4. Control different processes in plants

8. Synthetic hormone in ________ powder helps stimulate mitosisin roots.

10. Plant growth response towards the light by shoots. This would be positive.

12. Roots grow down towards the centre of the earth from whichgravity comes.

14. Stimulate the ovary to develop into a fruit without fertilisation

of ovules with synthetic hormone and these will not develop.15. Hormones can make this ripen.

16. This hormone sprayed onto bananas will cause them to ripen.

17. Hormones sprayed on trees can prevent these from falling.18. A plant is sensitive to this.

Down

1. Type of plant that protects the body from disease.3. Growth of roots is downwards due to this

5. A man made plant hormone called ________ auxin used bygardeners and fruit growers.

6. The seeds from a ginseng plant are this and the hormonegibberellic acid can force germination without a cold period.

7. Growth response in a plant towards or away from a stimulus.9. A plant will grow away from this type of stimulus.

11. Synthetic hormone can make weeds grow themselves to death.13. Part of the flower that contains eggs or ovules.

15. Hormones control the development of __________ and the ripening of fruit.

Question: Complete the following table with one-sentence answers;

45

Possible words: stimuli, ethene, apples,dormant, rooting, hormones, ginseng, auxin,

negative, geotropism, weedkiller, seed, fruit,flowers, synthetic, tropism, gravity, phototropism, ovary



Hormone Use

Synthetic auxin Control the development of fruit

Synthetic auxin Ripen quickly – gardeners, fruit growers

Synthetic auxin Stay fresh to help with slow transport issues

Ethene Controls fruit state

Gibberellic acid Force germination

Question: Suggest one reason why people prefer fruit that has not been sprayed with

hormones.Some could be harmful.

New genes for old

Scientists have identified a protein that stops tooth-rotting bacteria sticking to teeth.

They hope to place the gene that codes for the protein into apples. The apple would

then make the protein and eating an apple would stop the bacteria sticking to your teeth!

Designing a better cow


To breed a cow that has a high yield (quantity) of creamy milk, farmer’s carry out

selective breeding programmes.

• Choose a Jersey cow that produces the creamiest milk.

• Choose a Fresian cow with the highest milk yield.

• Cross-breed these cows by mating a Fresian cow with a Jersey bull and a Jersey

cow with a Fresian bull.

• Select the best cross breeds i.e. the offspring that produce large quantities of creamy milk.

• Repeat the selection and breeding process for a number of generations.

Possible words: selection, mating, cow, Fresian, yield

Change can also happen by mutation. A gene change usually causes harm to the

organism. Haemophilia is a condition in humans where the blood does not clot

properly and it can be caused by a mutation. Down’s syndrome is caused by a mutation

whereby a person has an extra chromosome (additional genes).

Some mutations can be an advantage to an organism giving it a better chance of

survival . For example, bacteria can mutate and become resistant to anti-biotics.

Mutations can be caused by:

• Radiation such as X-rays

• Chemicals such as those found in cigarette smoke.

• Chance.

Possible words: smoke, survival, antibiotics, mutation, clot, mutation, organism.

Question: Describe how a farmer could produce a plant with large sweet strawberries if

she starts with a plant that has small sweet berries and one with large non-sweet berries.

46



She would select the sweetest berries and the largest berries. She would then cross-

germinate them and would produce large, sweet berries.

Question: Describe one example of a mutation that is an advantage to an organism.

Evolution within an organism to suit themselves to their own environments.

Question: Name two things that can cause mutations. A change in the genetic code and the cross breeding of species so often creating a weakened

creature.Problems with a ‘designer animal’

Selective breeding often involves animals that are closely related. This is called

inbreeding. Inbreeding causes a reduction in the gene pool (the different genes

available in a species). With a smaller gene pool there is less variation. For example,

cows could lose genes that could help them survive a new disease.

Some animals are bred to show in competitions. The more an animal is selectively

bred, the more chance there is of harmful recessive genes being expressed.

Bulldogs have been bred with large folds of skin on their faces. This is a recessive

characteristic that reduces the chances of the dogs surviving in the wild because of

problems with their sight.

Question: Why is variation in organisms important?

