author manuscripts have been peer reviewed and accepted ... · 1/4/2011 · 3 department of oral...

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Copyright © 2010 American Association for Cancer Research

Title: CXCR4 promotes oral squamous cell carcinoma migration and invasion through inducing

expression of MMP-9, 13 via the ERK signaling pathway

A Running title: CXCR4 promotes OSCC migration and invasion

All authors' full names and affiliations:

Tao Yu1,2, Yingying Wu2, Joseph I Helman3, Yuming Wen1, Changmei Wang1, Longjiang Li1, 2*

1 Department of Head and Neck Oncology Surgery, West China College of Stomatology, Sichuan

University, No.14, Sec.3, Renminnan Road, Chengdu Sichuan 610041, People’s Republic of China

2 State Key Laboratory of Oral Diseases, West China College of Stomatology, Sichuan University,

No.14, Sec.3, Renminnan Road, Chengdu, Sichuan 610041, People’s Republic of China

3 Department of Oral Maxillofacial Surgery, University of Michigan Medical Center, Ann Arbor,

Michigan 48109-0018, USA

* The Corresponding Author

Contact details: Longjiang Li, Department of Head and Neck Oncology Surgery, West China College of

Stomatology, Sichuan University. No.14, Sec.3, Renminnan Road, Chengdu Sichuan 610041, People’s

Republic of China

Tel: +86 28 85501428;

Fax: +86 28 85582167;

E-mail: [email protected]

Tao Yu and Yingying Wu contributed equally to this work.

on March 9, 2021. © 2011 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on January 4, 2011; DOI: 10.1158/1541-7786.MCR-10-0386

http://mcr.aacrjournals.org/


Abstract

The increased migration and invasion of oral squamous cell carcinoma cells are key events in the

development of metastasis to the lymph nodes and distant organs. Although the chemokine receptor

CXCR4 and its ligand, stromal-cell-derived factor-1α, have been found to play an important role in

tumor invasion, its precise role and potential underlying mechanisms remain largely unknown. In this

study, we showed that knockdown of CXCR4 significantly decreased Tca8113 cells migration and

invasion, accompanied with the reduction of MMP9 and MMP13 expression. Inhibition of ligand

binding to CXCR4 by a specific antagonist TN14003, also led to reduced cancer cell migration and

invasion. Because the degradation of the ECM and the basement membrane by proteases, such as matrix

metalloproteinases (MMPs) is critical for migration and invasion of cancer cells, we investigated the

expression of several MMPs and found that the expression of functional MMP9 and MMP13 was

selectively decreased in CXCR4 knockdown cells. More importantly, decreased cell migration and

invasion of CXCR4 knockdown cells were completely rescued by exogenous expression of MMP9 or

MMP13, indicating that the two MMPs are downstream targets of CXCR4-mediated signaling.

Furthermore, we found the level of phosphorylated extracellular signal-regulated kinase (ERK) was

significantly decreased in CXCR4-silenced cells, suggesting that ERK may be a potential mediator of

CXCR4-regulated MMP9 and MMP13 expression in Tca8113 cells. Taken together, our results strongly

suggest the underlying mechanism of CXCR4 promoting Tca8113 migration and invasion by regulating

MMP9 and MMP13 expression perhaps via activation of the ERK signaling pathway.

Keywords oral squamous cell carcinoma; tumor migration and invasion; RNA interference; CXC





chemokine receptor 4; ERK signaling pathway

Introduction

Oral cancer is identified as a significant public health threat worldwide because its treatment often

produces dysfunction and distortions in speech, mastication and swallowing, dental health, and even in

the ability to interact socially. It is one of the 10 most frequent cancers in human males worldwide, with

about two thirds of all cases occurring in developing countries (1). The most common type of oral

cancer is oral squamous cell carcinoma (OSCC). Although local OSCC can be effectively controlled by

surgical excision and radiotherapy, metastasis to the lymph nodes and distant organs significantly

decreases the survival rate (2). Since OSCC is a type of highly malignant tumor with a potent capacity

to invade locally and distant metastasis, an approach decreasing the ability of invasion and metastasis

may facilitate the development of effective adjuvant therapy. The invasion of tumor cells is a complex,

multistage process. In this process, the degradation of the extracellular matrix (ECM) and the basement

membrane surrounding the primary tumor by proteases, such as matrix metalloproteinases (MMPs) is

critical for migration and invasion of cancer cells. To facilitate the cell motility, invading cells need to

change the cell-cell adhesion properties, rearrange the ECM environment, suppress anoikis and

reorganize their cytoskeletons (3). Tumor cells secrete various ECM degrading enzymes, including

matrix metalloproteinases (MMP), to facilitate their migration and invasion (4-5). In particular, MMP2,

MMP9 and MMP13 are highly expressed in OSCC compared with normal oral mucosa tissues, and their

mRNA and protein levels are further increased upon tumor progression (6-8). In addition, it is well

established that MMP2, MMP9 and MMP13 are closely associated with tumor invasion and metastasis





in a variety of human tumors(9-11).

Chemokines, a superfamily of small cytokine-like proteins, can bind to and activate a family of seven

transmembrane G-protein-coupled receptors, the chemokine receptors (12). Chemokines are expressed

by many tumor types and can promote mitosis, modulate apoptosis, survival and angiogenesis (13-14).

Interaction between the chemokine receptor CXCR4 and its ligand, stromal-cell-derived factor-1α

(SDF-1α or CXCL12), has been found to play an important role in tumorigenicity, proliferation,

metastasis and angiogenesis in many cancers, such as lung cancer, melanoma, esophageal cancer,

ovarian cancer, glioblastoma, pancreatic cancer, cholangiocarcinoma, and basal cell carcinoma cells

(15-22). Although several studies have implicated CXCR4 in tumor invasion, its precise role and

potential underlying mechanisms remain largely unknown. In this study, we hypothesize that CXCR4

regulates OSCC cells migration and invasion by altering the expression and function of MMPs. First,

several MMPs, including MMP2, MMP9, and MMP13, directly or indirectly interact with CXCR4,

which could alter MMP-mediated pericellular proteolysis (23-25). Second, several studies have shown

that CXCR4, as well as MMP2, MMP9 and MMP13 were highly up-regulated in human OSCC,

suggesting that their expression levels are likely coupled (26-27). Herein, we present evidence that

CXCR4 regulates tumor cell migration and invasion by altering the expression of MMP9 and MMP13.

