Arterial Remodelling andInflammation in Peripheral Arterial

Disease

Dr. Rasheeda Mohd. Zamin

(MBBS, MSc. Anatomy)

This thesis is presented for the degree of Doctor of Philosophyat The University of Western Australia

School of Anatomy,Physiology & Human Biology

2013

0

This thesis is dedicated to my loving and wonderful family:

Muhammad ‘IzzuddinUmaira Yusraa

Muhammad UwaisMohd. Zamin Jumaat

Robiah BaniNoor Hayati Hashim

Mohamad Adi

1

Abstract

Peripheral arterial disease (PAD) can lead to impaired perfusion to the lower limbs and

remains an important cause for non-traumatic lower limb amputations. PAD is

becoming known as an inflammatory disease with established biomarkers such as C-

reactive protein and osteoprotegerin (OPG). PAD is commonly associated with diabetes

mellitus, which is thought to be a product of low-grade but chronic inflammation.

Common pathological causes of PAD, which include atherosclerosis, are now linked to

the presence of several inflammatory factors such as fractalkine receptor (CX3CR1) and

monocyte chemotactic protein-1 receptor (now known as CCR2). Another common

characteristic of PAD is arterial calcification, which previously received less attention

but is now being investigated for the receptor activator of nuclear factor kappa-B

(RANK), RANK ligand and OPG involvement as part of an active cellular regulation of

the calcification process. Not only does atherosclerosis have a close association with

inflammatory and immune-based regulation, but also there is strong evidence to suggest

that arterial calcification is regulated by inflammatory factors. It is important to identify

the specific inflammatory factors, which may play a role in the development and

progression of PAD.

Peripheral arterial disease, as a form of pathological arterial wall remodelling and

known as arteriosclerosis, may present with two distinct types of calcification in which,

one may involve the intima and another, the media. Intimal calcification, which is a

feature of advanced atherosclerosis, initially involves infiltration of monocytes and

macrophages, which turn into foam cells and are deposited in the sub-endothelial layer.

In medial calcification, inflammatory mediators such as chemokines and cytokines, may

be released and drive arterial wall changes by modulating the phenotypic expression

and function of the arterial smooth muscle cells (ASMC). The pathological remodelling

of the arterial wall may involve cells, which have been activated or influenced to behave

like osteoblast cells, which can secrete mineralization matrix and may activate

infiltrating monocytes into mature osteoclasts. A persistent source of inflammation

could be from an intracellular infection of the ASMC with organisms such as

Chlamydia pneumoniae (CP).

ii

Thus, the thesis first aimed to assess the severity of calcification and lipid deposition in

the arterial walls of arteries obtained from limbs amputated for PAD, comparing these

to cadaveric controls. Secondly, the expression of the inflammatory markers: CCR2,

CX3CR1and RANK were investigated in both diabetic and non-diabetic PAD arterial

samples. Thirdly, the ASMC cultured from PAD samples and fetal aortic derived

ASMC were characterized and investigated for expression of lineage markers for

smooth muscle cells, fibroblasts, osteoblasts and precursor cells. The relevant

inflammatory surface markers such as RANK, CX3CR1 and their membrane bound

ligands were also investigated. Finally, possible source of infection such as CP were

also investigated as the possible cause of inflammation in the arterial wall.

Following the recruitment of 17 patients undergoing non-traumatic lower limb

amputation, 53 arteries were harvested for histopathological study and inflammatory

marker detection using immunofluorescence-based techniques. Out of 17 patients, 10

were diabetic. This thesis further investigated the relevant phenotypic and inflammatory

surface markers of successfully cultured ASMC (70% growth from the patient samples),

which have been postulated to play a role in pathological arterial remodelling. Flow

cytometry was also used to quantify the phenotypic and inflammatory markers exhibited

by PAD samples (diabetic and non-diabetic), and control samples that are derived from

human fetal aortic smooth muscle cells. Tissue immunofluorescence microscopy and

PCR were used to detect the intracellular pathogen in diabetic and non-diabetic PAD

samples, to determine the possible role of intracellular infection CP as a cause for

inflammation.

Generally, the arteries from both diabetic and non-diabetic amputated PAD cases

exhibited severe calcification when compared to the controls. Immunohistopathological

findings showed that RANK and CX3CR1 were expressed in these calcified arterial

walls but no expression of CCR2 was seen. In vitro evidence for phenotypic changes in

PAD derived ASMC suggested an osteoblast-like phenotype where there was positive

expression of vimentin, Stro-1, Runx2, Osterix along with the inflammatory markers

RANK and CX3CR1. The rate of detection of CP in the tissue immunofluorescence

microscopy was more than 50%, while PCR detection revealed 14% and 32% positivity

in diabetic and non-diabetic PAD samples, respectively. In vitro, the ASMC derived

from PAD samples responded to some extent with evidence of up-regulation in TLR4

iii

and CD14 following LPS activation. This supports the previous findings of CP

detection in diseased arteries and suggests a role of inflammation in pathological arterial

wall remodelling without diabetes.

Previous studies have proposed a role for CX3CR1 expression and positive CP infection

in atherosclerosis development. In the context of vascular diseases, RANK and OPG

activities have also been implicated separately from CX3CR1 studies. This thesis has

concluded that the activity or presence of these inflammatory markers, synergistically

lead to the progression of PAD towards more calcification in the media, as a severe

form of pathological arterial remodelling. Additional molecular experiments need to be

performed in order to provide detailed pathways and mechanism of actions (for e.g. the

influence of LPS on CX3CR1 and RANK expression at the cellular level), before these

inflammatory receptors can be considered as therapeutic targets in clinical studies.

iv

TABLE OF CONTENTS

Abstract ...................................................................................................................................... i

TABLE OF CONTENTS...........................................................................................................iv

Acknowledgements ............................................................................................................ vii

Statement of candidate contribution ..........................................................................viii

Academic Contribution .......................................................................................................ix

List of figures ........................................................................................................................... x

List of tables .......................................................................................................................... xii

Abbreviations ......................................................................................................................xiii

CHAPTER 1: INTRODUCTION .............................................................................................11.1 Clinical manifestations and diagnosis .............................................................................. 11.2 Epidemiology of PAD............................................................................................................... 31.3 Pathogenesis of PAD................................................................................................................ 41.4 Risk factors and common etiology of PAD ...................................................................... 5

CHAPTER 2: LITERATURE REVIEW ..................................................................................72.1 The arterial wall ....................................................................................................................... 72.2 Arterial remodelling ............................................................................................................... 9

2.2.1 Physiological arterial remodelling............................................................................................92.2.2 Pathological arterial remodelling .............................................................................................92.2.3 Cellular origin in arterial remodelling ....................................................................................9

2.3 Arterial inflammation...........................................................................................................112.3.2 Atherosclerosis .............................................................................................................................. 112.3.3 Causes of arterial inflammation: role of infection........................................................... 12

2.4 Arterial calcification .............................................................................................................132.4.1 Arterial cells and bone biology................................................................................................ 14

CHAPTER 3: AIMS AND HYPOTHESES........................................................................... 17

CHAPTER 4: GENERAL METHODS .................................................................................. 194.1 Materials and methods.........................................................................................................194.2 Arterial samples .....................................................................................................................20

CHAPTER 5: HISTOPATHOLOGICAL EVALUATION OF 53 ARTERIES FROM 17PAD CASES.............................................................................................................................. 21

5.1 Introduction.............................................................................................................................215.2 Hypothesis and aim...............................................................................................................215.3 Materials and Methods.........................................................................................................22

5.3.1 Arterial samples ............................................................................................................................ 225.3.2 Histopathological analysis ........................................................................................................ 225.3.3 Inter scorer reliability................................................................................................................. 255.3.4 Statistical analysis ........................................................................................................................ 26

5.4 Results........................................................................................................................................265.4.1 Subject population........................................................................................................................ 265.4.2 Differences between arterial location.................................................................................. 26

v

5.4.3 Calcification scores in PAD cases and controls................................................................. 275.4.4 Calcification scores in PAD cases with or without diabetes........................................ 275.4.5 Lipid scores in PAD cases and controls ............................................................................... 285.4.6 Lipid scores in PAD cases with or without diabetes ...................................................... 28

5.5 Discussion .................................................................................................................................29

CHAPTER 6: EXPRESSION OF RANK AND CX3CR1 IN ARTERIES DERIVEDFROM PERIPHERAL ARTERIAL DISEASE ..................................................................... 31

6.1 Introduction.............................................................................................................................316.2 Hypothesis and Aim...............................................................................................................326.3 Materials and Methods.........................................................................................................32

6.3.1 Patient demographics ................................................................................................................. 326.3.2 Tissue immunofluorescent study........................................................................................... 326.3.3 Detection of tartrate-resistant acid phosphatase (TRAP) ........................................... 336.3.4 Statistical analysis ........................................................................................................................ 33

6.4 Results........................................................................................................................................346.4.1 Immunohistological findings of pan leukocytic markers and SMA..................346.4.2 Immunohistological findings of inflammatory and bone markers ..................346.4.3 Tissue TRAP activity..........................................................................................................386.5 Discussion .................................................................................................................................40

CHAPTER 7: THE OSTEOBLAST-LIKE PHENOTYPE IN PAD SMOOTH MUSCLECELLS ....................................................................................................................................... 43

7.1 Introduction.............................................................................................................................437.2 Hypothesis and Aims.........................................................................................................447.3 Materials and Methods.........................................................................................................45

7.3.1 Cell culture....................................................................................................................................... 457.3.2 Flow cytometry and fluorescence microscopy................................................................. 457.3.3 Data and statistical analysis ..................................................................................................... 45

7.4 Results........................................................................................................................................477.4.1 Characterisation of ASMC according to lineage markers ............................................. 477.4.2 Characterisation of ASMC according to inflammatory markers................................ 50

7.5 Discussion .................................................................................................................................53

CHAPTER 8: INFECTIVE EVIDENCE IN PAD SAMPLES ............................................. 578.1 Introduction.............................................................................................................................578.2 Hypothesis and Aims.............................................................................................................588.3 Material & Methods ...............................................................................................................58

8.3.1 Antigen detection in tissue sections from PAD samples .............................................. 598.3.2 DNA extraction from cryosections ........................................................................................ 598.3.3 C. pneumoniae-species specific PCR screening................................................................. 598.3.4 Genotyping of C. pneumoniae PCR positive arterial samples...................................... 608.3.5 General PCR parameters............................................................................................................ 608.3.6 Statistical evaluation ................................................................................................................... 61

8.4 Results........................................................................................................................................618.4.1 Immunofluorescent detection of C. Pneumoniae in arterial tissues from PADsamples ........................................................................................................................................................ 618.4.2 PCR detection of C. Pneumoniae.............................................................................................. 628.4.3 Detection of C. Pneumoniae in ASMC derived from PAD samples ............................ 628.4.4 LPS activation induced TLR4 and CD14 expression....................................................... 65

8.5 Discussion .................................................................................................................................67

CHAPTER 9: DISCUSSION .................................................................................................. 699.1 Major histopathological findings......................................................................................699.2 Expression of CX3CR1 in the intima ................................................................................709.3 Expression of CX3CR1 and RANK in the media............................................................709.4 In vitro assessment ................................................................................................................719.5 CX3CR1 expression and relation to vascular calcification......................................72

vi

9.6 Possible infective cause as a source of inflammation ...............................................739.7 Limitations of the study .......................................................................................................74

9.7.1 Sample size ...................................................................................................................................... 749.7.2 Variability in biological samples............................................................................................. 759.7.3 Methodological aspects .............................................................................................................. 75

9.8 Future direction......................................................................................................................759.9 Conclusions ..............................................................................................................................75

REFERENCES.......................................................................................................................... 77

Appendix I.............................................................................................................................. 88A. SPECIFICITY OF RESEARCH ...............................................................................................89B. STORAGE OF SAMPLES........................................................................................................89C. ACCESS TO SAMPLES AND RESEARCH RESULTS.........................................................90

CONSENT..................................................................................................................................................... 90

Appendix II ............................................................................................................................ 97

Appendix III........................................................................................................................... 98

vii

Acknowledgements

I wish to thank all the following people who have helped me throughout my PhD

journey. My supervisors: Luis Filgueira, Paul Norman and Silvana Gaudieri. Without

them, I may not have reach out to my dream of seeing this work completed. To the

School of Anatomy, Physiology & Human Biology, I would like to thank all the staff

and fellow PhD students who made me feel welcome and exist as a family. Special

thanks to the school’s lab manager Greg Cozens; and Mary Lee, Leonie Khoo and Guy

Ben Ary from CELLCentral histology and biological image Lab. A big thank you to

John Murphy, Paul Rigby, Tamara Abel and Kathy Heel from CMCA for providing me

help, support and assistance to use all the high end equipment for my slides scanning,

microscopy and flow cytometry. To the manager of Crawley Village, Carolyn de Graw

and her assistant, Anna Karhunen, thank you for providing an excellent post-graduate

accommodation and allowing me to continue my lease year after year, and to be able to

live close by the university and walk over to my labs or the library in the day or at night.

Last but not least, I would like to express my gratitude to family members and close

friends who have supported me in all ways that they can.

viii

Statement of candidate contribution

The experimental work in this thesis was carried out at the University of Western

Australia under the supervision of Prof. Luis Filgueira (previously at the School of

Anatomy, Physiology and Human Biology), now the Chair of Anatomy at the

University of Fribourg, Switzerland. Internal supervisors include Winthrop Professor

Paul Norman (School of Surgery/Fremantle Hospital) and Associate Professor Silvana

Gaudieri (School of Anatomy, Physiology and Human Biology).

The PCR work in Chapter 7 was a contribution from Dr. Adam Polkinghorne’s group

from the Institute of Health and Biomedical Innovation, Queensland University of

Technology, Brisbane.

Otherwise, the work described in this thesis is original and entirely my own, except

where the contributions of others are acknowledged.

I also received financial assistance from the Malaysian Ministry of Higher Education

Scholarships and the University of Western Australia PhD Completion Scholarships.

Rasheeda Mohd. Zamin10th July 2013

ix

Academic Contribution

1. Poster Title: The role of inflammatory cytokines with effects of hyperglycemia on

arterial wall changes leading to chronic wound healing

Author(s): Zamin R.; Filgueira L.

Source: WOUND REPAIR AND REGENERATION Volume:18 Issue: 4 Pages:

A68-A68 Meeting Abstract: 38 Published: JUL-AUG 2010

2. Poster Title: The influence of hyperglycemia and inflammatory cytokine on human

arterial smooth muscle cell phenotype: implications for diabetic arterial disease

Author(s): Zamin R.; Filgueira L.; Norman P.

Conference: 20th Annual Combined Biological Sciences Meeting, AUG 27, 2010

Location: The University Club, University of Western Australia

3. Oral Presentation: The influence of hyperglycemia and inflammatory cytokine on

human arterial smooth muscle cell phenotype: implications for diabetic arterial

disease

Author(s): Zamin R.; Filgueira L.; Norman P.

The Asian-Pacific Society of Atherosclerosis and Vascular Disease (APSAVD)

Congress OCT 25-29, 2010.

Location: Cairns, Queensland.

4. Abstract Title: The association of peripheral arterial disease (PAD) with infective

and inflammatory factors: assessing the presence of chemokine receptors (CCR2,

CX3CR1 and RANK)

Author(s): Zamin R.; Filgueira L.; Norman P.

Conference: Annual Congress of the British-Society-for-Immunology

Location: Liverpool, United Kingdom. Date: DEC 05-08, 2011 Sponsor(s): British

Soc Immunol Source: IMMUNOLOGY Volume: 135 Special Issue:

SI Supplement: 1 Pages: 116-116 Published: DEC 2011

5. Oral Presentation: The role of inflammatory factors in diabetic and non-diabetic

peripheral arterial disease

Author(s): Zamin R.; Filgueira L.; Norman P.