If there was no variation the species would not be able to evolve and many genetic

abnormalities could be passed on easily.

The problem with mutations

When a gene mutates the DNA base sequence is changed. Spot the change in the

sequence of DNA

Original base code = CACTTGGTCAAA

Mutation = CACTTGTCAAA

Question: What is the difference in the base sequence?

One Guanine bond has been taken out of the sequence.

A change in the sequence changes the protein that is made or even prevents its

production.

Look at the messages:

47



Bring thermos on outing

Bring mothers on outing

‘Thermos’ and ‘mothers’ have the same letters but in a different order. The messages

have different meanings.

In a similar manner, changes in the base sequence can lead to a different order of amino

acids in the proteins that they code for. Cystic fibrosis is caused by a mutation in DNA.Sufferers have breathing problems caused by a change in the base sequence so a

different protein is made.

Question: What might cause this change in the base sequence?

A mutation of the DNA could change the order of the bases.

Selecting the best


Farmers are always trying to make their animals and plants produce more. They

choose animals and plants with the characteristics they want. Then they breed them to produce offspring that have the characteristics.

Plants and animals can also change by a process called mutation. A mutation happens

when there is a change in an animal or plant’s genes.

Possible words: characteristics, breed, plants, animals, mutation, genes

Question: Why do farmer’s want to plant wheat crops that grow quickly?

So they can gain more money from their crops in quick succession.

Question: Why do farmer’s want pigs that produce a lot of baby pigs?

So they can produce more meat and gain more money at one period of time.

Question: Name one characteristic of strawberry plants that is useful to gardeners.

Large strawberries.

Transferring genes

Scientists can take genes from one organism and put them into a different organism.

48



Would a square tomato be useful?

Would bacteria modified to produce insulin be useful?

Scientists have put a jelly-fish gene into mice. This makes the mice glow in the dark!

Question: Suggest how the following may be useful.

(1) A square tomato.

Useful for growing competitions.

(2) Maize that is resistant to weedkiller.

Useful to farmers who want weeds to be killed but their crops still okay.

(3) Bacteria that produce insulin.

Useful for those that suffer with diabetes to replace some of their lost insulin.

Question: Copy and replace the sentence using some of the words that follow.

When a scientist takes genes from one organism and puts them into another it is called

genetic engineering .

Possible words: cells, genes, genetic engineering, genetic patchwork

What happens in genetic engineering

In genetic engineering, the DNA of an organism is deliberately altered and changed. It

is now called a genetically modified organism. Usually this is by introducing a gene

that will make a useful product.

49



The human insulin gene can be introduced into the DNA of the bacterium E.coli. The

pancreas of a diabetic cannot produce insulin. Insulin is needed to remove excess

glucose from the blood, which would otherwise cause serious problems. Large

quantities of pure insulin can be made by genetically engineered E.coli, which is

desperately needed by these diabetics.

People living in Asia often eat a diet lacking in vitamin A containing large quantities of

rice. Vitamin A is needed to prevent night blindness where one cannot adjust to dimlight. Scientists have taken the gene to make beta-carotene from carrots and have put

them into rice plants. Humans eating the rice can then convert the beta-carotene into

vitamin A.

Advantages and disadvantages

Changing an organism by genetic engineering and selective breeding can have many

uses. Scientists are developing crops resistant to herbicides, frost and disease.

However, both methods can cause unexpected problems. Some people are worried how

our bodies will react to eating GM foods several years in the future.

Question: How is the production of insulin by genetic engineering different to the

production of beta-carotene?

Beta carotene making gene has been inserted into a plant whereas the insulin making gene has been inserted into a bacteria.

Question: What is a possible disadvantage of using genetically engineered insulin and

beta-carotene?

They can help those that suffer with diabetes or a lack of beta carotene in their diets.

How genetic engineering works

50



Enzymes are used to cut a gene out of an original chromosome and splice it into a new

chromosome.

Genetic engineering: right or wrong?

Genetic engineering allows us to combine fish, mouse, human and insect genes in the

same person or animal. It is for this reason that many people worry that we are ‘playing

god with nature!’