Materials and Methods

Cell line and reagents

SCC-4, SCC-9, SCC-15, SCC-25 and Tca8113 human tongue squamous cell carcinoma cell lines were

obtained from ATCC and State Key Laboratory of Oral Diseases at Sichuan University, respectively.

Recombinant human SDF-1α was obtained from Research Diagnostics, Inc. (Flanders, NJ). MMP





inhibitors, OA-Hy and inhibitor II, were obtained from Calbiochem. Antibody to human CXCR4,

MMP1, MMP2, MMP7, MMP9 and MMP13 were obtained from Santa Cruz Biotechnology (Santa

Cruz, CA). Rabbit anti-ERK/pERK, anti-AKT/pAKT, anti-P38/pP38, anti-JNK/pJNK and anti-GAPDH

primary antibodies were purchased from Cell Signaling Technology. The real-time PCR primers for

CXCR4, MMP1, MMP2, MMP7, MMP9, MMP13 and glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) were synthesized commercially (Takara, Kyoto, Japan). Cell proliferation and cytotoxicity

assay kit were from Dojindo Laboratories. The Migration and Invasion Assay kit were from Millipore.

All tissue culture media and serum were from Gibco. Peroxidase-labeled antirabbit antibody and

enhanced chemiluminescence (ECL) system were from Millipore.

Construction of plasmid vector expressing siRNAs for CXCR4

Two siRNAs were designed, based on the CXCR4 sequence (NM_001008540): siRNA 1: 5’-

GGTGGTCTATGTTGGCGTCTG-3’ or siRNA 2: 5’-GGCAGTCCATGTCATCTAC-3’.

Oligonucleotides with a sequence predicted to induce efficient RNAi of CXCR4 (containing sense and

antisense sequences) were synthesized (siRNA 1 sense: 5′-GATCCCGGGTGGTC

TATGTTGGCGTCTGGAAGCTTGCAGACGCCAACATAGACCACCTTTTTT-3′, antisense: 5′-CT

AGAAAAAAGGTGGTCTATGTTGGCGTCTGCAAGCTTCCAGACGCCAACATAGACCACCCG

G-3′; siRNA 2 sense: 5′-GATCCCGGGCAGTCCATGTCATCTACGAAGCTTGGTAGAT

GACATGGACTGCCTTTTTT-3′; antisense: 5′-CTAGAAAAAAGGCAGTCCATGTCATCTACC

AAGCTTCGTAGATGACATGGACTGCCCGG-3′). These oligonucleotides were annealed in STE

buffer (10 mM Tris [pH 8.0], 50 mM NaCl, and 1 mM ethylenediaminetetraacetic acid) at 94°C for 5

min and cooled gradually. The double-stranded products were cloned downstream to the human U6





promoter of the pRNAT/U6 vector (Genscripts) and designated as CXCR4-shRNA1 and

CXCR4-shRNA2. A control vector (Control) was constructed (5’-GAAGCAGCACGACTTCTTC-3’)

with no significant homology to any mammalian gene sequence and, therefore, served as a nonsilencing

control.

Cell culture and transfection

The cells were cultured at 37°C in 5% CO2 in RPMI 1640 containing 10% fetal bovine serum (FBS,

Gibco Life Technologies, USA), 2 mM glutamine, 1 mM sodium pyruvate, 10 mM HEPES, 100 U/ml

penicillin G, and 100 mg/ml streptomycin (Sigma, USA). The human tongue squamous cell carcinoma

cell lines were transfected in Opti-MEM I medium with Lipofectamine LTX & plus (Invitrogen) in

accordance with the manufacturer’s instructions. For stable transfection, selection was performed with

neomycin (500 mg/mL; Invitrogen) in RPMI 1640 medium containing 20% FBS for approximately 2

wk from the day after transfection. The cells with knockdown of CXCR4 were collected for cell

proliferation and cytotoxicity assay, migration and invasion assays, real-time PCR, and western blotting.

Quantitative real-time PCR

Quantitative reverse transcription-PCR was carried out using real-time PCR with the SYBR Green

reporter. Total RNA isolated using the RNeasy Mini kit (Qiagen) was subsequently reverse transcribed

to cDNA with the SuperScript First-Strand Synthesis System (Invitrogen). The quantitative real time

RT-PCR was performed using the SYBR premix Ex TaqTM II Kit (Takara, Kyoto, Japan) according to

the manufacturer’s instructions. The reaction mix was subjected to quantitative real-time PCR to detect

levels of the corresponding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), CXCR4, and several





MMPs. All primers sequence were shown in Table 1. The relative expression levels were quantified and

analyzed by using Bio-Rad iCycler iQ software. The comparative threshold cycle (CT) method was

used to calculate amplification fold. Glyceraldehyde 3-phosphatase dehydrogenase (GAPDH) gene was

used as a reference control gene to normalize the expression value of each gene. Triple replicates were

performed for each gene and average expression value was computed for subsequent analysis. The

relative expression level of the genes was calculated using the 2-△△Ct method (28).

Western blotting

The cells were lysed in lysis buffer (PBS containing 1% Triton X-100, protease inhibitor cocktail, and 1

mmol/L phenylmethylsulfonyl fluoride) at 4°C for 30 min. Equal quantities of protein were subjected to

SDS-PAGE. After transfer to Immobilon-P transfer membrane, successive incubations with

anti-CXCR4, MMP1, MMP2, MMP7, MMP9, MMP13, ERK/pERK, AKT/pAKT, P38/pP38 and

JNK/pJNK antibody or anti-GAPDH antibody and horseradish peroxidase-conjugated secondary

antibody were carried out. The immunoreactive proteins were then detected using the ECL system.

Bands were scanned using a densitometer (GS-700, Bio-Rad, USA) and quantification was performed

using Quantity One 4.6.3 software (Bio-Rad, USA).

Cell proliferation assay

Cell proliferation assay was performed using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Cells

were plated in 96-well plates at 1×104 cells per well and incubated for 5 days. Every day, at one time,

ten microliters of Cell Counting Assay Kit-8 solution were added to each well, then the cells were

incubated for another 2h. The value of optical density (OD) was obtained by the differences in

absorbance at a wavelength of 450 nm by using a microplate reader (VARI OSKAN FLASH 3001,





Thermo, USA). The amount of the formazan dye, generated by the activities of dehydrogenases in cells,

is directly proportional to the number of living cells.