Anatomy and Human Biology Postgraduate Student Expo (21st July 2011)

Location: The University of Western Australia

6. Poster Title: Bacterial LPS Influences Receptor Activator NF Kappa B and

Fractalkine Receptors Expression In Arterial Smooth Muscle Cells Derived From

Limbs Amputated For Peripheral Arterial Disease Author(s): Zamin, Rasheeda;

Norman, Paul; Filgueira, Luis. Conference: Experimental Biology Meeting

Location: San Diego, CA Date: APR 21-25, 2012.Source: FASEB

JOURNAL Volume: 26 Published: APR 2012

7. Journal Article: A novel in vitro human microglia model: Characterization of human

monocyte-derived microglia. Author(s): Etemad, Samar; Zamin, Rasheeda Mohd;

Ruitenberg, Marc J.; et al. Source: JOURNAL OF NEUROSCIENCE

METHODS Volume: 209 Issue: 1 Pages: 79-89 DOI:

x

10.1016/j.jneumeth.2012.05.025 Published: JUL 30 2012

List of figures

Figure 1.1 An example of digital subtraction angiogram showing atherosclerotic

plaque in the femoral artery, medial artery calcification shown in a plain x-ray and

tibial artery disease in a diabetic patient ____________________________________ 3

Figure 2.1 The structural representation of arterial wall layers __________________ 8

Figure 2.2 Proposed remodelling in arterial calcification with the involvement of two

key cells: monocyte derived osteoclasts and osteoblast-like smooth muscle cells ____ 15

Figure 4.1 Flow chart of the general research design for the thesis project. _______ 19

Figure 5.1 Scores of ‘0’ given for arterial section which are free from calcification

when stained with H&E and free from lipid deposition when stained with Oil red O _ 23

Figure 5.2 Calcification scoring was made using H&E staining indicated by the dark

purplish area in each segmental quadrant __________________________________ 24

Figure 5.3 Lipid scoring by quadrant involvement represented by the number of arrows

shown in each sample stained with oil red O ________________________________ 25

Figure 5.4 The mean scores from 6 different observers were plotted against the

author’s score ________________________________________________________ 26

Figure 5.5 Median scores of calcification and lipid deposition are shown in the box

plots for different arterial locations _______________________________________ 27

Figure 5.6 Median of calcification scorings is shown for control and PAD cases in box

plots________________________________________________________________ 28

Figure 5.7 Median of lipid scorings is shown for control and PAD cases in box plots 29

Figure 6.1 Presence of alpha SMA (stained green) in both the media and intima and

RANK expression in tissue samples _______________________________________ 35

Figure 6.2 CX3CR1 expression in PAD samples with either atherosclerosis or calcified

features _____________________________________________________________ 37

Figure 6.3 Non-DM and DM PAD arterial samples did not differ significantly in

calcification severity ___________________________________________________ 38

Figure 6.4 Medial calcification seen in the control groups (A) without TRAP staining

and (B) with TRAP staining indicates positive TRAP activity ___________________ 39

Figure 6.5 Samples with minimal calcification but having clear lipid deposition (in A)

stained positive with TRAP (in B) _________________________________________ 40

Figure 6.6 External stimuli (hyperglycemia, inflammation resulting from trauma,infection, or other injury) activate certain cells to release RANKL________________41

xi

Figure 7.1 Cells in the first row were stained with alpha smooth muscle actin with

Alexa Fluor 488 (in green). Cells in the second row were stained red with vimentin,

which is strongly positive for the skin fibroblast cells (as positive control)_________ 48

Figure 7.2 Phenotypic markers expression was compared between control cells and

ASMC derived from non-diabetic and diabetic PAD.__________________________ 49

Figure 7.3 Intracellular phenotypic markers assessed by flow cytometry representing

the control (fetal aortic smooth muscle cells) and PAD arterial smooth muscle cell

lineage______________________________________________________________ 50

Figure 7.4 Cover slips grown ASMC (derived from PAD samples) expressing CX3CR1,

CCR4 and RANK in (green fluorescent) with their respective negative controls in the

lower row. Blue fluorescent were the nuclear staining with DAPI _______________ 51

Figure 7.5 Expression of surface markers in cultured fetal aortic SMC (controls) and

arterial SMC derived from non-diabetic and diabetic PAD _____________________ 53

Figure 8.1 There was no difference between positive CP detection using (A)

immunofluorescent microscopy or (B) using PCR methods _____________________ 62

Figure 8.2 ASMC derived from PAD sample (A) stained with primary antibody against

Chlamydia Pneumoniae and (C) without the primary antibody stained with Alexa fluor

488_________________________________________________________________ 63

Figure 8.3 Arrows showing positively stained anti-Chlamydial antibodies in the intima

and media of calcified PAD samples. Non-calcified PAD samples were also positive

with anti-Chlamydial antibodies in both intima and media but negative in control

samples _____________________________________________________________ 64

Figure 8.4 TLR4 immunofluorsecent staining pre (A) and post (B) 24 hours incubation

with LPS 10ng/ml on glass cover slips _____________________________________ 65

Figure 8.5 TLR4 expression from flow cytometry, non-DM (N =5), DM (N =9),

unpaired T-test p=0.30.All samples were not activated with LPS in order to evaluate the

baseline expression of TLR4 _____________________________________________ 66

Figure 8.6 Histograms representing CD14 expression in non-activated ASMC in (A),

activated ASMC with LPS (B) and positive control from human peripheral blood

monocytes (C) ________________________________________________________ 66

xii

List of tables

Table 4.1 Demographic data representing groups of peripheral arterial disease (PAD)

cases and subgroups of the amputees or PAD cases with and without diabetes (DM) and

controls._____________________________________________________________ 20

Table 7.1 List of primary and secondary antibodies used in flow cytometry ________ 46

Table 8.1 Primer sequences for C. pneumoniae detection and genotyping _________ 61

Table 1 (Appendix III) Non-diabetic PAD arterial samples assessed for CP detection

using IF (immunofluorescence) and PCR (polymerase chain reaction)____________ 98

Table 2 (Appendix III) Diabetic PAD arterial samples assessed for CP detection using

IF and PCR __________________________________________________________ 98

xiii

Abbreviations

ABI - Ankle Brachial IndexALP - Alkaline PhosphataseANOVA - Analysis Of VarianceApo E – Apolipoprotein EASMC - Arterial Smooth Muscle CellsATA - Anterior Tibial Arteryc-FMS - CFS-1 Receptor (GM-CSF)CCR2 - Monocyte Chemotactic Factor-1 (MCP-1) ReceptorCCR4 - Chemokine (C-C Motif) Receptor 4CD14 - Cluster Designation-14/Myeloid Cell AntigenCP - Chlamydia PneumoniaeCVD - Cardiovascular DiseaseCX3CL1- Fractalkine (Ligand)CX3CR1-Fractalkine ReceptorDAPI - 4’, 6-Diamidine-2’-Phenylindole DihydrochlorideDM – Diabetes mellitusDPA - Dorsalis Pedis ArteryFIB - Fibular/Peroneal ArteryFITC - Fluorescein IsothiocyanateFKN – Fractalkine/CX3CL1FKNrc – Fractalkine receptor/CX3CR1IF - ImmunofluorescenceIQR - Inter-Quartile RangeLDL - Low Density LipoproteinLLA - Lower Limb AmputationsLPS - LipopolysaccharideLSD - Least Significant DifferenceM-CSF - Macrophage-Colony Stimulating FactorMDC - Macrophage-Derived Chemokine Of CCL22MGP - Matrix Gla ProteinMHC - Myosin Heavy ChainNF-κB - Nuclear Factor Kappa-B OPG – Osteoprotegerin/Osteoclastogenesis Inhibitory Factor (OCIF)PAD - Peripheral Arterial DiseasePBS - Phosphate Buffered SalinePCR -Polymerase Chain ReactionPFA - ParaformaldehydePOP - Popliteal ArteryPTA -Posterior Tibial ArteryRANK -Receptor Activator Of Nuclear Factor Kappa-BRANKL-Receptor Activator Of Nuclear Factor Kappa-B LigandRT- Room TemperatureRunx2 – Runt-Related Transcription Factor-2SMA - Smooth Muscle ActinSMD - Standardized Mean DifferenceTARC -Thymus-and Activation-Regulated Chemokine/CCL17TLR4 -Toll-Like Receptor-4TNFα -Tumour Necrosis Factor-Alpha TRAP -Tartrate Resistant Acid Phosphatase

1

CHAPTER 1: INTRODUCTION

Peripheral arterial disease (PAD) is amongst the commonest clinical manifestations of

atherosclerosis, which also includes acute coronary syndrome, transient ischaemic

attack and ischaemic stroke. These clinical manifestations suggest impaired oxygenated

blood supply to specific organs such as the heart, brain or lower limbs. However, PAD

alone is associated with a similar mortality risk as other manifestations of

cardiovascular disease (Chi & Jaff, 2008).

Soor and colleagues (2008) have demonstrated that there is another significant arterial

wall change i.e. medial calcification, which could impair oxygenated blood perfusion to

the lower limbs. Medial calcification, which is sometimes referred to as medial

sclerosis, is characterized by the presence of calcification in the media distinct from the

intimal layer, where calcification may be seen in atherosclerosis. Soor’s study samples

comprised 58 patients, who underwent lower limb amputations for limb-threatening

ischaemia. All arterial segments obtained in the study had some degree of calcification

with increased stiffening of the arterial wall and loss of vasodilator response and this

may have contributed to distal ischaemia. Medial calcification is also known as a

marker of increased risk of amputation and mortality (Guzman et al., 2008). Other

dominant risk factors for PAD include diabetes mellitus, renal failure, smoking,

advanced age and ethnicity (Aponte, 2012; Levy, 2002; Wattanakit et al., 2005).

1.1 Clinical manifestations and diagnosis

Peripheral arterial disease may initially present as pain in the calf during walking

(claudication), although it may be asymptomatic in individuals who do little walking or

lead a sedentary life-style. A more severe form of the disease is characterized by

persistent rest pain, which becomes worse when the legs are elevated, for example in

bed at night. In this case, it is called critical limb ischemia. In even more severe cases,

patients can develop gangrene and ulceration. At this stage, where the quality of life

might be impaired by the symptoms, patients may be advised to undergo re-

vascularisation. If this fails, lower limb amputation may eventually be necessary. This

however, depends on the extent of tissue damage, persistence of pain and/or recurrent

wound infection.

Making a diagnosis of PAD, as one of the macrovascular complications, may not be

easy as the clinical presentation may coincide with microvascular complications,

2

especially in diabetes mellitus. Calcification for example can affect large to small sized

arteries including the arterioles. When the small arteries are affected, they may cause

peripheral nerve ischaemia (Jeffcoate, Rasmussen, Hofbauer, & Game, 2009). This can

lead to loss of sensation to pain and pressure, which is known as neuropathy. Diabetic

patients are again commonly affected by distal symmetrical neuropathy. Once deprived

of pain sensation, they easily develop neuropathic ulceration or poor healing ulcer with

sepsis. Persistent local pressure can also lead to tissue necrosis and this may also be a

cause of non-traumatic lower limb amputations.

In the diagnosis of PAD, the widely used screening method is the measurement of the

ankle-brachial systolic pressure index (ABI). A resting ABI of < 0.90 is the standard

cut-off point (Norgren et al., 2007). However, this method may not be specific and

sensitive enough, in particular with patients with calcified arteries. When the arteries are

stiffened because of calcification, they cannot not be fully compressed and this leads to

an artificially higher reading of the ABI (Criqui & Ix, 2012). Therefore, the diagnosis of

PAD is best combined with imaging modalities such as angiograms (Figure 1.1A). The

common finding for PAD is usually blockage in one or more of the vessels and/or

calcified arteries (see Figure 1.1B and 1.1C).

A B

3

C

Figure 1.1 An angiogram showing atherosclerotic plaque in the femoral artery (A),

medial artery calcification shown in a plain X-ray (B) and tibial artery disease in a

diabetic patient as shown in a digital subtraction angiogram (C). Arrow show sites of

arterial lesions.

1.2 Epidemiology of PAD

The mean age of patients hospitalized with PAD in Western Australia is 69.0 years for

men and 71.5 years for women (Nedkoff et al., 2012). The prevalence of PAD has been

increasing and in Western Australia it affects about 15% of men aged 65 and over

(Fowler, Jamrozik, Norman, & Allen, 2002). PAD is common in the aging population

and events of lower limb amputations were reported to be on the rise with the increasing

prevalence of diabetes mellitus. It has been reported in Australia that the incidence of

diabetes mellitus is steadily rising. The current estimates from the Australian Institute of

Health and Welfare (AIHW, 2011) showed nearly 900,000 or 4.1% of the Australian

population have been diagnosed with diabetes mellitus (between 2007-08). The rate of

diabetes has more than doubled from 1.5% cases over just two decades, when compared

to the rate diagnosed in 1989. Thus, PAD, as part of the cardiovascular disease burden

remains an important morbidity and mortality risk factor.

4

The link of PAD to the incidence of acute cardiovascular events has been assessed in

nearly 3000 participants ranging from 61-65 years at follow-up (Abbott, Brand, &

Kannel, 1990). Twenty years follow-up data collected from the Framingham Study has

been evaluated to determine the relationship between diabetes mellitus and clinical

findings of occlusive peripheral arterial findings, which were at that time assessed by

carotid/femoral bruits and non-palpable pedal pulse. This study supported the findings

of high risk of occlusive PAD symptoms in diabetic patients. However, without severe

occlusive arterial disease, this group of patients may have severe medial calcification

instead (Soor et al. 2008). The combination of PAD with diabetes mellitus is known to

increase mortality and morbidity rate including lower limb amputations (Golomb, Dang,

& Criqui, 2006).

1.3 Pathogenesis of PAD

In a histological study of peripheral arteries, Jeziorska and colleagues (1998) proposed

an association between atherosclerosis and inflammatory cells such as macrophages and

mast cells. This is exclusively seen in the intimal region where there is prominent

infiltration with inflammatory cells. However, when the group described the media of

diseased arteries, they noted predominance of medial calcification with no macrophages

or other inflammatory cell accumulation. They described the calcification in the media

as a separate pathology, which could have different inflammatory mediators. They also

suggested that arterial calcification is an organized and regulated process rather than a

passive ageing phenomenon.

It has been agreed that atherosclerosis and medial calcification should be considered as

separate pathologies (Fishbein & Fishbein, 2009). Atherosclerotic lesions may involve a

varying degree of changes in the intimal layer from fatty streak to atheroma plaque

formation. Advanced atherosclerosis usually involves calcification of the arterial wall as

well (Stary et al. 1995). While atherosclerosis is confined to the intima, medial

calcification occurs exclusively in the media. Monkeberg gave rise to the term

Monkeberg’s sclerosis and described this specific histological change as early as 1903.

Monkeberg has also been reported as the first scientist to describe prevalent arterial

calcification in the distal arteries (Jeffcoate et al. 2009). Despite being a common

finding in the healthy aging population, both lesions (atherosclerosis and medial

sclerosis) are now becoming more common in a much younger group of patients with

chronic diseases such as diabetes mellitus or renal failure.

5

1.4 Risk factors and common etiology of PAD

The main risk factors for PAD are advanced age, smoking, diabetes mellitus,

hypertension and dyslipidaemia. As mentioned by Norgen and colleagues (2007), the

relative risk for developing PAD is less for hypertension than diabetes mellitus or

smoking. However, once hypertension is complicated with renal failure, then the risk of

having PAD may rise.

Ageing, for example was initially proposed as a risk factor because of the high

incidence or prevalence of PAD in the aging population. As put forward by Norgren and

others (2007), the risk factors may come out of association alone with no definitive

causal factor to be linked to the event of PAD.

With the increasing information on inflammatory-based diseases (Moe & Chen, 2005),

more can be postulated for the probable underlying factors for PAD. Despite the

seemingly multifactorial reasons, they may be underpinned by unifying inflammatory

causes. This thesis will try to bring together the common clinical manifestations of

atherosclerosis and medial calcification, which is PAD, under the umbrella of

inflammation and arterial remodelling.

There seems to be a type of mechanism in place in the arterial wall that is similar to

bone-formation, which may be responsible for the calcification and, which in itself is

pathological in the context of the artery (Boström et al., 1993; Parfitt, 1984). A better

understanding of how this bone-like process works in general, and specifically in the

arterial calcification, may help to identify new therapeutic approaches.

In addition, there are a number of bone diseases such as osteoporosis and arthritis

associated with vascular calcification, suggesting that inflammatory immune response

may be influencing bone metabolism at the same time (Foo, Frey, Yang, Zellweger, &

Filgueira, 2007; Weitzmann & Pacifici, 2006). It is not a straightforward case of

calcium depletion in the bone becoming deposits on the arterial wall, but rather an

intricate network of the adaptive immune system with T lymphocyte activity

augmenting release of immune factors and cytokines that influence bone, and possibly

vascular biology, such as RANKL and TNF-α (Chan, Mhawi, Clode, Saunders, &

Filgueira, 2009).

In vivo evidence of inflammatory burden has been shown in Apo E deficient mice with

increased arterial and valvular calcification, which at the same time showed loss of bone

mineral density (Hjortnaes et al., 2010). Due to the inherent difficulties associated with

investigation in humans, much information has been gained from animal models.

6

Consequently, many of the principles identified in animals need to await further

validation in humans. In this thesis, the main investigations were carried out in human

samples and this may still be hampered by certain limitations. The outcome may differ

from those that have been shown in animal models. The issue of limitations will be

further highlighted in the final discussion chapter. The next chapter will further review

the key players in pathological arterial wall remodelling and the underlying

inflammatory mediators relevant to PAD.

7

CHAPTER 2: LITERATURE REVIEW

This chapter aims to review the relevant background of the inflammation theory behind

atherosclerosis and medial calcification relevant to PAD. It has been proposed that

inflammation may drive the arterial wall changes and the corresponding arterial wall

remodelling (Ward, Pasterkamp, Yeung, & Borst, 2000).

2.1 The arterial wall

The arterial wall has three layers called tunics. The tunica externa or adventitia is the

outermost layer. It consists of loose connective tissue that often merges with

neighboring structures such as other blood vessels, nerves or an organ. This outermost

layer provides an anchor and passage to smaller nerves, lymphatic vessels and smaller

vessels called the vasa vasorum. The vasa vasorum represent feeding arteries to the

outer half of the larger arterial wall (see Figure 2.1A).