Question: Describe how genetic engineering could be used to make glucagon hormone,

which causes the breakdown of liver glycogen into blood glucose.

The gene for making glucagon can be isolated and put into another useful item for

which we could take as supplements eg. Vitamin tablets.

Question: Would you like to eat GM crops? Explain your answer.

I wouldn’t like to as these have been changed to suit or purposes when there are

products out there which we can manage with perfectly fine without any testing hassles.

More of the same

The process of cloning is used to make copies of plants and animals. The copies are

called clones. Clones are genetically identical. They all have the same DNA as the

original animal or plant.

Cloning involves only one parent. It is an example of asexual reproduction.

Natural clones

Clones are genetically identical organisms. Sometimes clones are produced naturally.

Human twins can be genetically identical. They are called natural clones.

Question: Why is cloning an example of asexual reproduction?

Cloning is used with stem cells and it does entail the full growth of a new organism,

just one that has been changed.

Question: What was the first animal to be cloned from an adult?

51



Dolly, the sheep.

Question: What is special about the DNA of a clone and its parent?

They are genetically identical.

Question: Why are identical twins called natural clones?

They were produced by sexual reproduction when the ball of cells split in half to form

identical genes.

Cloning cows

Most offspring can be obtained from high quality cows by using other cows to rear their

embryos. Hormones are used on the donor cow to stimulate her ovaries to release

several eggs. Fertilisation is by AI. After a few days, but before implantation, the

embryos are flushed out. Each embryo is immediately placed in the uterus of a

prepared cow that will act as a surrogate mother. In this way a good cow can have

more genetic offspring than would normally be possible in her lifetime. It may soon be

possible to select the sex of the embryo before being placed in the second cow.

Question: Number the following sentences in order.

(1) Hormones are used on the donor cow to stimulate her ovaries to release several

eggs

(2) It may soon be possible to select the sex of the embryo before being placed in

the second cow.

(3) In this way a good cow can have more genetic offspring than would normally be

possible in her lifetime.

(4) After a few days, but before implantation, the embryos are flushed out.

(5) Most offspring can be obtained from high quality cows by using other cows to

rear their embryos.

(6) Fertilisation is by AI.

(7) Each embryo is immediately placed in the uterus of a prepared cow that will act

as a surrogate mother

52



Importance of cloning

Cloning of animals has very important uses. Scientists are hoping to clone pigs to

supply organs for transplants into humans.

Human embryos could also be cloned to provide stem cells. Stem cells could be

transplanted into people suffering from diabetes so that they could make their own

insulin. However, people are concerned that this would be unethical because theembryo is a living thing. Some people are also afraid that scientists will eventually be

able to clone adult humans.

Question: Describe the process of embryo transplantation.

A surrogate mother is chosen and sperm is collected. The sperm is artificially

inseminated into another female gamete and is placed in the surrogate mother for it to

develop and thrive.

Question: Give examples of how cloning can be of use.

Cloning can help gardeners to produce more high quality goods in quick succession.

Question: Explain why some people are concerned about human cloning.Some say that it is unethical and inhumane to be copying someone’s identity.

Cloning sheep

The clones from embryo transplants are clones of each other.

Question: The original embryo formed from a fertilised egg. Does this mean that the

clones from embryo transplants are also clones of each other? Explain your answer.

If they have been taken from the same nucleus and stem cell, then they are cloned of

each other as the stem cells are identical so they will be also.

Remember, the clones are a mixture of two parents. Dolly the sheep was different. She

was genetically identical to her single parent.

53



Dolly was cloned using the DNA in the nucleus of udder cells. The process is called

nuclear transfer.

Question: An egg divides by mitosis and produces a foetus in a surrogate mother sheep.However, that egg was never fertilised by a sperm. Explain how this was possible.

The egg was created with the shell of the gamete but with a fully grown cell inside eg. A

cheek cell.

Risks involved in cloning

• There is a low rate of success. There were 227 attempts to clone a sheep before

Dolly was born.

• Research into human cloning raises many moral and ethical issues about

creating life and then using it to help others.

• Dolly died of conditions linked to old age, yet she was only seven years old.

Her DNA may have been old before she was born.