Cell migration assay

This cell migration assay was performed in a migration chamber with an 8 μm pore size polycarbonate

membrane (Millipore, USA), based on the Boyden chamber principle. Briefly, cells were resuspended

in serum-free RPMI 1640, and 3×105 cells were added to the interior of the inserts. Five hundred

microliters of RPMI 1640 containing 10% fetal bovine serum were added to the lower chamber as

chemoattractant. Cells were incubated for 24 h at 37°C in a CO2 incubator (5% CO2). Then, the upper

surface of the chamber was scraped to remove non-migratory cells. Migrated cells were fixed and

stained with 0.1% crystal violet and photographed under a light microscope (200×). The stained inserts

were transferred to a clean well containing 500 μL of 10% Acetic acid for 15 minutes at room

temperature. The Optical Density (OD) of the stained cell was measured at 560 nm.

Cell invasion assay

The cell invasion assay was performed with QCM™ 24-well Invasion Assay kit (Chemicon

International, USA). This cell invasion assay was performed in an invasion chamber, based on the

Boyden chamber principle. This kit contains 24 inserts and each insert contains an 8 μm pore size

polycarbonate membrane coated with a thin layer of ECMatrixTM. Briefly, cells were resuspended in

serum-free RPMI 1640, and 3×105 cells were added to the interior of the inserts, which had been

previously rehydrated at room temperature for 30 minutes. Five hundred microliters of RPMI 1640

containing 10% fetal bovine serum were added to the lower chamber as chemoattractant. Cells were

incubated for 48 h at 37°C in a CO2 incubator (5% CO2). Then, the upper surface of the chamber was





scraped to remove non-invasive cells. Invaded cells were fixed and stained with 0.1% crystal violet and

photographed under a light microscope (200×). The stained inserts were transferred to a clean well

containing 500 μL of 10% Acetic acid for 15 minutes at room temperature. The Optical Density (OD) of

the stained cell was measured at 560 nm.

Data statistics

All quantified data represent an average of at least triplicate samples. Error bars represent SD. Statistical

significance was determined by Student’s t test, and differences at probability of less than 0.05 were

considered statistically significant.

Results

CXCR4 silencing inhibits Tca8113 cells migration and invasion by regulating MMP9 and MMP13

expression

We investigated whether CXCR4 is required for the invasive phenotypes of oral squmous cell

carcinoma cells in vitro by expressing short hairpin RNAs (shRNA) to knock down CXCR4 expression.

We expressed shRNA from two different CXCR4 sequences (shRNA1 or shRNA2) in the highly

malignant Tca8113 cell line and SCC-9 cell line (Figure 1A). Expression of CXCR4 protein and its

mRNA levels were substantially reduced by 90%, 80% and 85%, 70% in CXCR4-shRNA1 expressing

Tca8113 and SCC-9 cells, respectively (Figure 1B~D). However, the expression of CXCR4 protein and

its mRNA levels were substantially reduced by 20% and 30% in CXCR4-shRNA2 expressing Tca8113

and SCC-9 cells, respectively (data not shown). Therefore, one of the two shRNAs (CXCR4-shRNA1)

was chosen for further study. Furthermore, the quantitative real-time RT-PCR and western blotting

results showed that the mRNA and protein expression of CXCR4 in both Tca8113 and SCC-9 cells





were significantly inhibited in vitro. We also selected the one of the two cell lines (Tca8113) for further

study. In addition, we examined the effect of CXCR4 silencing on the survival and proliferative activity

of Tca8113 cells because a decrease in survival or proliferation after CXCR4 silencing may also

contribute to the observed decrease in migration and invasion of Tca8113 cells. The results showed that

CXCR4 silencing decreased the proliferation rate of Tca8113 cells slightly compared with Tca8113 and

control cells (Supplementary Figure 1). To investigate whether CXCR4 silencing affects Tca8113 cell

migration and invasion, we conducted three-dimensional cell migration assays using transwell chambers

and invasion assays with matrigel-coated millicell chambers. The results demonstrated that knockdown

of CXCR4 in Tca8113 cells decreased cell migration and invasion at ~75% and 85%, respectively,

compared with controls (Figure 2A~B). To further confirm whether CXCR4 regulates Tca8113 cell

migration and invasion by modulating MMP expression, we analyzed the mRNA and protein levels of

MMPs upon CXCR4 silencing. Quantitative real-time PCR results showed that the mRNA levels of

MMP9 and MMP13 were decreased by ~70% and 60% in CXCR4-silenced cells, respectively,

compared to control cells (Figure 2C). The western blotting results showed that the protein levels of

MMP9 and MMP13 were decreased by ~75% and 65% in CXCR4-silenced cells, respectively,

compared to control cells (Figure 2D~E). As controls, the mRNA and protein levels of the MMP1,

MMP2 and MMP7 did not alter under these conditions. To further confirm that the effect of CXCR4

silencing on the decrease of migration and invasion of Tca8113 cells is specific, we restored CXCR4

function by coculturing the ligand of CXCR4 SDF-1α (100ng/ml, 12h), which can significantly promote

the upregulation of CXCR4 expression (Figure 3A) (29). We also observed that the upregulation of

CXCR4 expression restored Tca8113 cell migration and invasion and the protein levels of MMP9 and





MMP13 were increased by ~60% and 70% in CXCR4-restored cells, respectively, compared to control

cells. As controls, the protein levels of the MMP1, MMP2 and MMP7 did not alter under these

conditions (Figure 3B~D). We have further tested the effects of CXCR4 silencing on the invasion of

several OSCC cell lines (SCC-4, SCC-9, SCC-15, SCC-25) and found that the invasion of these human

tongue squamous cell carcinoma cells positively correlated with CXCR4 expression levels

(Supplementary Figure 2A). To further confirm whether CXCR4 regulates Tca8113 cell migration and

invasion by modulating MMP expression, we analyzed the protein levels of MMPs in different cell lines

upon CXCR4 silencing. The western blotting results showed that the protein levels of MMP9 and

MMP13 were decreased significantly in CXCR4-silenced cells except SCC-25 cell line, compared to

control cells (Supplementary Figure 2B). As controls, the protein levels of the MMP1, MMP2 and

MMP7 did not alter upon CXCR4 silencing. These results showed that the expression levels of CXCR4

positively correlated with the migration and invasion of human tongue squamous cell carcinoma cells.