The middle layer of an artery is called the tunica media and is usually the thickest in

size because it has to withstand the surges of blood pressure generated by the pumping

heart. The media also lends a more muscular structure to the artery and when compared

to the veins, the arteries will appear relatively round in tissue sections. The tunica media

is generally made of arterial smooth muscle cells (ASMC), collagen and elastic tissue.

The largest artery, which is the aorta usually, has the highest amount of elastic fibers in

its media. Whereas the muscular arteries such as the femoral and popliteal arteries have

less amount of this elastic sheets in their media. The tunica intima and media is usually

separated by the internal elastic lamina (see Figure 2.1B). However the internal elastic

lamina may not be visible in a large artery due to the high amount of elastic lamellae.

The innermost layer facing the lumen is the tunica intima, where the arterial wall is

exposed to the blood. This layer could differ in thickness, depending on the size of the

artery. The large artery have a thicker intimal layer due to the large subendothelial area

and the medium arteries may have several layers of endothelial cells in the intima,

although thinner than the intima of the large arteries. Finally, the arterioles usually

consist of simple squamous endothelium overlying a basement membrane. An intact

endothelial layer provides a smooth inner lining that normally repels blood cells and

platelets. Platelets may adhere to a damaged endothelium and during inflammation.

8

A

B

Figure 2.1 Structural representation of the arterial wall layers principally found in a

medium sized artery (A), and histological cross section with arrow indicating the

internal elastic lamina (B). Images taken from www.graysanatomyonline.com.

9

2.2 Arterial remodelling

2.2.1 Physiological arterial remodelling

Remodelling in a physiological sense is predominantly a maintenance cycle to ensure

normal functioning of a tissue. In the arteries, this could involve normal turnover of

cells such as the endothelial cells and ASMC. A well-regulated turnover and

replacement of dead and dying cells helps sustain the structure and function of a healthy

arterial wall (Ward et al., 2000).

2.2.2 Pathological arterial remodelling

In an overt case of pathological cell turnover such as intimal hyperplasia, proliferation

of ASMC, migration, phenotypic differentiation, as well as extracellular matrix

formation and degradation could determine the extent of intimal thickening (Newby &

Zaltsman, 1999). These are mostly features of atherosclerosis, and its more severe form

is presented with arterial stenosis.

There is also remodelling activity that causes the wall to become stiffened with bone-

like material embedded in the wall. For the scope of this thesis, only two types of

pathological arterial wall remodelling will be discussed in the context of PAD. First, is

arterial wall thickening and atherosclerosis; second, calcified arteries involving the

media, which is also known as medial sclerosis.

There is increasing evidence that abnormal ASMC turnover and differentiation can lead

to adipocyte-like foam cells and calcifying-like bone cells, resulting in atherosclerosis

or medial sclerosis (Vukovic, Arsenijevic, Lackovic, & Todorovic, 2006). Normal

ASMC express the specific markers desmin and smooth muscle actin, whereas

pathological cells are expected to express either adipocyte or bone cell markers

(Iyemere, Proudfoot, Weissberg, & Shanahan, 2006; Vukovic et al., 2006).

2.2.3 Cellular origin in arterial remodelling

Since phenotypic differentiation has been mentioned in pathological arterial

remodelling, the source of the cell origin is further discussed here. There are at least

three different, possible sources for the appearance of bone-like cells in the arterial wall,

which may originate from (1) the mesenchymal progenitors resident in the arterial wall,

(2) re-differentiation of the mature ASMC and (3) from circulating cells with calcifying

10

potential, which could still originate from bone marrow stromal cells. In order to

determine the possible cell origin, a range of markers has been used to determine the

lineage. Generally, ASMC are derived from the mesenchymal cell lineage and express

the stromal cell marker (Stro-1) and smooth muscle actin (Bensidhoum et al., 2004;

Yoshiba, Yoshiba, & Ohkura, 2012). The osteogenic cells, derived from pluripotential,

mesenchymal stem cells, principally come from the bone marrow and may be seeded

from the circulation (Fadini, Rattazzi, Matsumoto, Asahara, & Khosla, 2012). The cells

in the arterial wall, which retained the capacity to differentiate and re-differentiate, may

well display the osteogenic features, given a specific stimulus.

Osteoblasts are also of mesenchymal origin and share the same lineage as the ASMC,

fibroblasts, myocytes and adipocytes (Ahdjoudj, Fromigué, & Marie, 2004). An early-

differentiated osteoblast will display core binding factor-1 (cbfa-1) or Runx2. The

osteoblasts will differentiate and progress through several precursor stages before

forming the mature osteoblast. Osterix is a mature osteoblast marker and suggests a

terminally differentiated stage (Billiard et al., 2003). Osteoblasts can produce RANKL

to help regulate osteoclast activity. This is important because osteoblasts are responsible

for the calcification of the bone matrix and in maintaining physiological bone growth

and remodelling.

Osteoclasts however, originate from the haematopoietic lineage and the precursor forms

are monocytes. Osteoclasts are the only bone resorbing cells and are coupled with

osteoblast to regulate bone mass and structure as a feature of bone remodelling. The

markers that are important in characterizing the phenotype of osteoclasts are RANK,

TRAP and CD14 (for the early precursor cells-monocytes) (Saitoh, Koizumi, Sakurai,

Minami, & Saiki, 2007).

It is hypothesized that vascular cells may trans-differentiate into cells which display

osteoblast and osteoclasts-like phenotype ((Massy, Mentaverri, Mozar, Brazier, &

Kamel, 2008).There have been several tracer studies to identify whether these cells are

derived from ASMC. Mice models were developed, where the progenitors of

mesenchymal stem cells were tagged and then traced up to the stage of vascular

development. A specific strain such as the matrix Gla protein deficient (MGP null) mice

from the study of Speer and colleagues (2009), was used to show that the ASMC could

trans-differentiate and contribute to the development of medial wall calcification. Speer

and others (2009) have genetically labeled the ASMC with the SM22-Cre recombinase

and the Cre reporter Rosa26-LacZ alleles in utero and trace this cells formation into

osteochondrogenic precursor- and chondrocyte-like cells in calcified arteries of the

11

MGP null mice. Tang and others (2012) however, insist that proper lineage tracing

should include the myosin heavy chain (MHC), specific for a smooth muscle lineage

instead of using smooth muscle actin stain alone. Tang and others (2012) proposed that

the differentiated smooth muscle cells might instead be derived from multipotent

vascular stem cells.

In general, findings of bone-like cells in the arterial wall have led to the theory of

ectopic bone-like formation in the arterial wall. However, what induces the changes is

still not clear. It could also be that some cells are not fully differentiated and attempts to

resolve calcification by recruiting monocytes to sites of calcification have failed.

2.3 Arterial inflammation

In general, chronic inflammation is characterized by ongoing tissue damage from

reactive oxygen species and proteases, which are secreted by inflammatory cells such as

the monocytes and macrophages. When there is prolonged exposure to toxic agents or

other persistent inflammatory agents or inducers, chronic inflammation may occur.

Other products such as pro-inflammatory cytokines and chemokines may amplify and

propagate the damage. Inflammatory factors have been long proposed to play a major

role in the development of PAD (Epstein, Zhou, & Zhu, 1999; Tervaert, 2009). These

factors include infection or injury from a mechanical, chemical or biochemical sources.

Inflammation is recognized as a key process in the development of atherosclerosis given

the presence of infiltrating macrophages. However, in medial calcification, it is likely

that the vascular resident cells namely the ASMC, act to differentiate and protect

themselves, hence releasing a number of pro-inflammatory cytokines and chemokines

(Charo & Ransohoff, 2006; Moser, Wolf, Walz, & Loetscher, 2004). It has become

clear that the expression of functional chemokines and receptors are not restricted to

immune cells alone (Zulli et al., 2008). Many cell types are able to produce chemokines

or up-regulate inflammatory receptor expression under the influence of pro-

inflammatory cytokines such as IL-1β, TNF-α and IFN-γ. Both cytokines and

chemokines are important in the maintenance of such lesions.

2.3.2 Atherosclerosis

The initial event in atherosclerosis is the adhesion of monocytes to endothelial cells and

the extravasation of these cells into the sub-endothelial region (Plasschaert, Heeneman,

& Daemen, 2009; Ross, 1999). These monocytes are recruited in the event of injury or

imbalance of the chemokine gradient at sites of inflammation. The chronic recruitment

12

of these cells leads to the growth of the lesions and occlusion of arteries. With the

theory of “response-to-retention”, these monocytes accumulate modified forms of LDL

via scavenger receptors and further become lipid-laden cells called foam-cells

(Williams & Tabas, 1995). The chemokines CCL2 and CX3CL1 are important

mediators facilitating monocyte adhesion and migration, preceding the process of

plaque formation (Butoi et al., 2011; Matsumoto, Kobayashi, & Kamata, 2010)

CCL2 has been described previously as monocyte chemoattractant protein-1 (MCP-1)

and has been shown to be an important chemoattractant for monocytes towards the

subendothelial space of the arterial wall mediating the formation of foam cells (Nelken

et al. 1991). However, the involvement of chemokines other than CCL2 is suggested

when irradiated apolipoprotein (apo) E3-Leiden mice were reconstituted with CCR2-

deficient bone marrow progenitor cells, which resulted in 86% reduction of the overall

atherosclerotic lesion development (Guo et al., 2005). This suggests that there might be

other pathways for the monocytes recruitment to the inflammation site. Furthermore,

CCL2/CCR2 expression may be limited to the early stage of atherosclerosis formation

and downregulated in an advanced lesion (Wong, Wong, & McManus, 2002).

Fractalkine (FKN) or CX3CL1 is a unique chemokine, which functions as a

chemoattractant, as well as an adhesion molecule. FKN was described as a

transmembrane-anchored molecule on the surface of endothelial cells which is up

regulated in inflamed tissues, such as the atherosclerotic walls (Umehara et al., 2004).

The FKN receptor (CX3CR1) is a critical factor for monocyte trafficking to the

vasculature and is mainly expressed on monocytes. According to a number of studies,

CX3CR1 is chiefly involved in atherosclerosis (Butoi et al., 2011; Liu et al., 2008).

Interestingly, as atherosclerosis can display pathological remodelling such as intimal

hyperplasia and plaque formation, CX3CR1 has been found to be responsible from the

very beginning. A study by Lucas et al., (2003) has shown that the expression of the

FKN receptor facilitated the migration of the ASMC into the intimal layer. Since

Koizumi and colleagues (2009) suggested a novel role for FKN to attract monocytes to

sites of mineralization, there is the need to investigate the role of FKN and its receptor

in medial calcification.

2.3.3 Causes of arterial inflammation: role of infection

Many lines of evidence, ranging from in vitro experiments, pathological examinations

to epidemiological studies, reveal that inflammation is cardinal to the pathogenesis of

13

PAD (Libby, 2002). However, this relationship between inflammation and the

development or progression of PAD involves complex molecular networks of the

immune and the host defense system. There is an emerging role for the toll-like

receptors (TLRs) in recognizing exogenous and endogenous molecular signals

promoting inflammation in cardiovascular disease (Spirig, Tsui, & Shaw, 2012).The

possible role of infectious agents has been described in a number of studies, but has

mainly revolved around atherosclerosis (Leinonen & Saikku, 2002; Rosenfeld et al.,

2000).

Up until now, no definitive conclusion has been drawn on the association between PAD

and a number of proposed infective organisms such as Chlamydophila, Mycoplasma

and Cytomegalovirus (CMV). For instance, Chlamydia pneumoniae (CP) has been the

most frequently proposed pathogen in coronary artery disease, however, results are

conflicting and causality is difficult to prove in humans (Pasterkamp et al, 2004).

Gutierrez and others have compiled 43 published studies that evaluated the association

between PAD and CP and their observational case-control meta-analysis did not support

any strong association. Gutiérrez and others (2005) proposed that an association can

only be made with a case control study with adequate number of cases that uses

multiple techniques and samplings from the same subjects to detect the presence of the

bacterium and establish a relationship with the disease. For the purpose of this thesis,

two methods of detection of CP will be used; immunofluorescent detection in arterial

tissue samples and a pathogen-specific PCR assay using fine tissue scrapings.

2.4 Arterial calcification

Arterial calcification has been suggested to resemble the active process of bone

formation. Although initially it was believed to be a passive mechanism, accumulating

evidence has now led to a new understanding in the process of arterial calcification.

Moreover, bone-like markers such as alkaline phosphatase (ALP), bone sialoprotein or

bone matrix protein have been reported to be present in the diseased arterial wall

(Boström et al., 1993; Hunt, 2002; Wada, McKee, Steitz, & Giachelli, 1999). These

findings mainly showed an association of bone forming-like lesions in atherosclerosis

rather than in medial sclerosis. However, it is possible that this bone-like structure could

be present in the medial wall of the arteries, as well.

Other evidence includes in vitro findings on bone related nuclear transcriptional factors

such as Runx2 and Osterix (Panizo et al., 2009). However, Byon et al. (2011) in a recent

study suggested that Runx2 might be responsible for RANKL expression in the

14

osteoblast-like ASMC resulting from atherosclerotic lesions. It is now clear that arterial

calcification may involve phenotypic changes in the arterial cells. Although these

studies were centered on atherosclerosis, it is possible to investigate a similar

mechanism for medial sclerosis.

Up till now, several studies have investigated the role of OPG/RANKL in the

progression of atherosclerotic calcification. In hyperlipidemic ApoE deficient mice,

Bucay et al. (1998) showed that OPG deficient mice developed osteoporosis and

vascular calcification. Arterial calcification is now recognized as a marker of

atherosclerotic plaque burden and also a major contributor of arterial stiffness owing to

the loss of arterial elasticity (Soor, Vukin, Leong, Oreopoulos, & Butany, 2008).

2.4.1 Arterial cell and bone biology

The theory proposed for the regulation of arterial calcification is the interplay between

osteoblast and osteoclast-like cells (Massy et al., 2008). The bone remodelling theory

describes how bone forming cells (osteoblast) and bone resorbing cells (osteoclast) may

interact (Figure 2.2). Bone remodelling involves the spatial and temporal coupling of

these cells through four main stages: cell activation, bone resorption, reversal of cell

activation and bone formation (Parfitt, 1984). The remodelling is initiated by the

activation of the quiescent cells on the bone surface, which is covered by the bone

lining cells. Activation requires the recruitment of new osteoclasts from the

mononuclear phagocyte system or from haematopoietic precursors. Also, the close cell-

to-cell interaction is needed in order to activate the signaling cascade. The mechanism

of attraction and binding to the mineralized surface could be due to chemotactic signals

such as fractalkine (Koizumi et al., 2009). Further maturation of the osteoclast is then

induced by binding of RANKL expressed by the osteoblast. Resorption is then carried-

out by the osteoclast, which when activated becomes a giant multinucleated cell. There

is a proposed interaction between RANKL and fractalkine receptor, which further

fascilitate osteoclast functions (Saitoh et al., 2007).

15

Figure 2.2 Proposed remodelling in arterial calcification with the involvement of two

key cells: monocyte derived osteoclasts and osteoblast-like smooth muscle cells.

Adapted from Weitzmann and Pacifici (2006).

There is link between bone and vascular immunology, which has been established by

many bone destructive disorders such as rheumatoid arthritis (Jones, Kong, &

Penninger, 2002), Charcot’s disease (Ndip et al. 2011) and osteoporosis (Wu et al.

2012). The term osteoimmunology has been coined in order to describe the accelerated

bone loss caused by inflammatory and autoimmune diseases such as rheumatoid

arthritis and diabetes. Jones, Kong and Penninger (2002) noticed the osteoclast-inducing

capacity of activated T-cells in adjuvant arthritis that is mediated through the

RANK/RANKL/OPG axis. Most of these agents or pro-inflammatory cytokines are

produced by the osteoblast or bone marrow derived stromal cells. However, these

cytokines have to compete for binding on their shared cognate receptor RANK.

Therefore, the cytokines, which are more abundant in the circulatory system easily bind

to RANK and exert their effects. This is clearly demonstrated in the treatment of

osteoporosis by denosumad (an antibody to RANKL), where the osteoporotic bone

resorption problem in the patients can be controlled. Another important highlight from

an early animal study is the OPG knockout mice. In this mouse model of OPG

deficiency developed by Bucay and colleagues (1998), severe bone loss and

calcification of the aorta and renal arteries were observed. This finding indicates the

important role of OPG as an osteoprotective factor and also as an inhibitor to arterial

wall calcification. By acting as a decoy receptor to RANKL, osteoclastic activity and

thus bone resorption in the area of arterial wall may be halted and the active

remodelling of arterial wall calcification may be reduced.

16

Despite increasing evidence supporting the link between the immune system and

vascular calcification, the role of the proposed biomarkers remains obscure in the

pathogenesis of PAD. This study, thus aimed to investigate the presence and role of

inflammatory markers CCR2, CX3CR1 and RANK in PAD. It is hypothesized that

these markers will be up-regulated in the arterial wall in PAD and contributes to the

pathological arterial wall remodelling.