Benefits of cloning

• Cloned pigs could make up for a shortage in transplant organs and patients

needing a transplant would have to wait for someone to die.

• Diseases could be cured using embryonic stem cells.

Question: Explain why Dolly was not related to the sheep that gave birth to her.

The sheep that gave birth to Dolly was not related to her as she would have been a

clone of the grown cell of the sheep, not the gamete.

Question: If you need a new heart would you object to one from a cloned pig? Explain

its advantages and disadvantages.

I would reject one from a cloned pig as I feel that it is unethical but it can save manylives and help with medical researchers.

54



Question: A friend objects to the use of embryonic stem cells. Write a short passage to

persuade them they are wrong.

Embryonic stem cells can save many lives. If you needed a transplant and your family

weren’t a match, and there were no donors, what would you do..... die?

Asexual reproduction in plants


Many plants reproduce by asexual reproduction. This process produces new plants

very quickly. In asexual reproduction there is no fertilisation between male and female

gametes. New plants are produced using cell division only. The new plants are clones

of the parent plant.

• The part of the potato we eat is the tuber . Left long enough, it will grow shoots

and roots from the ‘eye’ (bud)

• Strawberries grow stems called runners. The runners spread over the ground

and have buds that grow into new strawberry plants.

• Spider plants grow new plants on their stems. These new plants are called

plantlets. If the plantlets are cut off the parent plant and planted in soil they

grow into adult plants.

Possible words: plantlets, strawberry, runners, soil, tuber, cell, clones, fertilisation,

asexual reproduction.

New plants from old

A small piece of a healthy plant is removed. It is kept in conditions that help it form

roots and grow into a new plant. Stem cuttings are used for the propagation of many

glasshouse plants. For some plants, leaf or root cuttings are better than stem cuttings.

Rooting powder can be used to stimulate the growth of new roots. Rooting powders

contain chemicals that stimulate plant growth. They may also contain fungicides to

prevent rot.

Procedure

55



Why clone plants

Advantages

• All the plants are genetically identical. All the cuttings taken from a red rose

grow into red roses.

• Plants can take a long time to grow from seeds. Cloning produces a lot of

identical plants more quickly.

• Cloning enables growers to produce plants that are difficult to grow from seed

such as bananas.

56



Disadvantages

• The plants are all genetically identical. If the environment changes or a new

disease breaks out it is unlikely that any of the new plants will survive.

• Cloning plants over many years has resulted in little genetic variation.

Question: Gardeners are trying to grow old varieties to increase genetic variation in

vegetables. Why is variation in a species beneficial?Variation ensures the evolution of species/organisms and helps the understanding of

many organisms and situations in the world.

Question: Describe how you could produce five clones from a potato tuber.

The potato tuber would grow eyes off of it, these can then be chopped off and placed in

another pot to create another potato plant.

Tissue culture

Question: What is meant by the following terms:

(1) Clone

An organism that is genetically identical to another.

(2) Micropropagation (or plant tissue culture)

The re-planting of parts of plants eg eyes of a potato plant which will grow into a

genetically identical plant.

(3) Callus

__________________________________________________________________

(4) Culture medium

__________________________________________________________________

57



Question: Why is small tissue samples taken from the tips of shoots or roots?

So they can grow larger into more of the plant to ensure that the plant can be used in

many ways or even for researchers.

Micropropagation (tissue culture) has two major advantages for the grower:

(1) Thousands of identical plants can be produced in a relatively small space

(2) The new plants are free from organisms that cause disease.

Animal or plant clones?

Humans have been cloning plants for hundreds of years. Animals have only been

cloned over the last few years. Why is this?

• Many plant cells, unlike animal cells, retain the ability to differentiate into

different cells. Root cells used in tissue culture have to change into all the

different types of cells found in a plant.

• Most animal cells have lost the ability to differentiate.

Question: Explain the term aseptic technique.

______________________________________________________________________

____________________________________________________________________

Question: Suggest two suitable conditions needed for tissue cultures to grow into plants

They need light conditions to grow and a humid, warm atmosphere.

Question: Explain why strawberry plants are easier to clone than sheep.

They are easier to clone as they have not yet become specialised.

58

b3 study notes

Documents