CXCR4 ligand-binding function is required for efficient cancer cell migration and invasion

To determine whether the ligand-binding ability of CXCR4 affected Tca8113 cell migration and

invasion, we pretreated Tca8113 cells with TN14003, an antagonist that blocks ligand binding to

CXCR4 (30). Treating Tca8113 cells with 100 nM TN14003 resulted in a significant decrease in

migration and invasion at ~85% and 70%, respectively, compared with control cells, suggesting that

ligand binding to CXCR4 is required for the CXCR4 function in tumor cell migration and invasion

(Figure 3E). We also investigated the mRNA and protein levels of MMP1, MMP2, MMP7, MMP9 and

MMP13 in Tca8113 cells with or without 100 nM TN14003. Quantitative real-time PCR results showed

that the mRNA levels of MMP9 and MMP13 were decreased by ~60% and ~75% in Tca8113 cells





treated with TN14003, compared to control cells (Figure 3F). The western blotting results demonstrated

that protein levels of MMP9 and MMP13 were decreased by ~50% and ~65% in Tca8113 cells treated

with TN14003, respectively, compared to control cells (Figure 3G~H). So the antagonist of CXCR4,

TN14003, may inhibit Tca8113 cancer cells migration through down-regulating expression levels of

MMP9 and MMP13 in CXCR4-related pathway.

MMP9 and MMP13 are downstream targets of CXCR4

To investigate whether MMP activity is required for Tca8113 cell migration and invasion, we tested the

effect of OA-Hy, a broad spectrum MMP inhibitor, and inhibitor II, a specific inhibitor of MMP9 and

MMP13 (Figure 4A). Both inhibitors significantly blocked Tca8113 cells migration and invasion,

demonstrating that MMP activity is necessary for efficient migration and invasion of Tca8113 cells. In

our previous data, we have analyzed the mRNA and protein levels of MMPs upon CXCR4 silencing.

Both quantitative real-time PCR and western blotting results showed that the mRNA and protein levels

of MMP9 and MMP13 were decreased significantly in CXCR4-silenced cells, respectively, compared to

control cells (Figure 2C~E). Herein, we investigated the protein levels of MMPs upon CXCR4 silencing

and MMP inhibitors. The protein levels of MMP9 and MMP13 were decreased by ~80% and 70% in

CXCR4-silenced cells, respectively, compared to control cells. The inhibition effect of protein

expression of MMP9 and MMP13 upon CXCR4-silencing was similar with MMP inhibitors, indicating

the CXCR4 is involved in the transcriptional regulation of MMP9 and MMP13 in Tca8113 cells (Figure

4B~C). To confirm the finding that CXCR4 regulates MMP9 and MMP13 expression, we investigated

the mRNA levels of MMP9 and MMP13 in CXCR4-deficient mouse embryonic fibroblasts

(CXCR4-deficient MEF cells) and CXCR4-expressing MEF cells (MEF cells) by quantitative real-time





PCR. Consistent with findings in CXCR4 knockdown cells, mRNA levels of MMP9 and MMP13 in

CXCR4-deficient MEF cells are only ~25% and 40%, respectively, of MEF cells (Figure 4D).

Furthermore, the mRNA levels of MMP9 and MMP13 in the brain of CXCR4-deficient forebrain mice

were also significantly lower than those in the brain of littermate control mice (31) (Figure 4E). In both

cases, the levels of MMP1, MMP2, and MMP7 were not changed, suggesting that CXCR4 specifically

regulates MMP9 and MMP13 expression. Additionally, to further confirm the effect of CXCR4

silencing on the decrease of MMP9 and MMP13 expression levels in Tca8113 cells is specific, we

restored CXCR4 function by coculturing the ligand of CXCR4 SDF-1α (100ng/ml, 12h). We found that

SDF-1α significantly restored mRNA levels of MMP9 and MMP13 in CXCR4-silenced cells (Figure

4F). Additionally, we tested whether ectopic expression of MMP9 or MMP13 can restore cell migration

and invasion or not in CXCR4-silenced Tca8113 cells. We found that MMP9 or MMP13

overexpression successfully restored both migration and invasion in these cells (Figure 5A). We also

detected the protein levels of MMP9 and MMP13 during this process. The restoration of protein

expression of MMP9 and MMP13 increased the invasiveness of CXCR4-silenced cells. Furthermore,

SDF-1α restored protein levels of MMP9 and MMP13 in CXCR4-silenced cells and significantly

increased invasiveness of these cells, indicating MMP9 and MMP13 are downstream targets of CXCR4

(Figure 5B~D).

Extracellular signal-regulated kinase is a potential mediator of CXCR4 regulation of MMP9 and

MMP13 expression

To understand the mechanism which CXCR4 regulates MMP9 and MMP13 expression, we analyzed

the effects of CXCR4-silencing on the activation of several potential signaling pathways. We found that





the level of phosphorylated ERK was significantly decreased in CXCR4-silenced Tca8113 cells, which

was restored by coculturing the ligand of CXCR4 SDF-1α (Figure 6A~B). Phosphorylated Akt, p38 and

JNK were not significantly changed in CXCR4-silenced Tca8113 cells. These results demonstrate that

ERK is likely a downstream target of CXCR4-mediated signaling that regulates MMP9 and MMP13

expression and their functions in cell migration and invasion in Tca8113 cells.

