AsABridgeForLiteracy

Reading About DNA As An Extension

This is not a presentation about any single tech tool (clickers) – It is

supposed to be about how a technology has unlocked another

world that can bridge our disciplines-

Do Any Of These Interest You?1- Can you be addicted to cat urine2- Who were the other humans ?3- Can there be a Champanzee ?4- Can you get your sister arrested for murder ?5- Can twins have different dads ?6- Darwin’s ‘finches’ ?7- Can I turn into The Hulk or Spiderman ?8- Is Bigfoot real ?9- Are you my mother ? (mitochondrial DNA)10- Am I eating Shrimp or Shramp ?11- President Jefferson’s children ?12- Why am I lactose intolerant ?13- Native Americans & the introduction of alcohol14- What did The Plague have to do with the development of Europe ?15- How related are you to Kevin Bacon16- Is there a DNA basis for Race ?17- When was North America actually settled ?18- What killed Napoléon's soldiers ?19- Genetic diversity of humans in the Valley of Mexico20- How accurate, really is DNA (for crime cases etc..)

Darwin’sFinches

OrAreThey?Tanagers?

Some (a lot) of people carry a gene which codes for a disease called Sickle Cell – This gene can protect you

from malaria –So – People who come from parts of the world where malaria is prevalent tend to carry the gene in higher

frequencies (math)

TheBiologyOfSkinColorMelanin

TheBiologyOfSkinColor

TheBiologyOfSkinColorVitaminDDeficiency

DNA As A Cross-Curricular Bridge(history; stats; writing; art; social, cultural)

a. Common Knowledge About DNAb. How has technology changed how

we can study DNA ?c. How can we use this to link our

classrooms together?

Picture of mother and child in an embrace after what is termed ‘China’s Pompeii’.

DNA proved that the child and the mother are not directly related-

The Boy King

King Tut Was Disabled, Malarial, and Inbred "Frail boy" needed cane, says study, which also

found oldest genetic proof of malaria.

Roy Criner TX, was sentenced with circumstantial evidence to 99 years for the rape & murder of a 16 year old girl. Years later, DNA testing excluded him from being the contributor of genetic material found on the girl. He remained in prison because the appeals judges had no confidence that DNA evidence would have weight over witness testimony. After a reporter found additional evidence that implicated another person, Criner was finally set free.

Family Matters : The ‘Other Humans’

EveryonelivingoutsideofdirectAfricaoriginstodayhasasmallamountofNeanderthalinthem,carriedasalivingrelicoftheseancientencounters.Ateamof

scientistscomparingthefullgenomesofthetwospeciesconcludedthatmostEuropeansandAsianshave

between1to4percentNeanderthalDNA.Indigenoussub-SaharanAfricanshavenoNeanderthalDNAbecause

theirancestorsdidnotmigratethroughEurasia

Super-QuickDNABackground

Super-QuickDNAExtraction

HowDoYou‘See’YourResults?

AverycoolprocesswhichcopiestheDNAmillionsoftimes

WhatMightWeDoWithThisProcess&TheKnowledgeThatIt

Unlocks?

We are testing food (fish) at the store (H-Mart) to see what it is -

In our example it’s sharks/rays –

First of all – What is it !?

Why would we study this ?

Students can study the ecological impact of fishing-

Are organisms endangered ?How many are left ?

How diverse are they ?

What’s ‘a’ next step ?

Students can study the paternity of organisms

Do two babies in the same uterus have different dads ?

What’s the math behind this ?

Given a regular phone number771-1981

How many ‘possible’ phone numbers could you get from this configuration ?

What happens when we run out of phone numbers ?

What happens when we run out of phone numbers ?

We just add area code –Each code

630 or 778 lets you restart the numbers -

DNA codes can be thought of as ‘phone numbers’

Just as each phone number reaches a person- Each DNA number reaches a

species –(if not an individual)

The DNA Phone Number

A T C GEach place only has four ‘digits’

So a 7 place digit DNA code

ATC-CGTA

So a 7 place digit DNA code

ATC-CGTA

Codes for how many variations?

4x4x4x4x4x4x4

Typically the length of the sequence that we look at is 400 to 600 bp

So4 to 400th power ?