17

CHAPTER 3: AIMS AND HYPOTHESES

This chapter generally outlines the hypotheses to be tested with aims to be addressed in

the following experimental chapters. The overall aim is to identify relevant

inflammatory markers in severe PAD as derived from the arterial tissues and ASMC

grown from viable samples and to identify possible intracellular infection as a source of

inflammation.

Hypotheses:

Hypothesis 1- Patients with clinically severe PAD (needing amputation) have greater

arterial wall changes than in control subjects.

Aim: To assess the degree of arterial wall changes in terms of calcification and

lipid deposition on the arterial walls of PAD and controls. Further comparison was

made between samples having PAD with or without diabetes.

Hypothesis 2 - The expression of inflammatory and bone-related markers is associated

with the severity of arterial calcification and/or lipid deposition in the arterial walls of

PAD and controls.

Aim: To investigate the expression of the inflammatory and bone-related

markers: CCR2, CX3CR1, TRAP and RANK in association to the severity of arterial

calcification and/or lipid deposition in the arterial walls of PAD and controls. Further

comparison was made between samples having PAD with or without diabetes.

Hypothesis 3 - The calcification phenotype (osteoblast-like cells) is up-regulated in

ASMC derived from the arterial wall of patients with PAD.

Aim: To characterize PAD-derived and human fetal aorta-derived ASMC for

expression of markers specific for smooth muscle cells (alpha-smooth muscle actin,

desmin), fibroblasts (vimentin), osteoblasts (Osterix, Runx2) and mesenchymal

precursor cells (Stro-1).

18

Hypothesis 4 - The inflammatory and bone-related cell surface markers (CX3CR1/L1,

RANK/L TLR4, CD14, CCR2 and CCR4) are up regulated in ASMC derived from the

arterial wall of patients with PAD compared to fetal derived ASMC.

Aim: To investigate the expression of inflammatory and bone-related cell

surface markers in PAD-derived ASMC and human fetal aortic smooth muscle cells,

including CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4.

Hypothesis 5 - Intracellular infection such as Chlamydia Pneumoniae (CP) may be

associated with inflammation in PAD.

Aims:

(i) To determine the presence of CP in calcified diabetic samples and non-

calcified non-diabetic samples using immunofluorescence (IF) study and

polymerase chain reaction (PCR).

(ii) To determine the molecular detection of TLR4 and CD14 in mediating

differential response to LPS as an in vitro model to CP infection in ASMC.

19

CHAPTER 4: GENERAL METHODS

4.1 Materials and methods

This section describes the samples and general methods used throughout the thesis.

There will be four experimental chapters describing separate studies, which first

investigate the main histopathological characteristic of the arterial samples (Chapter 5)

and identifying relevant inflammatory markers using immunofluorescence techniques

(Chapter 6).The next experimental chapter (chapter 7) uses fresh arterial samples to

culture smooth muscle cells for phenotypic characterization and identify proposed

inflammatory markers either intracellularly or on the surface membrane to help support

tissue findings in chapter 6. The final experimental chapter (chapter 8), combines both

tissue, ex-vivo and in vitro studies in order to identify the possible source of

inflammation by testing for the presence of an obligate intracellular pathogen,

Chlamydia pneumoniae. The general outline of the experiments was given below in

Figure 4.1.

Figure 4.1 Flow chart of the general research design for the thesis project.

20

4.2 Arterial samples

Between March 2010 and August 2012, 17 patients consented to arterial tissue

harvesting after below or above knee amputation for tissue loss, ulceration or gangrene.

Ethics approval was obtained from local Human Ethics committees (RA/4/1/4078) with

the relevant documents provided in Appendix I. Amongst the cases, seven were not

diabetic and 10 had diabetes for 9 to 20 years duration. Control arteries were obtained

from eight embalmed cadavers (< 48 hours post –mortem) – all without diabetes and no

clinical history of PAD. The cadavers were obtained from the body donation program at

the University of Western Australia. All subjects were Caucasian and subject

characteristics are summarized in Table 4.1.

Cases of PAD contributed 53 different arterial samples (popliteal,peroneal, anterior and

posterior tibial arteries) and controls contributed a total of 33 different lower limb

arteries for histopathological evaluation. A segment of these arteries were each

immediately fixed in 1% paraformaldehyde (PFA) (to be used for histopathological

evaluation).The other halves of the arterial segments were transported in culture

medium for explantation in the cell culture lab (as described in chapter 5).

The risk factors for PAD are also summarized in Table 4.1.

Table 4.1 Demographic data representing groups of peripheral arterial disease (PAD)

cases and subgroups of the amputees or PAD cases with and without diabetes (DM) and

controls.

PAD cases Controls

No DM DM No DM

Number 7 10 8

Mean Age (years) ± SD 66 ± 13 64 ± 15 78 ± 8

Median Age (years) 68 66 75

Age Range 41-78 39-82 68-90

Gender (male) (5) 71% (8) 80% (5) 63%

Smokers (7) 100% (6) 60% unknown

Hypertension (4) 57% (2) 20% unknown

Hyperlipidaemia (5) 71% (2) 20% unknown

Renal failure (1) 14% (6) 60% unknown

21

CHAPTER 5: HISTOPATHOLOGICALEVALUATION OF 53 ARTERIES FROM 17PAD CASES

5.1 Introduction

Histopathological studies have revealed that the changes in severe peripheral arterial

disease (PAD) not only involves atherosclerosis in the intima, but also significant

medial arterial wall calcification (Soor et al. 2008, Mozes et al. 1998). Imaging

modalities usually confirm the diagnosis of PAD by showing areas of stenosis or

blockage and calcified arteries at the problem site. Calcification in the posterior tibial

artery can be scored using multi-sliced computated tomography, and this technique has

been proposed by Guzman and colleagues (2008) to predict future amputation.

Increasing age and traditional risk factors for atherosclerosis are associated with an

increased tibial artery calcification (TAC) score, which is used as an independent

marker by Guzman and his colleagues.

Sangiorgi and colleagues (1998) have also proposed that quantification of calcified

arterial lesion should be used in histological studies rather than using lumen diameter

measurements because of arterial remodelling factors that might influence the predictive

value of atherosclerotic plaque burden. Overall, the significance of calcification in PAD

has been established but the mechanistic picture is still not clear.

Through histopathological study in this chapter, evaluation were made on; first, whether

lipid or calcium depositions are more predominant in arteries from lower limbs

amputated for non-traumatic causes and clinically diagnosed PAD, compared to the

controls. Secondly, PAD cases with and without diabetes were compared separately

with control samples from individuals without known PAD or diabetes.

5.2 Hypothesis and aim

Hypothesis - Patients with clinically severe PAD (needing amputation) have greater

arterial wall changes than in control subjects.

Aim: To assess the degree of arterial wall changes in terms of calcification and

lipid deposition on the arterial walls of PAD and controls. Further comparison was

made between samples having PAD with or without diabetes.

22

5.3 Materials and Methods

5.3.1 Arterial samples

Segments 2-3 cm in length of the distal popliteal artery and its named branches

(peroneal, anterior and posterior tibial arteries) were harvested and immediately fixed in

1% paraformaldehyde and 0.6% sucrose for storage at 4⁰C. Prior to transverse

sectioning, 5 mm long arterial sections from three different intervals (of at least 15 mm

apart) were embedded in Tissue Tek® (Sakura Finetek U.S.A. Inc., Torrance, CA) and

frozen at -22⁰C. Serial cryosections of 8 µm thickness were prepared from each sample,

air-dried and fixed on positively charged, Super frost® glass slides. 81 tissue slides

were then subjected to routine Hematoxylin and Eosin (H&E) and Oil red O lipid

staining with at least two repeats.

5.3.2 Histopathological analysis

The severity of PAD was determined by counting the number of quadrants involved

with either calcification or lipid deposition. For each segment of a given arterial section,

one type of the lesion was scored with a specific staining i.e. H&E; dark blue staining

indicating calcification and Oil Red O; deep red droplet areas indicate lipid deposition.

Figure 5.1 below highlights a normal arterial sample with H&E staining (Figure 5.1A),

and a similar tissue from serial sectioning (Figure 5.1B), which indicates that the sample

is free from lipid deposition (no red staining). The following figure (5.1C) showed

minimal red staining in two different areas within the intima, were given a score of 2.

Arterial sample in Figure 5.1D were also given a score of 2 despite the larger area with

the red stain, because it extends over two quarter of the arterial cross section. The

scoring methods were adapted from Mozes et al. (1998) for the semi quantitative

assessment. The region where the lesion was found was taken into account i.e. lipid

deposition was counted as a lesion only if found in the intimal layer (see Figure 5.1D)

and calcified lesion was counted only if it appeared in the medial region (see arrows in

Figure 5.2).

Since the method chosen was a semi quantitative assessment, the scale is not linear and

may not represent the severity of other confounding lesions. The approach taken is to

identify each type of lesion, one at a time although in reality, both lesions may coincide

or influence each other. For example, a similar extent of calcification may be found in

Figure 5.2B and 5.2C but the lumen of the artery in Figure 5.2B is occluded (indicating

a more severe lesion) and given a score of 2 although the sample in Figure 5.2C is not

occluded, but given a score of 3 since it is a calcification scoring. If occlusion is taken

23

into account, it will suggest a contribution from atherosclerotic lesion and not

calcification.

Figure 5.1 Scores of ‘0’ given for arterial section which are free from calcification

when stained with H&E (A) and free from lipid deposition when stained with Oil red O

(B). Scores of ‘2’ were given to both arterial sections in C and D. Scale bars at 200 µm.

C D

A B

24

Figure 5.2 Calcification score was made using H&E staining as indicated by the dark

purplish area in each segmental quadrant. Examples of scores from 1-4 are shown. All

calcification was noted to be in the medial region. The arrows indicate areas of

calcification. Each box represents a quadrant of the arterial segment. Scale bars at 1mm

except for score 2 at 100 µm (shown by the black rectangle bar).

Stained slides were digitized using the ScanScope CS digital slide scanner (Aperio, San

Diego, CA) and analysed using the software programme Aperio Image Scope

v11.1.2.752 (www.aperio.com). The number of quadrants involved determined the

scores for each lesion, with a score of 0 indicating no lesions (Figure 5.1A) and Figure

5.2 showing a representative score for calcification, from a score of 1 for any lesion

found in a quadrant up to a score of 4; indicating the most severe lesion involving all

four quadrants in a given arterial section. Similar representative scoring were also

shown for lipid deposition but this time indicated by the arrows (Figure 5.3).

25

Figure 5.3 Lipid scoring by quadrant involvement represented by the number of arrows

shown in each sample stained with oil red O. Lipid deposition indicating atherosclerosis

generally involved the intima. However, difficulty in scoring arises when the intimal

region became distorted with hyperplasia for example in B, C and D. Scale bars 200

µm.

5.3.3 Inter-scorer reliability

To assess inter-scorer reliability, a total of 133 slides were analyzed independently for

lesion scoring using standard light microscope. There were six scorers (blinded to

sample ID and grouping) and the mean scores were compared to the author’s (RZ score)

using Cohen’s kappa measurement of agreement. The kappa measure of agreement was

moderate (R=0.4) but the correlation between author’s scoring and the other observer’s

mean scoring was high (R=0.84) Figure 5.4. There is also good internal consistency,

with Cronbach’s alpha coefficient of 0.93.

C D

A B

26

Figure 5.4 The mean scores from 6 different observers were plotted against the author’s

score. Positive correlation was seen with a correlation coefficient of 0.84.

5.3.4 Statistical analysis

Data were analyzed using SPSS (version 16.0; SPSS, Chicago, IL). Kruskal–Wallis for

more than two different groups and Mann Whitney non-parametric tests were used to

assess the comparison of the data. In all analyses, a p value < 0.05 was considered to be

statistically significant. Kappa inter-observer strength of reliability was measured and

plotted. Box plot diagrams indicate the median (± interquartile range; IQR) scores for

calcification and lipid deposition.

5.4 Results

5.4.1 Subject population

There was a significant difference between the age of PAD cases (mean age 65 ± 13.5

years SD) and control cases (78 ± 8 years SD), using an unpaired t test (p =0 .02).

5.4.2 Differences between arterial location of deposit

The scoring of both calcification and lipid deposition did not differ between location of

the arteries harvested from the amputated leg of PAD and controls. A Kruskal-Wallis

ANOVA indicated that there were no statistical differences between the scores given to

calcification assessment for anterior tibial artery (ATA) Mean Rank = 42.89, posterior

tibial artery (PTA) Mean Rank =38.76, and popliteal artery (POP) Mean Rank =41.29,

27

H (corrected for ties) =0.455, df =2, N =81, p =0.796, Cohen’s f (effect size =0.005)

was small. Figure 5.5A shows the box plot representation with median scores.

There were also no statistical differences between the scores given to lipid deposition

(Figure 5.5B). Atherosclerosis assessment for ATA (Mean Rank = 43.14), PTA (Mean

Rank =36.06), and POP (Mean Rank =43.83), H (corrected for ties) =1.902, df= 2, N

=81, p=0.386; Cohen’s f (effect size =0 .024) was small.

A p=0.796 B p=0.386

ATA

PTAPO

P

0

1

2

3

4

Ca

lcif

ica

tio

nS

co

res

ATA

PTAPO

P

0

1

2

3

4

Lip

idS

co

res

Figure 5.5 Median scores of calcification and lipid deposition are shown in the box

plots (A and B respectively) indicating no significant difference between the different

arterial locations from the lower limb arteries. Interquartile range (IQR) for calcification

scoring was between 3 to 4, and IQR for lipid scoring was 2 for all types of arteries.

5.4.3 Calcification scores in PAD cases and controls

Generally, all calcifications in the samples were noted to be in the medial layer where

the main bulk of ASMC reside. The severity of calcification was scored from 0 to 4 and

data for medians are represented in the box plot diagrams in Figure 5.6A. The Mann

Whitney U test indicated that there is statistically significant higher scores given to

calcification assessment for PAD cases (Mean Rank =46.04) compared to controls

(Mean Rank =33.67), H (corrected for ties) =5.726, df =1, N =81, p =0.016; Cohen’s f =

0.072, which is a moderate effect size.

5.4.4 Calcification scores in PAD cases with or without diabetes

Cases of PAD with diabetes showed a higher trend for calcification score but the

difference was not statistically significant from non-diabetic PAD cases (Figure 5.6B).

Calcification scores for cases with diabetes (Mean Rank = 26.61) and PAD cases

28

without diabetes (Mean Rank = 21.55) showed a median of 3 and 1 respectively with a

large IQR for both groups. Mann Whitney U test indicated p =0.198, H (corrected for

ties) =1.658, df =1, N =48. The effect size calculated using eta squared, was small at

0.035.

A * p=0.016B p=0.198

Contr

ol

PAD

0

1

2

3

4

Ca

lcific

atio

ns

co

res

Non

DM

PAD

DMPA

D

0

1

2

3

4

Ca

lcif

ica

tio

nS

co

res

Figure 5.6 Median of calcification scores are shown for control and PAD cases in (A)

and between non-diabetic PAD and diabetic PAD in (B). The IQR for control is 2 and

PAD cases IQR is 4.

5.4.5 Lipid scores in PAD cases and controls

Atherosclerosis was classically represented with lipid deposition in the intimal region

(Figure 5.3). Only the quadrant stained positively red with Oil red O were counted for

ranking the severity and data for medians of PAD cases and controls are represented in

box plot diagrams in Figure 5.7A.

Mann Whitney U tests indicated that there were no statistically significant differences

between the scores given to lipid deposition on quadrant involvement. Mean rank of

lipid scores for amputated PAD cases was 38.94 and controls was 44.00, H (corrected

for ties) = 0.957, df = 1, N =81, p=0.314, Cohen’s f =0 .012. Figure 5.7A indicated the

median (± IQR) of PAD cases without DM is 3 ± 2, and PAD cases with DM is 2 ± 3.

5.4.6 Lipid scores in PAD cases with or without diabetes

There was no significant difference when atherosclerotic scores were compared

between diabetic and non-diabetic PAD cases. Atherosclerosis scoring for diabetic

*

29

presence (Mean Rank = 24.00) was not significantly higher compared to cases without

diabetes (Mean Rank = 25.20), H (corrected for ties) = 0.091, df = 1, N =48, p=0.763;

Cohen’s f =0.002. Figure 5.7B shows the median (± IQR) of PAD cases without DM is

3 ± 3 and PAD cases with DM is 2 ± 2.75.

A p= 0.314 B p=0.763

Contr

ol

PAD

0

1

2

3

4

Lip

idS

co

res

Figure 5.7 Median and IQR of lipid scores are shown for control and PAD cases (A)

and between non-diabetic PAD and diabetic PAD (B).