Discussion

Although local OSCC can be effectively controlled by surgical excision and radiotherapy, in tongue

squamous cell carcinoma, the incidence of occult cervical lymph nodes metastases is relatively high. Of

the patients with T1 and T2 squamous cell carcinoma of the oral tongue clinically staged N0, 13-33%

and 37-53%, respectively, have occult metastases at the time of diagnosis (32-33). The metastasis of

tumor cells is a very complex process. Tumor cells must migrate through ECM and basement

membranes in order to invade local tissues and metastasize to distal sites. Muller et al. showed that

injecting the antibody that neutralizes CXCR4 activity leads to inhibition of metastasis to the bone

marrow and lungs in vivo (34). Recently, it has been proposed that chemokine receptors are critical in

determining the metastatic destination of tumor cells (35-37). Uchida et al. demonstrated a possible role

for CXCR4 in mediating the dissemination of OSCCs to the lymph nodes (38). In this study, we

demonstrate that CXCR4 silencing leads to a significant decrease of Tca8113 cells migration and

invasion and provide evidence that CXCR4 regulates the transcriptional levels of MMP9 and MMP13 in

Tca8113 cells. We further show that CXCR4 regulation of MMP9 and MMP13 expression is likely

mediated by ERK signal pathways.

The finding that CXCR4 silencing led to a significant decrease of Tca8113 cells migration and invasion





was consistent with many previous reports, which showed that high levels of CXCR4 expression

promoted OSCC cell invasion (26). Moreover, functional blocking of CXCR4 by TN14003 also led to

decreased cell migration and invasion, which was also consistent with reports that TN14003 treatment

decreased migration of breast cancer cells and pancreatic cancer cells in vitro and reduced pulmonary

metastasis of breast cancer in SCID mice (30, 39). Additionally, we rescued cell migration and invasion

in CXCR4-silenced Tca8113 cells by coculturing the ligand of CXCR4 SDF-1α, which suggested that

CXCR4 expression levels were positively correlated with cancer cell migration and invasion.

We further observed that the number of invaded cells positively correlated with endogenous levels of

CXCR4 in different human tongue squamous cell carcinoma cell lines, suggesting that CXCR4

regulates cancer cell migration and invasion via a similar mechanism among different tongue squamous

cell carcinoma cell types. To determine how CXCR4 promotes Tca8113 cells migration and invasion,

we focused on delineating the relationship between CXCR4 and MMPs, particularly MMP9 and

MMP13. In human cancer cells, MMP-1, -2, -9 and -13 have been found to correlate with malignant

grade and metastasis (40-41). MMPs have been implicated to facilitate cancer cell invasion and

metastasis through degradation of surrounding ECM proteins. Expression of MMPs and other

extracellular proteinases have been shown to positively correlate with the progression of cancer in

patients (10, 42). It’s interesting to note that several studies have shown that the expression levels of

CXCR4 were also highly upregulated in human HNSCC and OSCC, suggesting that MMPs and

CXCR4 expression levels are likely coupled (26, 43-44). However, it is unknown how these genes

regulate each other during tumorigenesis. Herein, we found that CXCR4 silencing significantly

decreased the mRNA and protein levels of both MMP9 and MMP13, but not the mRNA and protein





levels of the MMP1, MMP2, and MMP7, indicating that CXCR4 specifically modulates the expression

of MMP9 and MMP13.

Although >90% of CXCR4 expression was silenced by shRNA, the migration and invasion rates of

Tca8113 cells and the expression levels of MMP9 and MMP13 were reduced by only ~50% to 80%. A

potential explanation for this discrepancy is the paradoxical function of some MMPs. Indeed, MMP9

has a function of host resistance in cancer, as well as protumorigenic action (45). Additionally, other

modulators may regulate MMP expression and Tca8113 cell migration and invasion independent of

CXCR4. Further investigation will be needed to reveal the relationship of CXCR4-dependent and

CXCR4-independent mechanisms in cancer cell migration and invasion. We further showed that the

expression of MMP9 and MMP13 in both CXCR4-deficient MEF cells and the brain of

CXCR4-deficient forebrain mice were significantly lower than those in the control samples. These

results suggest that CXCR4 is involved in the transcriptional regulation of MMP9 and MMP13 in

Tca8113 cells. We also showed that the ectopic expression of MMP9 or MMP13 successfully restored

both migration and invasion of CXCR4-silenced Tca8113 cells, indicating that MMP9 and MMP13 are

indeed downstream targets of CXCR4.

The signal transduction pathways that modulate the activity of MMP transcription factors are highly

diverse. Mitogen-activated protein kinase signal transduction pathways, including p38, extracellular

signal-regulated kinase (ERK), and c-Jun NH2 kinase (JNK), are well known mediators that stimulate or

inhibit MMP expression depending on cell types (46-48). In this study, we showed that downregulation

of CXCR4 expression by shRNA could significantly reduce the phosphorylation of ERK. Thus, ERK

signaling pathway is likely associated with several mechanisms of cell motility mediated by CXCR4,





including regulation of the transcriptional levels of MMP9 and MMP13.

Taken together, in the present study we demonstrated that the downregulation of CXCR4 by shRNA

may well serve as a potential therapeutic strategy to treat cancer, particularly cancer metastasis. Further

studies aimed at identifying the precise signal transduction pathways and transcription factors that

mediated CXCR4 regulation of MMPs expression may provide a molecular understanding of the roles

of CXCR4 in cancer biology.

Acknowledgments

We thank Xiaoyu Li, Yurong liu, and Min Zhou from State Key Laboratory of Oral Diseases, Sichuan

University for their technical assistance. This project was supported by National Natural Science

Foundation of China (Grant 30973345).

References

1 Yu T, Wang XY, Gong RG, et al. The expression profile of microRNAs in a model of

7,12-dimethyl-benz[a]anthrance-induced oral carcinogenesis in Syrian hamster. J Exp Clin Canc

Res.2009; 28:64.

2 de Aguiar FCA, Kowalski LP, de Almeida OP. Clinicopathological and immunohistochemical

evaluation of oral squamous cell carcinoma in patients with early local recurrence. Oral Oncol. 2007;

43:593-601.

3 Woodhouse EC, Chuaqui RF, Liotta LA. General mechanisms of metastasis. Cancer. 1997;

80:1529-37.

4 Castellano G, Malaponte G, Mazzarino MC, et al. Activation of the Osteopontin/Matrix

Metalloproteinase-9 Pathway Correlates with Prostate Cancer Progression. Clin Cancer Res. 2008;





14:7470-80.

5 Fromigué O, Hamidouche Z, Marie PJ. Blockade of the RhoA-JNK-c-Jun-MMP2 Cascade by

Atorvastatin Reduces Osteosarcoma Cell Invasion. J Biol Chem. 2008; 283:30549-56.