This allows us to look at a relatively small piece of DNA and determine what

species a sample is and then by using multiple samples – What individual a

sample is -

The Database Is HUUUGEEE

Which means that we could not even begin to do these types of study without

some control over the data –

This is where computers enter the story-

Here is a DNA sequence from the samples that our students worked with -

TACCTAATCTTTGGTGCCTGAGCAGGTATAGTCGGAACTGGCCTAAGTCTTTTAATTCGAGCAGAGTTGAGCCAGCCCGGATCACTTCTAGGTGATGATCAGATTTATAATGTCCTTGTTACAGCCCATGCCTTAGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGAGGGTTTGGCAATTGACTCGTCCCTTTAATGATTGGCTCTCCAGACATAGCCTTTCCCCGCATGAATAATATGAGCTTTTGACTTTTACCACCTTCATTTCTTCTTCTCCTAGCCTCCGCTGGAGTTGAAGCTGGGGCGGGGACAGGTTGAACTGTCTACCCCCCTCTAGCAGGCAATCTAGCCCACGCGGGGGCCTCCGTAGACTTAACAATTTTCTCTCTCCATTTGGCAGGTATCTCCTCCATCCTAGCTTCCATTAACTTCATCACCACAATTATTAACATAAAACCCCCAGCAATCTCTCAATACCAAACACCTCTATTCGTATGATCAATCCTTGTTACAACTGTCTTACTTCTTATAGCCCTCCCAGTTCTAGCAGCTGGCATTACTATGCTTCTCACAGATCGTAACCTCAATACAACTTTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTTTACCAGCACCTGTTCTGATTTTTTGGG

This sample was taken from a fishpurchased at H-Mart- DNA was

extracted and then copied and then sequenced –

Students were given the raw sample data and what did they do with it ?

http://blast.ncbi.nlm.nih.gov/Blast.cgi

How Is Alcohol Metabolized ?

You need two enzymes –Alcohol Dehydrogenase (ADH) & Acetaldehyde Dehydrogenase (ALDH)

Native Chinese and Japanese populations produce a lot of ADH. 85% of their population produces unusual high activities of this enzyme. Where Caucasians score less than 21%, African Descent Americans less than 10% and Native Americans as well as Asian Indians 0%.

Don’t jump to any conclusions yet --Now about half of the Chinese and Japanese (Koreans way less by the way) lack the normal amount of this second enzyme (ALDH). The result is that in many cases a byproduct builds up very fast when these individuals start drinking. First of all because of the big amount of ADH and second because of the lack of ALDH 2. This is very unfortunate since this byproduct makes you way more sick than ethanol itself. This genetic disadvantage is the reason that you can’t hold your liquor. A clear sign of a high acetaldehyde-level is that the face turns extremely red.

Tsutomu Yamaguchi-san, the first officially recognized survivor of BOTH atomic blasts in Japan.

How Closely Are We Related To Kevin Bacon ?

Genetic studies tend to support the ‘out of Africa’ model. The highest levels of genetic variation? in humans are found in Africa. In fact there is more genetic diversity in Africa compared with the rest of the world put together. In addition, the origin of modern DNA in the mitochondria (the ‘powerhouses’ of our cells) has been tracked back to just one African woman who lived between 50,000 and 500,000 years ago –'Mitochondrial Eve'.

You Can Get Your Sister Caught

This might be a little messed up (kind of like time travel)

Scenario: If your sister commits a crimeAnd she leaves DNA at the scene of the crime But- She is not in any DNA database (never been caught)It is possible to ‘tell’ the computer to look for a theoretical sibling of known sample taken from the crime –There are lots of DNA databases out there --Then a list is generated and even though you are innocent you could be visited by law enforcement asking you if you have a sibling and details about them -

A Single Letter Out Of Billions

Tay-Sachs A terrible condition where the neurons in the brain are choked by

too much of a malformed protein-This protein is made incorrectly because of single error in a single

letter in a strand of DNA that you inherited –There are more than a few variations of Tay-Sachs and they are

prevalent in multiple groups of people (culture)

What’s weird is that this terrible condition actually confers resistance to another disease called TB or tuberculosis so there is a genetic reason why this condition continues to persist in our genetic

code -

Do Any Of These Interest You?http://www.forbes.com/sites/kristinakillgrove/2015/10/27/mysteries-of-the-black-death-shroud-of-turin-and-origins-of-early-americans-solved-with-dna/#184402ae7584

http://news.nationalgeographic.com/news/2010/02/100216-king-tut-malaria-bones-inbred-tutankhamun/#/12801.ngsversion.1421960076665.jpg

http://forensicoutreach.com/library/5-real-life-cases-where-dna-profiling-changed-everything/

https://genographic.nationalgeographic.com/neanderthal/

http://thebrainscoop.tumblr.com/post/139191025076/darwins-tanagers-dyk-darwins-finches-arent

http://www.yourgenome.org/stories/evolution-of-modern-humans