5.5 Discussion

The prevalence of PAD is known to increase with age (Norman, Eikelboom, & Hankey,

2004). However, aging is not the only risk factor for PAD progression. This study has

demonstrated that the control group, which represents the “healthy” aging population,

showed significantly lower calcification scores compared to the cases with PAD. These

findings further support the studies of Guzman and others (2008), that calcification

could be the targeted as a modifiable risk factor for intervention. The early works by

Blumenthal and others (1944) also confirmed that Hematoxylin and Eosin staining is

adequate for determining calcified lesions in arterial walls.

Given that arterial calcification may contribute to increased arterial wall stiffness,

enhanced stiffening could be due to pathological causes. Mitchell and others (2004)

30

have observed a relationship between aging and increase arterial wall stiffness in the

central arterial trunk but not in the peripheral arteries. The mean age of their study

sample is 56 years old for men and 57 years old for women and these participants are

relatively free of cardiovascular disease risk factors. They used arterial tonometry to

assess central (carotid-femoral) and peripheral (carotid-brachial) pulse wave velocity

and concluded that there is an age-related increase in aortic stiffness.

In the study by Soor and others (2008), the severity of calcification in diabetic arteries

were found to be greater than in non-diabetic arteries, whereas in this study the

calcification score did not differ between cases with underlying diabetes or not. This

could be due to the larger coefficient of variation (measured by IQR) for calcification

scores in the dataset, limiting the ability to detect modest associations for diabetes and

arterial calcification. However, a trend similar to Mozes and others (1998) can be seen

where the diabetic cases showed slightly higher calcification than non-diabetic cases.

Interestingly, the lipid deposition score did not differ between cases and controls or in

cases with or without diabetes. Indeed, the control group showed a higher trend for lipid

scores but it was not statistically significant. The limitation in detecting significant

changes could be due to the sensitivity of the scoring system. The lipid scoring took into

account the number of quadrants involved, for example a score of ‘2’ was given for

both Figure 5.1C and 5.1D despite area or volume differences of the red stained lipid

droplets and clinical severity such as stenosis (e.g. Figure 5.1C) was not assessed by

this scoring of quadrants. Although stenosis is best determined by the diameter of the

lumen, Sangiorgi and others (1998) also demonstrated that stenosis graded by luminal

diameter did not correlate with plaque burden whereas calcium quantification did.

In summary, the main histopathological findings in this study include early

atherosclerotic lesion, which could be seen in both PAD cases and cadaveric controls,

whereas arterial calcification is particularly seen in PAD cases with or without diabetes.

31

CHAPTER 6: EXPRESSION OF RANK ANDCX3CR1 IN ARTERIES DERIVED FROMPERIPHERAL ARTERIAL DISEASE

6.1 Introduction

Both atherosclerotic lesions and medial calcification play important role in PAD

progression. However, factors that propagate these arterial wall lesions remain to be

elucidated. Atherosclerosis, which is known to be a chronic inflammatory disease, have

been linked with events of infiltration of monocytes and other inflammatory cells to the

site of “injury” (Ross, 1999). Given the similar pathology that coronary disease and

PAD may share, several inflammatory factors were investigated for their significant role

in atherosclerosis (i.e. CCR2 and CX3CR1) and RANK, for its specific influence on

calcified arterial wall lesions (Butoi et al., 2011; Heymann et al., 2012).

Several biomarkers have been associated with the progression of PAD. Amongst

prominent biomarkers, the molecular triad of osteoprotegerin (OPG), receptor activator

of nuclear factor kappa B (RANK) and its ligand (RANKL) have been associated with

arterial calcification or pathophysiologic bone remodelling (Mabilleau, Petrova,

Edmonds, & Sabokbar, 2008; Ndip, Williams, Jude, & Serracino-inglott, 2011). The

OPG/RANK/RANKL triad plays a pivotal function in bone metabolism, vascular

biology and immunity. Bucay and others showed that OPG-deficient mice exhibited

medial calcification of the aorta and renal arteries with an early onset of osteoporosis

hence the introduction of the so-called “osteoprotective” factor OPG (Bucay et al.,

1998). In humans, a paradoxical picture was seen when increased OPG plasma

concentration was positively associated with severity of PAD (Ziegler et al. 2005,

Poulsen et al. 2011). High OPG levels were also associated with all-cause mortality in

type 2 diabetic patients (Reinhard et al., 2010).

RANKL, when present at high levels, may compete with OPG for the binding site on

RANK. It is still not clear how elevated RANKL concentration may promote arterial

wall calcification. Physiologically, RANKL is expressed by osteoblasts to activate and

promote activation of osteoclasts through binding with RANK. Thus, many studies have

postulated a role for osteoclasts in vascular calcification (Byon et al., 2011; Heymann et

al., 2012). If RANKL predominates, the osteoclast precursor monocytes will proliferate

32

and commit to become osteoclasts and express the marker tartrate-resistant acid

phosphatase (TRAP). With the presence of osteoblast-like and osteoclast-like cells in

the vascular wall, there is a high chance that the remodelling process taking place will

deviate towards arterial wall calcification. Byon and others’ (2011) findings support the

accelerated calcification by increased osteoclast activity, which indirectly re-modeled

the calcified plaques. Bone-like plaque formation in the intima however, is distinctive

from medial wall calcification. In that the intima resembles an endochondral type of

bone formation while medial calcification resembles that of the non-endochondral type

(Vattikuti & Towler, 2004).

This study is proposing that RANK expression could be present on the ASMC instead

of the polymorphonuclear cells, and fit with the proposal of Panizo et al. (2009) on the

influence of RANKL on ASMC to directly promote phenotypic modulation. Ndip and

colleagues (2011) have also proposed that OPG and RANKL are important modulators

in bone homeostasis and are frequently associated with vascular calcification. It is

hypothesized that RANK would be up-regulated in pathological arteries.

6.2 Hypothesis and Aim

Hypothesis – The expression of inflammatory and bone-related markers is associated

with the severity of arterial calcification and/or lipid deposition in the arterial walls of

PAD and controls.

Aim: To investigate the expression of the inflammatory and bone-related

markers: CCR2, CX3CR1, TRAP and RANK in association with the severity of arterial

calcification and/or lipid deposition in the arterial walls of PAD and controls. Further

comparison was made between samples having PAD with or without diabetes.

6.3 Materials and Methods

6.3.1 Patient demographics

As presented earlier (Chapter 4).

6.3.2 Tissue immunofluorescence study

Arterial tissue sections from a series of sections were investigated for the presence of

antigens: CCR2, CX3CR1, RANK, alpha-smooth muscle actin (SMA) and leukocyte

common antigens: CD45 and CD68. Tissue slides were hydrated in PBS, separately

33

incubated overnight in 3% bovine serum albumin with either mouse anti-human CKR-2

(1: 100; Santa Cruz Biotechnology), rabbit anti-human CX3CR1 (1:50; AbD, Serotec),

mouse anti-human RANK (1:100; Santa Cruz Biotechnology) mouse anti-human SMA

(1:200; Santa Cruz Biotechnology), FITC mouse anti-human CD45 (1:100; BD

Bioscience) or Alexa Fluor ® 647 mouse anti-human CD68 (1:100; BD Bioscience).

Samples for intra-cellular staining i.e. alpha SMA were initially permeabilized with

0.1% Triton-X for 5 minutes at room temperature (RT) to increase antibody penetration.

Following overnight incubation, tissue slides were washed three times and incubated

with Alexa Fluor® 488 (1:200; Invitrogen) conjugated anti-rabbit or anti-mouse (as

required) for a minimum of 60 minutes at RT. Nuclear staining was also introduced

during the secondary antibody incubation, using DAPI (4’, 6-diamidine-2’-phenylindole

dihydrochloride, 10ng/ml, Roche Diagnostics, Mannheim, Germany). For negative

controls, tissue slides were incubated without the primary antibodies. Slides were

washed another three times before mounting (Dako Cytomation, Carpinteria, CA,

USA). The samples were then analysed and documented using multiphoton confocal

laser scanning microscopy (Leica TCS SP2).

6.3.3 Detection of tartrate-resistant acid phosphatase (TRAP)

The phosphatase substrate ELF97 (Molecular Probes now Invitrogen) was used for the

detection of TRAP activity in osteoclasts as previously described (Filgueira, 2004).

Briefly, arterial sections on glass slides were hydrated in distilled water and

subsequently incubated with 200µM ELF97 in 110 nM acetate buffer staining solution

(pH5.2), 1.1 mM sodium nitrate and 7.4 mM tartrate (all from Sigma-Aldrich) and left

overnight in a humidified chamber at RT. After screening for a positive reaction, the

enzymatic reaction was halted by rinsing in distilled water. Other nuclear staining was

then introduced using DAPI (10ng/ml); Roche Diagnostics, Mannheim, Germany. After

mounting, the samples were analysed and documented using Nikon Inverted

Microscope Eclipse TE 300 with a Nikon CCD digital camera.

6.3.4 Statistical analysis

A Pearson’s chi-square test of contingencies (with α = 0.05) was used to evaluate

whether expression of the inflammatory and bone-related markers: CCR2, CX3CR1,

TRAP and RANK positivity is related to PAD with or without diabetes.. Chi square test

for independence with Yates Continuity Correction were also use to determine an

association between two different groups.

34

6.4 Results

6.4.1 Immunohistological findings of pan leukocytic markers and SMA

Serial sections from PAD arteries were stained with pan-leukocytic marker and

monocyte-derived macrophage marker (CD45 and CD68 respectively) to determine the

presence of inflammatory cells in the regions prone for atherosclerosis. However, none

of the samples showed expression of the leukocytic or monocytic markers. Positive

control staining has been tested on fixed mononuclear cells on cytospins and in flow

cytometry, indicating that the antibody works on fixed cells. In addition, there was cells

found to be positively stained with the tested antibody, indicating immune cells were

found in the small blood vessels of the tissues.

Evidence for atherosclerosis was only found when expression of alpha-SMA was

present in the intima, apart from its usual location in the media (see Figure 6.1A). This

indicates intimal thickening, which most probably occur in arteries due to migration of

the ASMC into the intimal region. Other PAD samples, which showed severe

calcification, expressed fewer alpha-SMA in their medial region (Figure 6.1B).

6.4.2 Immunohistological findings of inflammatory and bone markers

To determine which inflammatory marker could be detected in association with

PAD, freshly isolated arteries from amputated lower limbs were carefully fixed

and examined by immunofluorescence microscopy. Separate arteries sampled from

ten PAD cases were serially sectioned and each stained with different test

antibodies against RANK, CX3CR1, CCR2, RANKL and fractalkine. Each slide

was evaluated with confocal microscopy for the expression of positive AF488

emission from positively tagged antibodies.

As shown in Figure 6.1C and 6.1E, RANK is mainly expressed in the medial

regions. Twenty-five percent of arteries derived from non-diabetic limbs and 75%

of samples derived from diabetic limbs stained positively for RANK (see Figure

6.3B). The chi square test was statistically significant, x² (1, N =24) = 6, p = 0.014.

The association between RANK and diabetic presence was quite strong with phi =

1.2.

There was positive CX3CR1 staining in 75% of arteries derived from non-diabetic

amputations and 83% of samples derived from diabetic amputations (Figure 6.3C).

A Chi-square test for independence (with Yates Continuity Correction) indicated

no significant association between CX3CR1 positivity and diabetes status, x² (1, N

=30) = 0.31, p = 0.576, phi = 0.06.

35

CX3CR1 expression was found diffusely all over the media and intima of arterial

samples derived from amputated PAD cases. They were also expressed in both

calcified and non-calcified media e.g. Figure 6.2B and 6.2D. None of the

amputated arterial samples expressed CCR2, RANKL or fractalkine. Control

samples also did not show expression for all these markers (see Figure 6.2E and

6.2F).

Figure 6.1 Presence of alpha SMA (stained fluorescent green) in both the media

100um

36

and intima (arrow indicating intimal layer). For calcified arterial wall section (B),

alpha SMA staining in the media was reduced. RANK expression (stained

fluorescent green) was positive in non-calcified amputated artery in (C) and

calcified artery in (E). D and F are the corresponding DAPI nuclear staining (blue)

for samples in C and E, respectively.

37

Figure 6.2 Control sample without primary antibodies (A and C) correspond to samples

in B and D, which were incubated with CX3CR1 and showed positive expression

(stained green with AF488). Aand B represents the calcified arteries, whereas C and D

represents atherosclerotic samples (arrow indicating the intima). E and F are control

arterial sections showing no expression of RANK and CX3CR1 respectively. Scale bars

= 100um.

38

A B C

Figure 6.3 Non-DM and DM PAD arterial samples (shown in A) did not differ

significantly in calcification severity (p= 0.126; N=53, x² =2.34). However, diabetic

arterial samples showed a significantly higher expression of RANK (B), suggesting a

moderate relationship between DM and RANK with phi and Cramer’s V at 0.5 (p=

0.014; N= 24, x² =6.0). CX3CR1 expression in non-DM and DM arterial samples (C)

were not significantly different.(p= 0.576; N=30, x² =0.312).

6.4.3 Tissue TRAP activity

To characterize the presence of osteoclast-like cells in the tissues, fluorescent tartrate

resistant acidic phosphatase (TRAP) and nuclear staining with DAPI was performed.

Positive fluorescence emission was detected in calcified regions (Figure 6.4B) and also

atherosclerotic regions in the intima (Figure 6.5A), with small regions starting to calcify

(Figure 6.5C, see arrow). These areas also coincide with the presence of multinucleated

cells (Figure 6.5D). Positive TRAP staining is indicative of osteoclastic activity in the

calcified region.

39

A B

C D

Figure 6.4 Medial calcification seen in the control groups (A; without TRAP staining

and B; with TRAP staining) indicates positive TRAP activity surrounding the calcified

region (green fluorescent dots). Arterial sample from non-DM PAD (C) and DM PAD

(D) showed calcified region with some expression of TRAP. Scale bar 100µm.

40

Figure 6.5 Samples with minimal calcification but having clear lipid deposition (A),

stained positive green with TRAP in B. The calcification area indicated by an arrow in

magnified image C. Negative control or control with secondary antibody only, shown in

D. Scale bar in A;400µm, B and D ;1000µm and C; 50µm.

6.5 Discussion

Complications of PAD may arise from progressive underlying arterial wall changes and

active vascular remodelling. Understanding the biologic basis of vascular remodelling

is, therefore, critical to prevent disease progression and clinical complications of PAD.

Recently, there has been a surge of interest in bone regulating factors such as OPG and

RANKL in PAD research (Poulsen et al., 2011). These key bone regulators have been

shown to be involved in vascular remodelling since 1997 (Bucay et al.1997). OPG was

positively related to the extent of aortic and valvular calcification in patients with

coronary arterial disease. Similarly, OPG is also linked to severity of PAD (Ziegler et

al. 2005; Poulsen et al. 2011). There is also an association between diabetes and

increased OPG serum level in this group of patients (Knudsen et al., 2003; Secchiero et

al., 2006).

This study has shown that the calcification in amputated PAD was generally found in

the media. Both the media and intima seem to be devoid of inflammatory cells such as

macrophages or monocytes. For medial calcification, it is accepted that no inflammatory

cells will be present and this is consistent with the findings of Jeziorska, McCollum and

Woolley (1998). Interestingly, TRAP positive staining suggested that osteoclastic

41

activity is seen in the media, and osteoclasts are known to derive from the monocytic

precursors. The presence of osteoclastic activity also suggests that there is a bone-like

mechanism in place of the arterial wall. It could be that there is a direct type of bone-

like formation through trans-differentiation of ASMC which is responsible for the

arterial calcification (Panizo et al., 2009; Steitz et al., 2001). Due to the pathological

remodelling, osteoblast-like cells in the media promote monocytes differentiation

towards osteoclasts, instead of the activation into macrophages and dendritic cells

which is more common for an atherosclerotic lesion.

Positive staining for RANK on arterial SMC was seen in the media of both diabetic and

non-diabetic arteries. No positive expression of RANKL was found, in agreement with

the report by Schoppet et al. (2004). It could be that the ligands were cleaved into their

soluble forms and washed away during the staining steps. The soluble form of RANKL

may be counteracted by the actions of OPG and this may fit with the reports that up

regulation of OPG may act directly or indirectly act on the arterial SMC (Poulsen et al.,

2011; Ziegler et al., 2005). RANK expression on the arterial SMC could also suggest an

osteoblast-like phenotype for the SMC in diseased arteries. Medial calcification

certainly differs in mechanistic formation, and this may be implicated with the

molecular triad RANK/RANKL/OPG. Ndip and others (2011) have depicted a probable

pathway in which RANK expression on ASMC may interact with RANKL/OPG (see

Figure 6.6).

CX3CR1 expression on ASMC has been documented by Lucas and colleagues (2003).

Similarly, CX3CR1 were found to be positively expressed in ASMC derived from both

diabetic and non-diabetic PAD cases. Butoi and others (2011) proposed that there is an

interaction between ASMC and the inflammatory cells (monocytes) via the CX3CR1-

CX3CL1 axis, which promotes atherosclerosis formation. In the context of vascular

calcification, the same axis has also been found to promote calcification if soluble

fractalkine induced the migration of bone marrow derived osteoclast precursors and

bound to CX3CR1 expressed on the arterial SMC (Koizumi et al., 2009). This axis is

useful when both attraction of osteoclast precursors and subsequent cell-cell interactions

are required. The evidence may be seen in increased osteoclast-like activity marked by

positive TRAP staining.