6 Kawamata H, Nakashiro K, Uchida D, et al. Possible contribution of active MMP2 to lymphnode

metastasis and secreted cathepsin L to bone invasion of newly established human oral squamous

cancer cell lines. Int J Cancer. 1997; 70:120-7.

7 Ruokolainen H, Paakko P, Turpeenniemi-Hujanen T. Serum matrix metalloproteinase-9 in head and

neck squamous cell carcinoma is a prognostic marker. Int J Cancer. 2005; 116:422-7.

8 Johansson N, Airola K, Grenman R, et al. Expression of collagenase-3 (matrix metalloproteinase-13)

in squamous cell carcinomas of the head and neck. Am J Pathol.1997;151:499-508.

9 Komatsu K, Nakanishi Y, Nemoto N, et al. Expression and quantitative analysis of matrix

metalloproteinase-2 and -9 in human gliomas. Brain Tumor Pathol. 2004; 21:105-12.

10 Chambers AF, Matrisian LM. Changing views of the role of matrix metalloproteinases in metastasis.

J Natl Cancer Inst. 1997; 89:1260-70.

11 Culhaci N, Metin K, Copcu E, Dikicioglu E. Elevated expression of MMP-13 and TIMP-1 in head

and neck squamous cell carcinomas may reflect increased tumor invasiveness. BMC Cancer. 2004;

4:42.

12 Zlotnik A, Yoshie O. Chemokines. a new classification system and their role in immunity. Immunity.

2000; 12:121-7.

13 Zhou Y, Larsen PH, Hao C, Yong VW. CXCR4 is a major chemokine receptor on glioma cells and

mediates their survival. J Biol Chem. 2002; 277:49481-7.





14 Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and their

microenvironment. Blood. 2006; 107:1761-7.

15 Spano JP. Andre F, Morat L, et al. Chemokine receptor CXCR4 and early-stage non-small cell lung

cancer: pattern of expression and correlation with outcome. Ann Oncol. 2004; 15:613-7.

16 Scala S, Ottaiano A, Ascierto PA, et al. Expression of CXCR4 predicts poor prognosis in patients

with malignant melanoma. Clin Cancer Res. 2005; 11:1835-41.

17 Koishi K, Yoshikawa R, Tsujimura T. Persistent CXCR4 expression after preoperative

chemoradiotherapy predicts early recurrence and poor prognosis in esophageal cancer. World J

Gastroenterol. 2006; 12:7585-90.

18 Jiang YP, Wu XH, Shi B, et al. Expression of chemokine CXCL12 and its receptor CXCR4 in human

epithelial ovarian cancer: an independent prognostic factor for tumor progression. Gynecol Oncol.

2006; 103:226-33.

19 Barbero S, Bonavia R, Bajetto A, et al. Stromal cell-derived factor 1a stimulates human glioblastoma

cell growth through the activation of both extracellular signalregulated kinases 1/2 and Akt. Cancer

Res. 2002; 63:1969-74.

20 Saur D, Seidler B, Schneider G, et al. CXCR4 expression increases liver and lung metastasis in a

mouse model of pancreatic cancer. Gastroenterology. 2005;129:1237-50.

21 Ohira S, Sasaki M, Harada K, et al. Possible regulation of migration of intrahepatic

cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor

necrosis factor-a and stromal-derived factor-1 released in stroma. Am J Pathol. 2006; 168:1155-68.

22 Chen GS, Yu HS, Lan CC, et al. CXC chemokine receptor CXCR4 expression enhances





tumorigenesis and angiogenesis of basal cell carcinoma. Br J Dermatol. 2006; 154:910-18.

23 Son BR, Marquez-Curtis LA, Kucia M, et al. (2006) Migration of bone marrow and cord blood

mesenchymal stem cells in vitro is regulated by stromal-derived factor-1-CXCR4 and hepatocyte

growth factor-c-met axes and involves matrix metalloproteinases. Stem Cells. 2006; 24:1254-64.

24 Tang CH, Tan TW, Fu WM, Yang RS. Involvement of matrix metalloproteinase-9 in stromal

cell-derived factor-1/CXCR4 pathway of lung cancer metastasis. Carcinogenesis. 2008; 29:35-43.

25 Chu CY, Cha ST, Chang CC, et al. Involvement of matrix metalloproteinase-13 in

stromal-cell-derived factor 1 alpha-directed invasion of human basal cell carcinoma cells. Oncogene.

2007; 26:2491-501.

26 Ishikawa T, Nakashiro K, Hara S, et al. CXCR4 expression is associated with lymph-node metastasis

of oral squamous cell carcinoma. Int J Oncol. 2006; 28:61-6.

27 de Vicente JC, Fresno MF, Villalain L, et al. Expression and clinical significance of matrix

metalloproteinase-2 and matrix metalloproteinase-9 in oral squamous cell carcinoma. Oral Oncol.

2005; 41:283-93.

28 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative

PCR and the 2-��Ct method. Methods. 2001; 25: 402-8.

29 Kukreja P, Abdel-Mageed AB, Mondal D, et al. Up-regulation of CXCR4 Expression in PC-3 Cells

by Stromal-Derived Factor-1A (CXCL12) Increases Endothelial Adhesion and Transendothelial

Migration: Role of MEK/ERK Signaling Pathway–Dependent NF-KB Activation. Cancer Res. 2005;

65: 9891-8.

30 Mori T, Doi R, Koizumi M, et al. CXCR4 antagonist inhibits stromal cell-derived factor 1-induced





migration and invasion of human pancreatic cancer. Mol Cancer Ther. 2004; 3:29-37.

31 Zou YR, Kottmann AH, Kuroda M, et al. Function of the chemokine receptor CXCR4 in

haematopoiesis and in cerebellar development. Nature. 1998; 393: 595-9.

32 Teichgraeber JF, Clairmont AA. The incidence of occult metastases for cancer of the oral tongue and

floor of the mouth: Treatment rationale. Head Neck Surg. 1984; 7:15-21.

33 Byers RM, El-Naggar AK, Lee YY, et al. Can we detect or predict the presence of occult nodal

metastases in patients with squamous carcinoma of the oral tongue? Head Neck. 1998; 20:138-44.

34 Muller A, Homey B, Soto H, et al. Involvement of chemokine receptors in breast cancer metastasis.

Nature. 2001; 410:50-6.

35 Taichman RS, Cooper C, Keller ET, et al. Use of the stromal cell-derived factor-1/CXCR4 pathway

in prostate cancer metastasis to bone. Cancer Res. 2002; 62:1832-7.

36 Geminder H, Sagi-Assif O, Goldberg L, et al. A possible role for CXCR4 and its ligand, the CXC

chemokine stromal cell-derived factor-1, in the development of bone marrow metastases in

neuroblastoma. J Immunol. 2001; 167:4747-57.

37 Murphy PM. Chemokines and the molecular basis of cancer metastasis. N Engl J Med. 2001;

345:833-5.

38 Uchida D, Begum NM, Almofti A, et al. Possible role of stromal-cell-derived factor-1/CXCR4

signaling on lymph node metastasis of oral squamous cell carcinoma. Exp Cell Res. 2003;

290:289-302.

39 Tamamuraa H, Horib A, Kanzakib N, et al. T140 analogs as CXCR4 antagonists identi¢ed as

anti-metastatic agents in the treatment of breast cancer. FEBS Lett. 2003; 550:79-83.





40 Egeblad M. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer.

2002; 2:161-74.

41 Ohbayashi H. Matrix metalloproteinases in lung diseases. Curr Protein Pept Sci. 2002; 3:409-21.

42 Zucker S, Cao J. Imaging metalloproteinase activity in vivo. Nature Med. 2001; 7:655-6.

43 Lee JI, Jin BH, Kim MA, et al. Prognostic significance of CXCR-4 expression in oral squamous cell

carcinoma. Oral Surg Oral Med O. 2009; 107:678-84.

44 Muller A, Sonkoly E, Eulert C, et al. Chemokine receptors in head and neck cancer: association with

metastatic spread and regulation during chemotherapy. Int J Cancer. 2006; 118:2147-57.

45 Overall CM, Kleifeld O. Towards third generation matrix metalloproteinase inhibitors for cancer

therapy. Br J Cancer. 2006; 94:941-6.

46 Westermarck J, Kahari VM. Regulation of matrix metalloproteinase expression in tumor invasion.

FASEB J. 1999; 13:781-92.

47 Simon C, Goepfert H, Boyd D. Inhibition of the p38 mitogen-activated protein kinase by SB 203580

blocks PMA-induced Mr 92,000 type IV collagenase secretion and in vitro invasion. Cancer Res.

1998; 58:1135-9.

48 Johansson N, Ala-aho R, Uitto V. Expression of collagenase-3 (MMP-13) and collagenase-1

(MMP-1) by transformed keratinocytes is dependent on the activity of p38 mitogen-activated

protein kinase. J Cell Sci. 2000; 113:227-35.





Figure legends

Figure 1. CXCR4 silencing in tongue squamous cell carcinoma cells. A: Tca8113 and SCC-9 tongue

squamous cell carcinoma cells were transfected with CXCR4 shRNA1, CXCR4 shRNA2 or

control shRNA using Lipofectamine LTX & plus. For stable transfection, selection was

performed with neomycin (500 mg/mL; Invitrogen) in RPMI 1640 medium containing 20%

FBS for approximately 2 wk from the day after 48h transfection, then photographed under a

inverted fluorescence microscope (FL) × 100. B: western blotting analysis of CXCR4

silencing by CXCR4-shRNA1 in both Tca8113 and SCC-9 cells. GAPDH loading control is

also shown. C: densitometric analysis of protein levels of CXCR4, relative to GAPDH,

determined by western blotting and compared to Tca8113 cells. D: transcript levels of

CXCR4, relative to GAPDH, determined by qRT-PCR and compared to Tca8113 cells. error

bars indicate SD., n=3 experiments. **, P < 0.01.

Figure 2. CXCR4 silencing inhibits Tca8113 cells migration and invasion. A: three-dimensional

migration and invasion assay were performed using Boyden Chambers in CXCR4-shRNA1

Tca8113 cells. B: the quantitative analysis of migrated and invaded cells, which were

eluted using 10% Acetic acid and measured Optical Density value at 560 nm. Scale bars,

100μm. C: transcript levels of CXCR4, MMP1, MMP2, MMP7, MMP9 and MMP13 in

CXCR4-silenced Tca8113 cells, relative to GAPDH, determined by qRT-PCR. D: western

blotting analysis of CXCR4 MMP1, MMP2, MMP7, MMP9 and MMP13 in CXCR4

shRNA1 Tca8113 cells. GAPDH loading control is also shown. E: densitometric analysis

of protein levels of CXCR4, MMP1, MMP2, MMP7, MMP9, and MMP13, relative to





GAPDH, determined by western blotting and compared to Tca8113 cells. Representative

photos of migration and invasion are presented, which were taken at a magnification of

200× under inverted microscopy. error bars indicate SD., n=3 experiments. **, P < 0.01.

Figure 3. CXCR4 modulates cell migration and invasion by regulating MMP9 and MMP13 expression.

A: western blotting analysis of the ligand of CXCR4 SDF-1α was cocultured with

CXCR4-shRNA1 Tca8113 cells. The cells were serum starved for 12 hours and treated

with SDF-1α (100 ng/mL) for 12 and 24 hours. CXCR4 silencing and SDF-1α

overexpression were determined by western blotting (GAPDH levels as loading control). B:

the quantitative analysis of migrated and invaded cells treated with SDF-1α (100 ng/mL)

for 12 hours, which were eluted using 10% Acetic acid and measured Optical Density value

at 560 nm. C: western blotting analysis of MMP1, MMP2, MMP7, MMP9 and MMP13 in

the ligand of CXCR4 SDF-1α cocultured with CXCR4-shRNA1 Tca8113 cells. GAPDH

loading control is also shown. D: densitometric analysis of protein levels of MMP1, MMP2,

MMP7, MMP9, and MMP13, relative to GAPDH, determined by western blotting. E:

Tca8113 cell migration and invasion were analyzed with or without 100 nM TN14003 in

both chambers. F: transcript levels of MMP1, MMP2, MMP7, MMP9 and MMP13 in

Tca8113 cells with or without 100 nM TN14003, relative to GAPDH, determined by

qRT-PCR. G: western blotting analysis of MMP1, MMP2, MMP7, MMP9 and MMP13

protein levels of Tca8113 cells with or without 100 nM TN14003. GAPDH loading control

is also shown. H: densitometric analysis of MMPs protein levels for Tca8113 cells with or

without 100 nM TN14003, relative to GAPDH, determined by western blotting. error bars





indicate SD., n=3 experiments. *, P < 0.05; **, P < 0.01.