Another inflammatory marker, which was not found, is the CCR2 or MCP-1 receptor.

However, this marker is important in the early stage of atheroma formation as it acts

mainly to recruit monocyte-macrophages (Roijers et al., 2011; Wong et al., 2002).

42

CCR2 expression may not be present, as it may not have a specific role for vascular

calcification.

The immunohistological findings from this study emphasized the possible role of

certain inflammatory and bone inducing factors in calcification seen in severe PAD

cases recruited in this study. These findings could raise the possibility of anti-

inflammatory therapy in modulating the role of RANK and CX3CR1 in vascular

calcification. In the next chapter the phenotypic markers of the smooth muscle cells

grown from PAD samples will be determined and their osteoblast-like feature and

associated membrane surface markers will be evaluated.

Figure 6.6 External stimuli (hyperglycemia, inflammation resulting from trauma,

infection, or other injury) activate certain cells to release RANKL. When the

RANKL/OPG ratio is high as in PAD (A), RANKL binds to its receptors (RANK) on

ASMC to activate NF-κB and cause downstream cell signaling cascades, resulting in

osteoblastic differentiation and deposition of mineralized matrix leading to arterial

calcification. However, when the OPG levels are high or the RANKL/OPG ratio is not

elevated (B), OPG acts as a decoy receptor mopping excess RANKL and preventing

human ASMC from undergoing osteoblastic differentiation and mineralization. (Image

taken from Ndip et al. 2011).

43

CHAPTER 7: THE OSTEOBLAST-LIKEPHENOTYPE IN PAD SMOOTH MUSCLECELLS

7.1 Introduction

Physiological remodelling of the arterial wall should involve a normal turnover of cells

that sustain normal structure and function of the arterial wall. There is evidence that the

adult vasculature contains stem cells with the ability to differentiate into mesenchymal

stem-like cells that can subsequently differentiate into smooth muscle cells. These stem

cells, known as multipotent vascular stem cells were recently described by Tang and

colleagues (2012). They showed that these stem cells express markers such as Sox17,

Sox 10, S100β and neural filament-medium polypeptide and can further differentiate

into a proliferative and “synthetic” smooth muscle phonotype, which may contribute to

the pathological remodelling of the arterial wall. Another group (Phinney & Prockop,

2007), listed a few markers that are commonly present on multipotent mesenchymal

stromal cell which have the propensity to differentiate into osteoblast, adipocytes or

chondrocytes. They described the cells as having positive Stro-1 and lack the definitive

hematopoietic lineage markers such as CD11b, CD14 or CD45. However, it is

suggested that these cells display “plasticity” in response to the microenvironment they

are placed in. For example, low level of endotoxemia may induce expression of

functional membrane-bound CD14 in human coronary ASMC (Stoll et al., 2004). Ndip

and others (2011) also proposed that external stimuli could induce changes that

promotes release of significant inflammatory factors such as RANKL which could

influence ASMC phenotype and function. Thus, investigating the relevant markers on

cells derived from PAD samples will shed some light on the function and activity of the

cells. In order to show that these cells could differentiate into osteoblast-like cells, the

important transcriptional factors such as Runx2 and Osterix, will be investigated. Runx2

which is a key regulator of osteoblastic differentiation, still require the activation of

Osterix (Ducy et al.,1997; Komori et al., 1997). In mesenchymal cells, Runx2 has been

shown to bind to the Osterix promoter gene to regulate transcription (Nishio et al.,

2006).

Data presented in Chapter 6 indirectly supports the theory of phenotypic plasticity of the

smooth muscle cells because alpha smooth muscle actin (alpha-SMA) expression

indicates the ASMC lineage were present in the neo-intima and calcified media.

Similarly, RANK and CX3CR1 were expressed in the area, which has been stained

44

positive with alpha-SMA in respective serial sections. The ability of the ASMC to

undergo phenotypic change has give rise to the description of the “synthetic”

phenotype, which marks the arterial disease process of either atherosclerosis or

Monkeberg’ sclerosis (Iyemere et al., 2006). The de-differentiation of ASMC, from the

contractile to the proliferative or synthetic phenotype has underly the basis of arterial

remodelling in disease processes.

By growing arterial SMC from PAD amputated cases, this chapter studies the

phenotype of cells from diseased arteries to be compared against control fetal derived

cells. This chapter describes the use of an in vitro model to investigate the markers

relevant to calcification such as RANK and CX3CR1. It is proposed that the expression

of RANK and CX3CR1 on ASMC controls active remodelling in the arterial wall of

PAD.

This current study will first determine the characteristic features of cells grown from

PAD arteries and analyze the features of ASMC such as alpha smooth muscle actin,

desmin and vimentin (Gabbiani et al., 1981). These cells will be further compared with

the control cell lines derived from fetal aortic samples. The phenotype and function of

these cells will be further investigated for other inflammatory markers such as

CX3CR1, CCR2, CCR4, TLR4, CD14, CX3CL1 and RANKL.

7.2 Hypothesis and Aims

Hypothesis (a) - The calcification phenotype (osteoblast-like cells) is up-regulated in

ASMC derived from the arterial wall of patients with PAD.

Aim: To characterize PAD-derived and human fetal aorta-derived ASMC for

expression of markers, specific for smooth muscle cells (alpha-SMA, desmin),

fibroblast (vimentin), osteoblasts (Osterix, Runx2) and mesenchymal precursor

cells (Stro-1).

Hypothesis (b) - The inflammatory and bone-related cell surface markers

(CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4) are up regulated in ASMC

derived from the arterial wall of patients with PAD.

Aim: To investigate the expression of inflammatory and bone-related cell surface

markers in PAD-derived ASMC and human fetal aortic smooth muscle cells,

including CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4.

45

7.3 Materials and Methods

7.3.1 Cell culture

Primary cultures of human arterial smooth muscle cells were generated in vitro. Briefly,

arterial segments were kept in DMEM/F12 and antibiotics (10,000 U/mL penicillin G

sodium, 10,000 μm/mL streptomycin sulphate and 25μg/mL amphotericin B in 0.85%

saline; Gibco) for the transport from the theatre to the laboratory. Samples were

processed within 5 hours after amputation. Segments of the arteries were minced under

sterile conditions and transferred into 25cm2 culture flasks (Corning/Starsted)

supplemented with fresh DMEM/F12, 20% fetal calf serum and 1% antibiotics. Success

rate was evaluated after 3 weeks in culture. Human fetal ASMC (from the American

Type Culture Collection, Manassas,Virginia) were used as control cells and kept under

the same culture condition as the patient derived cells. The cells were incubated at 37°

C with 5% Co2 under humidified conditions and passaged when almost confluent. Cells

were used for experiments between passage 3 and 9, after reaching 80-90% confluency.

7.3.2 Flow cytometry and fluorescence microscopy

Cells for morphological study were grown separately onto glass cover slips placed in 24

well cell culture plate with flat-bottom wells (Sarstedt). The same antibodies were used

for flow cytometry and glass cover slips staining. Incubation with listed primary

antibodies (as given in Table 7.1) followed several washing steps before incubation with

respective secondary antibodies (Table 7.1). Corresponding labeled isotypes or

unstained controls were included in all experiments.

Morphologically, stained cells on cover slips were analysed with CoolSNAP ES digital

camera (Photometrics, Tucson, AZ) on a Nikon Eclipse 90i fluosrescent microscope.

For flow cytometry, live cells were scrapped and fixed before the standard staining

protocol was introduced. Fluorescent quantification was performed with FacsCallibur

(BD Biosciences). The recorded data were analyzed using Flowjo Software

(Treestar,Ashland,OR). Flow cytometry analysis included unstained controls and

isotype antibodies to account for autofluorescence or non-specific antibody binding.

7.3.3 Data and statistical analysis

The data obtained post-gating were corrected (minus auto fluorescence value) and

standardized against control to get the mean fluorescent score or standardized mean

difference (SMD). A one-way ANOVA with LSD post hoc tests were used to test mean

46

differences in expression of the phenotypic and/or inflammatory markers. A p-value of

less than 0.05 was considered statistically significant. Data were statistically analysed

with SPSS software (version 17.0; Chicago, IL) and GraphPad Prism® version 6.0

(trial). Error bar indicates standard deviation.

Table 7.1. List of primary and secondary antibodies used

Primary Antibody Company and

dilution

Secondary antibody

and dilution

(All from Invitrogen

unless stated

otherwise)

Mouse Anti-Smooth-

Muscle Actin antibody

(anti-α-SMA)

Isotype: Monoclonal IgG2b

with1 min permeabilization

time

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:200

Mouse Anti-Vimentin

antibody

Isotype: Monoclonal IgM

10 mins permeabilization

time

Sigma-Aldrich

(1:50)

Goat Anti-mouse IgM

(FITC) AbD Serotec

1:100

Mouse Anti-Desmin

Isotype: Monoclonal IgG1

No permeabilization

Sigma, USA

(1:50)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:100

Rabbit Anti- Osterix

Isotype: Polyclonal IgG

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-rabbit IgG

(Alexa Fluor 488)

1:200

Mouse anti-human Runx2

Isotype: Monoclonal IgG2b

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:200

Stro-1 IgM

Hybridoma cell line

Culture supernatant

(1:1)

(from Development

Studies Hybridoma

Bank)

Goat Anti-mouse IgM

(FITC) AbD Serotec

1:200

Mouse Anti-human CKR-2

Isotype:Monoclonal IgG

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:200

47

Pe-Cy7 ™ Mouse Anti-

Human CD194 or CCR4

Isotype: Monoclonal IgG1

BD Pharmingen

(1:100)

Pe-Cy7 ™ labeled

mouse IgG1 isotype

1:100

Mouse Anti-RANK

Isotype: Monoclonal

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:200

Mouse Anti-RANKL

Isotype: Monoclonal

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:200

Rabbit anti-human

CX3CR1

Isotype: Polyclonal IgG

No permeabilization

AbD Serotec

(1:100)

Donkey Anti-rabbit IgG

(AlexaFluor 488)

1:200

Rabbit anti-rat with 20%

cross-reactivity to Human

fractalkine

(CX3CL1)

Isotype: Polyclonal IgG

No permeabilization

Torrey Pines

(1:100)

Donkey Anti-rabbit IgG

(AlexaFluor 488)

1:200

PE ™ Mouse Anti-Human

CD14

Isotype: Monoclonal IgG

Becton Dickinson &

company

(1:100)

PE ™ labeled mouse

IgG isotype

(Becton Dickinson &

company)

1:200

Mouse Anti-Human TLR4

Isotype: Monoclonal IgG1

Santa Cruz

Biotechnology,Inc.

(1:100)

Donkey Anti-mouse

IgG (Alexa Fluor 488)

1:100

7.4 Results

7.4.1 Characterisation of ASMC according to lineage markers

Cells grown from PAD and control samples were tested for expression of lineage

markers using fluorescence microscopy. Both adherent cell lineages displayed slightly

elongated cells with hills and valleys characteristic of the arterial smooth muscle cells

(Figure 7.1A). The fetal aortic smooth muscle cells were positive for alpha smooth

muscle cell actin (SMA), slightly positive for vimentin and negative for desmin

expression. PAD derived cells generally exhibited positive SMA, vimentin and desmin

indicative of a myofibroblastic nature, as well as Stro-1, indicating a precursor stage

with stem cell properties. Flow cytometry was used to quantify marker expression and

the pooling of several cell lines results, after standardization using their negative

48

controls. Flow cytometry allows an indicative measurement of marker expression and in

this study, showed a relatively higher expression of vimentin, desmin, Stro-1, Osterix

and Runx2 in PAD samples when compared to the controls (representative bar charts

given in Figure 7.2). PAD derived cells also displayed detectable level of bone

transcription factors Runx2 and Osterix, although not significantly higher than control

cells (Figure 7.2E and 7.2F). In a representative histogram (shown in Figure 7.3), Stro-1

was expressed more in PAD derived ASMC compared to the fetal aortic smooth muscle

cells.

A Fetal Aortic SMC B DM PAD ASMC

C Fetal Aortic SMC D Skin Fibroblast Cells

Figure 7.1. Cells in the first row (A and B) were stained with alpha smooth muscle

actin (green). Cells in the second row (C and D) were stained with vimentin (red) which

is strongly positive for the skin fibroblast cells (used as positive control).

49

A p=0.764 B p=0.176

alpha-SMA

SM

D

Contr

ol

Non

DMPA

D

DM

PAD

0

1000

2000

3000

Vimentin

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

1000

2000

3000

4000

5000

C p=0.384 D p=0.272

Desmin

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

200

400

600

800

Stro-1

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

500

1000

1500

2000

E p=0.395 F p=0.488

Osterix

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

200

400

600

Runx-2

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

200

400

600

Figure 7.2 Phenotypic marker expression compared between control cells and ASMC

derived from non-diabetic and diabetic PAD. The assessments were made from pooled

flow cytometry data but standardized against unstained controls and respective

secondary or isotype antibodies. (SMD: standardized mean differences from median

fluorescent intensity). SMD ± SD.

50

Fetal Aortic SMC PAD ASMC

Figure 7.3 Intracellular phenotypic markers assessed by flow cytometry representing

the control (fetal aortic smooth muscle cells) and PAD arterial smooth muscle cell

lineage. The cells were gated based on cell size and granularity (forward scatter and side

scatter) after labeling with respective markers. Median fluorescent intensity from blue

histograms (as test markers) was corrected against the controls (in red histogram).

7.4.2 Characterisation of ASMC according to inflammatory markers

ASMC explanted and grown from PAD arterial samples expressed RANK and

CX3CR1. Interestingly, their respective ligands, which are membrane-bound RANKL

and CX3CL1, were not visible in arterial tissues (as examined in chapter 6) but seen

positive on PAD explanted ASMC when examined through flow cytometry. The

cellular surface markers for CX3CR1, CCR4 and RANK were shown in cells cultured

on glass cover slips (Figure 7.4).

51

Figure 7.4 Cover slips grown ASMC (derived from PAD samples) expressing

CX3CR1, CCR4 and RANK in (green fluorescent) with their respective negative

controls in the lower row. Blue fluorescent were the nuclear staining with DAPI.

Magnification at x20.

Since PAD is related to chronic inflammatory processes, an array of surface

inflammatory markers such as CX3CR1, RANK, CX3CL1, RANKL, CCR2, CCR4,

TLR4 and CD14 were investigated through flow cytometry. Figure 7.5 lists the one-way

ANOVA comparisons of the mean SMD between controls (fetal aortic SMC) and PAD

derived ASMC (which were further divided into non-diabetic and diabetic derived

samples). There were no significant differences between the groups but RANK showed

a trend to have increased expression in diabetic PAD derived samples as compared to

the rest of other cell groups (Figure 7.5A).

52

A p =0.052 B p =0.592

RANK

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

1000

2000

3000

m-RANKL

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

1000

2000

3000

4000

C p =0.575 D p =0.725

FKNrc

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

500

1000

1500

CX3CL1

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

1000

2000

3000

4000

E p =0.209 F p =0.653

CCR2

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

100

200

300

400

500

CCR4

SM

D

Contr

ol

Non

DMPA

D

DMPA

D

0

500

1000

1500

2000

G p =0.527 H p =0.073

53

TLR4

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

50

100

150

200

250

CD14

SM

D

Contr

ol

Non

DM

PAD

DM

PAD

0

20

40

60

80

100

Figure 7.5 Expression of surface markers on cultured fetal aortic SMC (controls) and

arterial SMC derived from non-diabetic and diabetic PAD. The assessments were made

from pooled flow cytometry data but standardized against unstained controls and

respective secondary or isotype antibodies. (SMD: standardized mean differences from

median fluorescent intensity). SMD ± SD.

7.5 Discussion

An in vitro model was used in this study to assess the phenotype and function of PAD

arterial smooth muscle cells, in which ASMC were able to be cultured from PAD

samples and subjected to phenotypic characterization and function. The results mainly

suggested an osteoblast-like phenotype with positive expression of Stro-1,vimentin and

an increased expression of RANK in diabetic PAD derived cells. These cells mainly

expressed positive alpha SMA staining, which suggests that these cells retained their

features as ASMC but with some “plasticity” in the presence of other markers. The

current study approach was mainly for observation of bone-like markers and other

inflammatory markers.

In vitro conditions in this study might be limiting to test the functional markers of

osteoblast-like cells as it is an artificial environment. Furthermore, by not using culture

conditions for bone forming cells, but getting an osteoblast-like phenotype indicates that

the approach may well be suitable. Media which is commonly used to generate

osteoblasts in culture (which include β-glycerophosphate and ascorbic acid) has been

shown to help transdifferentiation of the ASMC (Steitz et al., 2001; Wada et al., 1999).

It is not the intention of this study to try and generate osteoblast, but rather to examine

their basic phenotype potential.