Figure 4. MMP9 and MMP13 are downstream targets of CXCR4. A: migration and invasion assays

were performed with Tca8113 cells in the absence or presence of 10 μM MMP inhibitor

OA-Hy or 10 nM MMP inhibitor II. B, mRNA levels of MMP1, MMP2, MMP7, MMP9 and

MMP13 were quantified by real-time PCR upon CXCR4 silencing and MMP inhibitors

compared with control cells. GAPDH mRNA levels were used as internal controls. B:

western blotting analysis of MMP1, MMP2, MMP7, MMP9 and MMP13 upon CXCR4

silencing and MMP inhibitors. GAPDH loading control is also shown. C: densitometric

analysis of protein levels of MMP1, MMP2, MMP7, MMP9, and MMP13, relative to

GAPDH, determined by western blotting and compared to Tca8113 cells. D: CXCR4,

MMP1, MMP2, MMP7, MMP9 and MMP13 mRNA levels were determined by qRT–PCR

in MEF cells and CXCR4-deficient MEF cells. E: CXCR4, MMP1, MMP2, MMP7, MMP9

and MMP13 mRNA levels were determined by qRT–PCR in CXCR4-deficient forebrain

mice and control mice. F: the CXCR4 shRNA1 cells were serum starved for 12 hours and

treated with SDF-1α (100 ng/mL) for 12 hours. Increased mRNA levels of MMP9 and

MMP13, determined by qRT-PCR, in CXCR4 shRNA 1 cells treated with SDF-1α,

compared with CXCR4 shRNA1 cells. GAPDH levels were used as internal control. error

bars indicate SD, n=3 experiments. *, P < 0.05; **, P < 0.01.

Figure 5. Decreased migration and invasion in CXCR4 knockdown Tca8113 cells were rescued by

MMP9 and MMP13 overexpression. A: invasion assay was performed after the ligand of

CXCR4 SDF-1α was cocultured and MMP9 or MMP13 expression vector were cotransfected





with CXCR4 shRNA1 cells. B: the invaded cells on the bottom side of the membrane were

stained with 0.1% crystal violet solution, then the stained inserts were eluted using 10%

Acetic acid and measured Optical Density value at 560 nm. C: western blotting analysis of

MMP9 and MMP13 upon CXCR4 overexpressing and ectopic expression of MMP9 or

MMP13. GAPDH loading control is also shown. D: densitometric analysis of protein levels of

MMP9, and MMP13, relative to GAPDH, determined by western blotting and compared to

CXCR4-silenced Tca8113 cells. Scale bars,100μm. error bars indicate SD., n=3 experiments.

*, P < 0.05; **, P < 0.01.

Figure 6. CXCR4 silencing decreased phosphorylated ERK. Effects of CXCR4 silencing on several

cellular signaling pathways were analyzed by Western blotting. A: control shRNA or CXCR4

shRNA1, without or with SDF-1α, were cocultured with CXCR4 shRNA1 cells. The same

amounts of lysates were analyzed by Western blotting for CXCR4 expression and the levels

of indicated signaling molecules. GAPDH loading control is also shown. B: densitometric

analysis of protein levels of pERK, relative to GAPDH, determined by Western blotting and

compared to control shRNA cells. error bars indicate SD., n=3 experiments. *, P < 0.05;

Supplementary Figure 1. CXCR4 silencing decreased the proliferation rate of CXCR4-shRNA1 cells

slightly compared with Tca8113 and control shRNA cells. The number of

viable cells was assessed by CCK-8 assay. All data points are the mean ±

SD from three separate experiments of each group.

Supplementary Figure 2. CXCR4 silencing inhibits SCC-4, SCC-9, SCC-15, and SCC-25 human

tongue squamous cell carcinoma cells invasion. A: three-dimensional





invasion assay were performed using Boyden Chambers in CXCR4-shRNA1

SCC-4, SCC-9, SCC-15, and SCC-25 cells. the invaded cells on the bottom

side of the membrane were stained with 0.1% crystal violet solution, then

the stained inserts were eluted using 10% Acetic acid and measured Optical

Density value at 560 nm. B: western blotting analysis of MMP1, MMP2,

MMP7, MMP9 and MMP13 upon CXCR4-shRNA1 SCC-4, SCC-9,

SCC-15, and SCC-25 cells. GAPDH loading control is also shown. error

bars indicate SD., n=3 experiments. *, P < 0.05; **, P < 0.01.




Table 1. The primers for quantitative Real-Time RT-PCR

Genes Forward Primer (5'-3') Reverse Primer (5'-3')

CXCR4 AGACCACAGTCATCCTCATCCT GTTCTCAAACTCACACCCTTGC

MMP1 GGGAGATCATCGGGACAACTC GGGCCTGGTTGAAAAGCAT

MMP2 CTGACCCCCAGTCCTATCTGCC TGTTGGGAACGCCTGACTTCAG

MMP7 GAGATGCTCACTTCGATGAGG GGATCAGAGGAATGTCCCATAC

MMP9 CTTTGACAGCGACAAGAAGTGG GGCACTGAGGAATGATCTAAGC

MMP13 TTGTTGCTGCGCATGAGTTCG GGGTGCTCATATGCAGCATCA

GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT




Published OnlineFirst January 4, 2011.Mol Cancer Res Tao Yu, Yingying Wu, Joseph I Helman, et al. signaling pathwayinvasion through inducing expression of MMP-9, 13 via the ERK CXCR4 promotes oral squamous cell carcinoma migration and

Updated version

10.1158/1541-7786.MCR-10-0386doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2011/09/01/1541-7786.MCR-10-0386.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2011/01/04/1541-7786.MCR-10-0386To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-10-0386

http://mcr.aacrjournals.org/content/suppl/2011/09/01/1541-7786.MCR-10-0386.DC1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2011/01/04/1541-7786.MCR-10-0386


author manuscripts have been peer reviewed and accepted ... · 1/4/2011 · 3 department of oral...

Documents