54

Not many studies used human derived cells to determined the ability of these cells to

differentiate into osteoblast-like cells. Several studies have shown that primary culture

from bovine ASMC or mice derived ASMC are able to differentiate into ostoblast-like

cells, but with supplement of osteogenic β-glycerophosphate and ascorbic acid (Shioi et

al;1995,Steitz et al;2001). With higher Stro-1 expression (as represented in Figure 7.3),

there is a possibility that these PAD derived cells may differentiate into bone-like cells

given the right microenvironment. Spontaneous calcification has also been

demonstrated in human ASMC, but they may need longer culturing period for up to a

month (Proudfoot et al;1998).

Earlier study by Shanahan et al. (1999) has also looked into several markers to indicate

potential osteogenic cells from ASMC derived from amputated samples exhibiting

medial sclerosis. They showed expression of bone sialoprotein, alkaline phosphatase

and matrix Gla protein. In this study, transcription factors such as Runx2 and Osterix

were detected around 300 SMD and may be seen as low expressed in PAD derived

cells. However, higher expression of vimentin (nearly 3000 SMD), indicates that these

PAD derived cells were exhibiting a premature feature of an osteoblast-like cells (Lian,

Wang, Li, Elefteriou, & Yang, 2009). Having low expression of these transcriptional

factors, could still indicates that these cells have the potential to up-regulate the genes

related to bone formation. These cells may only need additional support by

inflammatory or other signals to do so. As a consequence of an inflammatory condition,

they could fully differentiate towards osteoblast-like cells and start to deposit a calcified

matrix (Ndip et al., 2011).

Inflammatory markers such as fractalkine receptors and CX3CL1 expression were

found to be higher than CCR2 expression. TLR4 and CD14 were 10 fold lower than

RANK fluorescent SMD, which is just above 1000. Whereas TLR4 SMD is about 100

and CD14 just 20. Markers having SMD below 500, were not detectable through cover

slip staining. Thus, markers which were positive in both tissue studies (in chapter 6) and

stained positive on cover slips were considered to be significant players in the

mechanistic pathway towards arterial remodelling.

Panizo and colleagues (2009) showed in their model, that ASMC lacking RANK, will

not show increase in calcification in the presence of RANKL. Given that the ASMC

expressed RANK (as shown in this study), they would probably respond to RANKL.

With higher Stro-1 expression (as represented in Figure 7.3), there is a possibility that

these PAD derived cells may differentiate into bone-like cells, given the right

55

microenvironment. Many studies have put forward the evidence that similar diseased

arterial SMCs can differentiate into bone-like cells (Ziyad and Abedin., 2004, Al-Aly,

2007; Panizo et al., 2009).

Chemokines and cytokines are important mediators of macrophage and T-cell

recruitment in a number of inflammatory pathologies, including PAD. Chemokines such

as CCR2 and CX3CR1 expressed in atherosclerotic lesions may play an important role

in mononuclear cell recruitment and macrophage differentiation. Lucas and others

(2003) has reported that fractalkine is expressed at a high level by a subset of

inflammatory cells, but rarely expressed in normal endothelial and ASMC. Instead,

ASMC derived from diseased patients’ arteries showed high expression of fractalkine

cognate receptor, CX3CR1. Relevant to atherosclerotic features, Lucas and colleagues

(2003) proposed that fractalkine-driven ASMC proliferation could result in intimal

hyperplasia. On the other hand, the current study tried to extend this finding to other

forms of arterial remodelling such as arteriosclerosis or specifically the calcification in

the medial wall. Medial calcification is an important risk factor for cardiovascular

disease and also an independent risk factor of future amputations in PAD (Guzman et al.

2008). Furthermore, another novel function of fractalkine involved not only cell

trafficking but also osteoclast maturation and activation (Koizumi et al 2009).

Saitoh and colleagues (2007) reported that the common osteoclast activator (RANKL)

could interact with CX3CR1. This study proposed that with continuous CX3CR1

expression, may interfere with osteoclast “release” from osteoblast after their interaction

to activate mature osteoclast. As Koizumi and others (2009) showed that osteoclasts

precursors may expressed CX3CR1, which became a potent chemotactic factor and

adhesive factor to bind to osteoblast. The close cell-to-cell interaction between an

osteoblast and an osteoclastic precursor is needed as part of the precursor cell’s crucial

steps to be activated by RANKL. Once the precursor is activated and become mature

osteoclast, the cell will need to reverse the adhesion from osteoblast in order to proceed

with bone-resorption activities. This is where RANKL role is proposed to suppress

CX3CR1 expression (Saitoh et al., 2007) and may explain the higher CX3CR1

expression in PAD derived ASMC.

The RANKL competitive inhibitor, osteoprotegerin (OPG) were positively expressed in

the vicinity of arterial calcification (Schoppet et al; 2004). OPG have been shown to

counteract RANKL effect by competitively binding to RANK. A study on OPG knock-

out mice display severe osteoporosis and vascular calcifications, which is also common

56

in humans (Bucay et al; 1998). When OPG action was blocked by RANKL infusion in a

mice model, skeletal deterioration but not vascular calcification was seen (Yuan et al.,

2008). It could be that in this case, a higher OPG to RANKL ratio indicates a late

marker for the disease process which involves vascular calcification.

The current study is adding more evidence to human studies by showing reduced

expression of RANKL but high expression of RANK for OPG binding and proposes an

increase in CX3CR1 expression as an effect which have been described by Saitoh and

colleagues study (2007). Therefore, detection of expression of RANK and CX3CR1 in

ASMC derived from PAD samples, point to certain mechanisms of how the

calcification phenotype may develop.

57

CHAPTER 8: INFECTIVE EVIDENCE INPAD SAMPLES

8.1 Introduction

This chapter is focused on investigating a specific risk factor, which is the intracellular

pathogen, known to be associated with atherosclerosis but equivocal for medial

sclerosis or medial calcification (MAC). Chlamydia Pneumoniae (CP) was selected as

the commonest reported obligate intracellular pathogen. CP has been the candidate link

between respiratory infection and atherosclerosis due to its ability to infect monocytes

or macrophages as a means of systemic dissemination (Campbell et al. 1995). This

chronic and commonly insidious infection may contribute to the inflammatory process

of atherosclerosis (Lehto et al., 2002; Rödel et al., 2000) and medial sclerosis

(Bobryshev, Lord, & Tran, 2006). Pathological studies have identified CP in

atherosclerotic plaques using numerous methods from polymerase chain reaction,

electron microscopy and antibody staining. Though the causal mechanism is not clear,

current evidence is that normal or non-atherosclerotic segments of the arterial wall were

comparatively free of Chlamydial antigens (Ngeh, Anand, & Gupta, 2002).

It has been shown earlier (in chapter 5) that severe vascular disease could be a

contributor to the calcified changes of the media. However, the link between calcified

arterial walls and CP infection is still not clear. Previously, evidence has been collated

from clinical study with a focus on ischemic heart disease or ischemic injury to the

brain (reviewed by Singanayagam et al. 2011). An interesting finding from a clinical

study (Syrjanen et al. 1988) suggests that prior infection is an important risk factor for

ischaemic stroke. The group identified that positive serological evidence for bacterial

infection in patients developing ischemic stroke was five times more likely than patients

with no serological evidence of infection prior to a stroke. These infections include the

common pathogens causing community-acquired pneumonia such as Staphylococcus

aureus, Streptococcus pneumoniae, Mycoplasma pneumoniae and CP. Another study by

Lin and others (2003) investigated the presence of CP in comparison to

Cytomegalovirus but found lower frequency of CP in their 200 samples of amputated

lower limbs in diabetic PAD cases.

58

Lipopolysaccharides (LPS) are part of the outer wall component of the intracellular

bacterium CP and other gram-negative bacteria. LPS are well-known endotoxins, and

their presence may be representative of these pathogenic organisms. Host defense

mechanisms will usually initiate a protective response or a chain of defense mechanisms

to combat the invasion of pathogenic organisms by detecting the molecular pattern of

the invading pathogen. Usually, the presence of these invaders will be sensed by the

surveillance cells like monocytes and macrophages with the help of a group of

transmembrane receptors called Toll-like receptors (TLR4) and CD14. However, CP

and certain intracellular microbes may be able to slip through these circulating sentinel

cells and hide intracellularly in residence cells such as ASMC. It has been reported that

low level of endotoxemia can pose as a significant risk factor for atherosclerosis and be

sufficient to produce an inflammatory response by human ASMC (Stoll et al., 2004;

Stöllberger & Finsterer, 2002). This study also investigated if the ASMC could

somehow respond to this invasion directly by mounting similar defense mechanisms to

the sentinel cells by evaluating the expression of TLR4 and CD14 on ASMC.

8.2 Hypothesis and Aims

Hypothesis - Intracellular infection such as Chlamydia Pneumoniae (CP) may be

associated with inflammation in PAD.

Aims:

(i)To determine the presence of CP in calcified diabetic samples and non-calcified

non-diabetic samples using immunofluorescence (IF) and polymerase chain

reaction (PCR).

(ii)To evaluate differential response to LPS via the molecular detection of TLR4

and CD14.

8.3 Material & Methods

Patient samples were grouped according to diabetic presence and calcification score.

The first group is non-diabetic PAD cases with mild or no calcification (N=3, 9 arterial

segments) and the second group is diabetic PAD cases with severe calcification (N=3, 6

arterial segments). Arterial segments were about 1-2 cm in length and contributed to an

average of 3 different sections tested for either PCR or immunofluorescent staining.

Successfully grown and confluent cells on glass cover slips were incubated with LPS

10ng/ml (AbD, Serotec) in 24 well plates over 24 hours. These cells were then fixed

with 0.5% PFA and stained with primary antibodies against TLR4 and CD14. Control

59

cells without LPS incubation were also included and a comparison was made with

negative control cover slips.

8.3.1 Antigen detection in tissue sections from PAD samples

CP specific immunofluorescence was performed on slides using purified mouse

monoclonal primary antibodies (IgG2a) against CP (TWAR; AbD, Serotec) and rabbit

IgG against Chlamydia (all strains; Fitzgerald). All tissue sections (8 µm) were

rehydrated and incubated in PBS with 3% FCS overnight after brief permeabilization

with 0.1% Triton-x. Test slides were incubated with respective primary antibodies

(1:100) and control slides were incubated without the primary antibodies in a humidity

chamber at 4°C overnight. Slides were washed in PBS prior to incubation with

respective secondary anti-rabbit and anti-mouse IgG (Alexa Fluor 488) from Invitrogen

(1:200). Nuclei were stained with DAPI (4’, 6-diamidine-2’-phenylindole

dihydrochloride) at 10ng/ml (Roche Diagnostics, Mannheim, Germany) along with

secondary antibody incubation for 30 minutes at RT. Slides were covered and allowed

to dry on the bench. Positive detection using confocal microscopy (Leica SP5) was

compared with the negative staining control of the same sample (matched sections

devoid of the primary antibody).

The following PCR work was undertaken by Adam Polkinghorne’s group from the

Institute of Health and Biomedical Innovation, Queensland University of Technology,

Brisbane, Queensland, Australia.

8.3.2 DNA extraction from cryosections

A variable number of 50 µm PFA-fixed cryosections were cut from the arteries of each

patient and placed in sterile cryotubes. Sections were transferred to sterile eppendorf

tubes and weighed. Tissue was washed twice in phosphate buffered saline to remove

cryogel and fixative. DNA extraction was performed using a QIAamp DNA mini kit

(Qiagen, Doncaster, Victoria) as per the manufacturer’s instructions.

8.3.3 C. pneumoniae-species specific PCR screening

Detection of CP from DNA extracted from tissue sections was performed using a

previously described conventional CP species-specific PCR assay (Campbell et

al.1992). Using primers (HM-1/HR-1; Table 8.1), this PCR assay targets a 229 base pair

(bp) CP-specific region of the RNA polymerase beta (rpoB) gene. PCR positivity was

60

evaluated on a subjective five-point scale (Appendix II, Figure 1) from strongly positive

(+++), moderately positive (++), weak positive (+), very weak positive (+/-) and PCR

negative (-) For the purpose of this thesis; the scale was converted to positive or

negative findings as represented in Table 1 and 2 (Appendix III).

The identity of CP positive bands was confirmed for selected samples by cloning of

PCR products into a pGEM-T Easy vector system (Promega, Alexander, NSW) and

transformation of Escherichia coli JM109 competent cells, as per the manufacturer’s

instructions. Positive plasmid constructs, identified by blue-white colour selection from

transformed colonies, were grown overnight in LB/ampicillin (100 µg/ml) media at

37°C. DNA extraction from selected colonies was performed using the Purelink™

Quick Plasmid Miniprep kit (Invitrogen, Mulgrave, Australia) and submitted for

sequencing at the Australian Genome Research Facility (AGRF).

8.3.4 Genotyping of C. pneumoniae PCR positive arterial samples

Genotyping of CP positive samples was based on the ability of the selected gene to

discriminate between indigenous Australian, non-indigenous and animal strain,

amplicon sizes (for amplification from fixed tissues). This gene, CPK_ORF00679,is a

hypothetical gene encoding a laminin 2-like protein which, distinguishes indigenous

Australian from non-indigenous strains by a 251 bp upstream segment, and additionally

distinguishes human from animal strains by any of five single nucleotide

polymorphisms (SNPs).

8.3.5 General PCR parameters

A set of general parameters was used for both CP detection and genotyping PCR assays.

Primer sequences and the appropriate annealing temperatures used are listed in Table

8.1. Briefly, each 50 µL reaction volume was prepared by addition of 10 µL DNA

template to a reaction mastermix containing 1U FastStartTaq DNA polymerase (Roche,

Castle Hill, NSW), 0.2 mM dNTPs (Roche), 1 x FastStartTaq PCR buffer with MgCl2

(Roche), 4.5 mM MgCl2 (Roche) and 0.3 µM each of forward and reverse primers as

described (Sigma Aldrich, Australia). Cycling conditions consisted of an initial

denaturation of 94 °C for 10 minutes, followed by 45 repeated cycles of 94 °C for 60

seconds, primer annealing (Table 8.1) for 60 seconds and extension at 72 °C for 60

seconds. The reaction was concluded with a final extension at 72 °C for 7 minutes.

DNA extracted from cell-cultured CP was used as a positive control for these reactions

and dH2O was used in negative control reactions.

61

All PCR products were visualised using Tris-Borate-EDTA agarose gel electrophoresis

with ethidium bromide to confirm presence and size of target products. PCR products

were purified and submitted for sequencing.

Table 8.1 Primer sequences for C. pneumoniae detection and genotyping.

8.3.6 Statistical evaluation

The groups of CP-positive vs.-negative samples were compared using non-parametric

Chi-square or Fisher’s exact test. The analysis was performed with SPSS version 16.0

(USA). Statistical significance was defined as p <0.05.

8.4 Results

8.4.1 Immunofluorescent detection of C. Pneumoniae in arterial tissues from PADsamples

Positive detection of CP antigen was found in nine out of fifteen PFA fixed arterial

sections when tested using species-specific CP antibodies. There were 3 positive

sections (50%) derived from diabetic PAD cases, which exhibited severe medial

calcification (score of 4). Whereas 6 positive sections (67%) were derived from non-

diabetic PAD cases and has minimal arterial calcification (score of 0 or 1). There was

no significant difference between the rates of CP detection in diabetic and non-diabetic

Primer

namePrimer sequence (5’ to 3’)

Annealing

temperature

(°C)

Predicted

size of

product

(bp)

Ref

Detection:

HM-1 GTGTCATTCGCCAAGGTTAA 48

229

Campbell

et al.

(1992)

HR-1 TGCATAACCTACGGTGTGTT48

Genotyping:

K_00679 HF TCGAAAAGGCGATTGTATATTG 60

539

Mitchell

et al.

(2010)

K_00679R TTGAGCTAAGGTCGAGGGAAG60

62

PAD cases, p=0.619 (see Figure 8.1A). CP antigens were not only found in diabetic

PAD cases or calcified arterial segments alone, but frequently found in non-diabetic

PAD cases as well. Similar arterial samples were also tested for PCR and the results

were given in Appendix II. The list for CP detection results by both techniques was

comparable in the tables provided in Appendix III.

A p =0.619 B p =0.128

Figure 8.1 There was no difference between positive CP detection using (A)

immunofluorescent microscopy or (B) using PCR methods.

8.4.2 PCR detection of C. Pneumoniae

Subsequent sections from similar arterial segments tested with IF, were run through

PCR analysis where more cryosections (N=50) were obtained from a total of 6 different

patients; three with diabetes and three without diabetes. Samples were investigated

using CP genotyping primers. Grading of the PCR products was done using quantitative

PCR. Figure 8.1B showed the distribution of positive PCR samples for non-diabetic and

diabetic arterial samples, which were 32% and 14% respectively. There was no

significant difference for the distribution (p=0.128).

8.4.3 Detection of C. Pneumoniae in ASMC derived from PAD samples

In order to confirm the presence of CP in ASMC, explant technique was used to obtain

cultured smooth muscle cells from PAD samples. Tissue immunofluorescence

microscopy has indicated that the CP distribution was found in the region positive with

smooth muscle cells (positive with alpha smooth muscle actin as shown in chapter 6).

63

Thus, cover slip samples were prepared to determine CP presence and distribution in

this cell culture. Figure 8.2A showed cytoplasmic distribution of CP antibodies in

ASMC. In tissue samples, positive staining was shown in the intima and media of

calcified arterial samples (Figure 8.3A and G), and also in the intima and media of non-

calcified sample (Figure 8.3 C). Evaluation through epifluorescent microscope (Nikon

90i upright) was further confirmed by confocal fluorescence microscopy evaluation (see

Figure 8.3).

Figure 8.2 ASMC derived from PAD sample (A) stained with primary antibody against

Chlamydia pneumoniae and (C) without the primary antibody stained with Alexa fluor

488.Figure B and D were corresponding nuclei staining with DAPI.

C D

A B

64

Figure 8.3 Arrows show positively stained anti-Chlamydial antibodies in the intima (A)

and media (G) of calcified PAD samples. Non-calcified PAD samples were also

positive with anti-Chlamydial antibodies in both intima and media (C) but negative in

C Media D Media

E Control sample F

G Test sample H

Intima Intima

A Lumen B Lumen

65

control samples (D). E and F were controls for calcified PAD samples. Blue staining

were respective nuclear staining DAPI. Scale bars in C and D 300 μm.

8.4.4 LPS activation induced TLR4 and CD14 expression

There is a possibility that ASMC could somehow respond to CP invasion by mounting a

similar defense mechanism to the sentinel cells (monocytes and macrophages) by

expressing TLR4 and CD14. Cover slips with grown cells activated by LPS and non-

activated cells were evaluated through immunofluorescence staining and positive

expression of TLR4 was seen only with LPS activated cells (Figure 8.4B). However,

upon quantification of pooled samples with flow cytometry, there was no significant

difference in TLR4 expression between diabetic or non-diabetic PAD grown cells

(Figure 8.5).

CD14 expression was invisible through immunofluorescence microscopy due to the

nature of the PE™ conjugated antibodies, which is sensitive to photo-induced

degradation. Therefore, it is best investigated through flow cytometry along with the

introduction of a positive control, using donor’s peripheral blood mononuclear cells

(PBMCs). Figure 8.6 showed the histogram of CD 14 expression for ASMC not

activated with LPS (Figure 8.6 A) and ASMC activated by LPS (Figure 8.6B).

Although there is a shift in the test histogram (Figure 8.6B) with LPS activation, the

overall expression of CD14 is still lower than the positive control (Figure 8.6C).

(A) TLR4 before LPS activation (B) TLR4 after LPS activation

Figure 8.4 TLR4 immunofluorescent staining pre (A) and post (B) 24 hours incubation

with LPS 10ng/ml on glass cover slips. Scale bar 50 μm.

66

Figure 8.5 TLR4 expression from flow cytometry, non-DM (N =5), DM (N =9),

unpaired T-test p=0.3.All samples were not activated with LPS in order to evaluate the

baseline expression of TLR4.

A B C

Figure 8.6 Histograms representing CD14 expression in non-activated ASMC in (A),

activated ASMC with LPS (B) and positive control from human peripheral blood

monocytes (C). Slight increase in CD14 expression can be seen in (B) which could be

due to the activation effect with LPS. The red lines showed cells with secondary

antibodies stained alone as controls and the blue line as the cells profile with tested

antibodies.

67

8.5 Discussion

The main finding of this study is that CP can be frequently demonstrated in both

diabetic and non-diabetic PAD arterial samples obtained from lower limb amputations.

The first aim in this study was to determine the presence of CP in calcified diabetic

samples, which represents severe PAD cases, and non-calcified non-diabetic samples,

which represents the less severe PAD cases. Thomas and colleagues (1999) also found

no correlation between CP detection and the severity of atherosclerosis grading using

Stary’s classification and showed that mild atherosclerotic lesions were as likely as the

severe lesions to be positive for CP.

Peripheral arterial disease, which is commonly comprised of both atherosclerosis and

medial sclerosis, has been associated with diabetes mellitus (Soor et al., 2008).

However, non-diabetic specimens with less severe histopathopathology (showing no

calcified lesions), collected in this study, showed positive detection of CP at a higher

percentage (between 6 and 20%) more by immunostaining detection and PCR

respectively. This could be due the presence of atherosclerosis in the non-calcified

samples. Earlier studies had found a relationship between atherosclerotic lesions and CP

presence through serological antigens, and previous study has shown that CP is not

normally found in non-diseased arteries (Grayston, 2000).

However, there is also a study showing low detection (3.5% positive) of CP in diseased

lower limb arteries from 200 cases of non-traumatic, diabetic amputated cases (Lin et

al., 2003). The control patients recruited in Lin and colleagues’ study (2003) were non-

diabetic patients who had undergone surgical amputation due to traumatic injury.

Therefore, this study reported similarly lower incidence of CP infection in diabetic

amputees with severe calcification, but higher incidence of CP infection in a well-

described control cases different to Lin’s study samples. The control cases recruited in

the current study were non-traumatic cases undergoing lower limb amputations

involving non-diabetic patients. Since this study has demonstrated that both diabetic and

non-diabetic cases have significantly higher calcification scores compared to non-

amputated cases in controls (as presented in chapter 5), CP infection may contribute to

the calcified lesions formation to some degree. The detection of CP could also be lower

because severe calcified samples may have less viable ASMC. As proposed by

Bobryshev and others (2006), the detection of CP in the medial ASMC may be

associated with the pathophysiological presentation of the calcified media as 10 out of

17 carotid artery specimens detected positive CP in their study. They also detected the

68

presence of CP with both PCR and immunohistochemistry staining. Gutiérrez and

others (2005) also found a relationship between PAD and CP infection through

immunohistochemical analysis and nested PCR studies. However, they made a guarded

conclusion from their meta-analyses of forty-three published studies, suggesting that

proper case-control study and adequate number of cases need to be used. Although the

majority of published studies used coronary arteries, one has to consider that coronary

disease and PAD share common risk factors including CP infection.

The finding in this study further enhanced the possibility that CP influences PAD

progression and contributes to vascular inflammation by expression of TLR4 and CD14.

Membrane-bound TLR4 and CD14 have been shown to be expressed in human

coronary ASMC, which suggests a role for these cells in leading the innate

inflammatory response by expressing the pattern recognition molecules (Shi et al.,

2010; Stoll et al., 2004). This response was shown in the context of low endotoxin such

as LPS and the level of CD14 can be a useful determinant of endotoxin–induced cellular

activation. Although there was no difference between non-diabetic and diabetic samples

in this study, expression of both TLR4 and CD14 could be clearly demonstrated using

the techniques proposed by Qiang Shi and colleagues (2010), which used flow

cytometry and similar conjugated-antibodies. Despite a low base-line expression in

these cells, higher expression of TLR4 and CD14 is seen in human ASMC compared to

endothelial cells or baboon ASMC (Shi et al., 2010).

The current study suggests that there might be various sources of inflammation

including CP, and interestingly the group without diabetes has higher infection rates. It

could be that other than diabetes mellitus, intracellular infection could influence PAD

progression and lead toward calcification of the arterial wall. TLR4 as part of the innate

immune system can be triggered not only by external pathogens, but also by

endogenous molecules released in response to tissue injury or damage cells (Gan et al.,

2013; Manolakis et al., 2011; Pasterkamp et al., 2004).

69

CHAPTER 9: DISCUSSION

The purpose of this general discussion is to summarize the major findings of this thesis

and attempt to discuss the implications of how the data contributes to an increased

understanding of vascular calcification related to inflammation and immunobiology.

The experiments described in this thesis were performed to examine the

immunopathology in PAD, specifically in the context of arterial calcification.

9.1 Major histopathological findings

The first issue addressed was to determine the major histopathological findings in

severe PAD cases obtained in this study. Previously, PAD was thought to be a sole

consequence of atherosclerosis because of the obvious stenotic lesion. Soor and others

(2008), however, showed that apart from atherosclerosis, medial calcification is an

important condition that can cause stiffening of the arterial wall, which can further

compromise the circulation to the lower limb. Medial calcification is also related to the

complication of diabetes mellitus, especially in patients having chronic kidney diseases.

In the study of Soor and colleagues (2008), out of 58 patients undergoing lower limb

amputation, 70% comprised patients with diabetes mellitus (mainly type 2). This study

recruited 17 patients undergoing lower limb amputation for non-traumatic causes in

which 59% were diabetic cases. The main histopathological lesion presented in the

current study was severe medial calcification, which did not show discrimination

between diabetic and non-diabetic cases.

The histopathological study (chapter 5) has found no fibrotic calcification displayed in

the intimal layer of the arterial cross sections derived from amputated PAD cases and

the controls. Instead, very few stages in the formation of atherosclerosis could be found,

which were fatty streak (evidenced by positive Oil red O staining) and intimal

thickening (showed by positive alpha smooth muscle actin staining). Although the

arterial samples appeared devoid of inflammatory cells (negative for CD45 and CD68),

it has been documented that in response to inflammatory damage, the normally residing

smooth muscle cells in the media can migrate and proliferate to effect repair.

70

9.2 Expression of CX3CR1 in the intima

Lucas and others (2003), have implicated the role of a chemokine receptor (CX3CR1)

expressed by the ASMC, to facilitate the migration and proliferation of the smooth

muscle cells. The findings in Chapter 6 have demonstrated the presence of CX3CR1 in

similar cells of the arterial intima and media of both diabetic and non-diabetic PAD.

However, another common receptor in atherosclerosis (CCR2) or the monocyte

chemotactic protein-1 (MCP-1) was not found in the samples of this study. It could be

that these PAD samples have bypassed the early stage of atherosclerosis formation and

may not progress to form plaques in the intima. This finding may support the notion that

CCR2 is mainly important at the early stage. However, no other human study has

demonstrated CCR2 expression on ASMC. Evidence of CCR2 involvement in

atherogenesis were mainly based on animal studies using the Apo E deficient mice

model (Guo et al., 2005; Zhang et al., 2011). A study using freshly isolated human

monocytes, suggested that stimulation with CCL2 induced a rapid increase of CX3CR1

protein on the cell surface (Green et al., 2006). Guo and colleagues (2005) studied the

role of CCR2 in established atherosclerotic lesions by transplanting bone marrow

progenitor cells from CCR2-deficient mice into irradiated 16 week-old Apo E knockout

mice with established atherosclerosis. The CCR2 deficient bone marrow progenitor

cells did not seem to reduce the plaque progression in the irradiated mice after 9 weeks

of transplantation and there is still evidence of macrophage or monocyte influx at lesion

site. This suggests that there may be additional mechanisms for recruitment of

monocytes at later stages of an advanced vascular disease with expression of CX3CR1

and not CCR2.

9.3 Expression of CX3CR1 and RANK in the media

The findings of medial calcification in severe PAD cases examined in this thesis were

further associated with expression of RANK and CX3CR1. These markers may

represent inflammatory functions related to osteoblast and osteoclast-like activity. On

one hand, osteoclast precursors, which are the monocytes, may be recruited by diseased

ASMC expressing CX3CR1. On the other hand, there is less RANKL expression to

induce the down-regulation of the fractalkine receptor and release the binding of

monocytes from ASMC. In a physiological context, Saitoh and others (2007) proposed

that mature osteoclast (upon activation by the osteoblast on cell-cell interaction) need to

reverse the adhesion to osteoblast and rustle in the bone-like matrix in order to proceed

with bone resorption activities. ASMC in the context of PAD do not only express

71

CX3CR1 but also RANK. RANK expression is important in the event of arterial

calcification, which closely resembles bone formation. RANK as part of the molecular

triad (RANK, RANKL and OPG) is an important participant in bone forming activity.

With the reportedly higher OPG expression in PAD (Poulsen et al., 2011; Ziegler et al.,

2005), RANKL activity may be reduced and allow higher expression of CX3CR1

instead.

OPG and RANKL as inflammatory markers, have been investigated by Schoppet and

colleagues (2004), who investigated atherosclerosis and Monkeberg’s sclerosis in the

coronary arteries; but they have not yet been described for the popliteal and tibial

branches. One recent study by Heymann and others (2012) did compare the expression

of the bone regulatory triad OPG/RANK/RANKL between carotid and femoral arteries

and highlighted some differences between the two. The study of Heymann and

colleagues (2012) also demonstrated less infiltration of macrophages in the femoral bed

and lesser expression of OPG, which may contribute to the overall higher calcification

seen in the lower limb arteries. Interestingly, serum OPG level is higher for the femoral

subjects but lower for the carotid subjects.

9.4 In vitro assessment

In chapter 7, it has been shown that the highly calcified arteries were able to grow

“synthetic” ASMC phenotype with explant techniques. The term “synthetic” is used

here to denote the plasticity or the ability of the ASMC to trans-differentiate into other

stromal cell lineages as suggested by Vukovic and others (2006). Compared to human

fetal ASMC, PAD derived ASMC displayed positive smooth muscle actin and

vimentin. Vimentin is a well-known marker for a synthetic smooth muscle cell (Salabei

et al., 2013; Vukovic et al., 2006). Na Lian and colleagues (2009, 2012) had also found

an interaction of vimentin with an osteoblast transcription factor ATF4. They concluded

that vimentin will be predominantly expressed in immature osteoblast and might

interfere with the terminal differentiation of this cells, which are of stromal origin (Lian

et al., 2012, 2009).

The expression of other bone-regulatory markers in association with inflammation such

as RANK and CX3CR1 were demonstrated at both tissue and cellular levels in this

thesis. In support of these findings, Schoppet et al. (2004) have demonstrated OPG

localization, but not RANKL in Mönckeberg’s sclerosis and atherosclerotic samples. In

contrast, Ndip et al. (2011) showed positive RANKL staining within the vicinity of

calcified medial arterial layer. Both studies utilized immunohistochemistry techniques,

72

but used different primary antibodies which are mouse anti human RANKL monoclonal

antibodies (R&D systems) and rabbit anti-human RANKL (AbCAM,UK). RANKL

mRNA expression were also negative in Schoppet’s investigation. Ndip and colleagues

however, did not find any different serum level of RANK or RANKL between control

and diabetic patients without Charcot’s lesion, but a higher soluble form of RANKL in

the serum of Charcot’s patient. Thus, the higher serum RANKL in patients with Charcot

lesion may explain the increased osteolysis activity of the ankle joint. Ndip and

colleagues (2011) further suggest increased expression of RANK on the smooth muscle

cells, drives the osteoblastic differentiation pathway to facilitate arterial calcification.

This could be relevant to the expression of RANK in ASMC as shown at both tissue and

cellular levels (chapter 6 and 7). Furthermore, Heymann and others (2012) found

positive expression of both RANK and RANKL in diseased carotid and femoral

specimens but highlighted that the expression is found in macrophages, lipid core and

calcified plaques rather than ASMC.

9.5 CX3CR1 expression and relation to vascular calcification

In earlier literature, the fractalkine receptor (CX3CR1) has been mainly discussed in

association with atherosclerosis (Kumar et al., 2010; Liu et al., 2008). Although, the

expression of CX3CR1 has been frequently associated with atherosclerosis, the main

function of this receptor is to facilitate monocyte and macrophage recruitment to the

intimal layer or other inflammatory sites (reviewed by Liu and Jiang, 2011). Lucas and

colleagues (2003) proposed that this chemokine may play an important role in vascular

remodelling, since many of these receptors are found in the neo-intima of human

coronary artery plaques and expressed by the smooth muscle cells recruited into the

atherosclerotic plaque.

However, there is now emerging evidence for the role of CX3CR1 and its ligand in

vascular calcification (Hoshino et al., 2013). CX3CR1 expression in the context of

PAD in this study may be relevant to arterial wall remodelling which involved

osteoblast and osteoclasts-like activity. Evidence of osteoclast-like activity was detected

through positive TRAP expression along calcified areas of PAD arteries.

In a model of CX3CR1-deficient mice, osteoclast formation was reduced alongside the

increase in osteoid formation. Thus, in a diseased state where CX3CR1 is up-regulated,

there may be an up-rise in osteoclast formation and more bone resorption that leads to

osteopenia. This phenomenon was considered to be a therapeutic method in

counteracting vascular calcification in a review by Demer, Linda and Tintut (2011).

73

They proposed that the osteoclastic activity could be part of the host defense mechanism

to counteract vascular calcification. Chapter 6 of this thesis has demonstrated positive

TRAP staining in PAD arterial samples, suggesting that there is osteoclast-like activity

in the area of the calcified lesions.

In bone biology, presence of CX3CR1 alongside the TRAP activity may be explained

by Hoshino and others (2012) findings, where they coupled the role of the CX3CR1-

CX3CL1 axis to the early stage of osteoblast formation and maintenance of osteoclastic

precursors. Chapter 7 demonstrated detectable levels of bone transcriptional factors;

Cbfa1/Runx2 and Osterix through flow cytometry on PAD derived arterial SMC.

RANK expression is higher in PAD derived SMC and this supports the expression of

RANK on the stromal lineage cells such as ASMC.

9.6 Possible infective cause as a source of inflammation

As mentioned earlier, intracellular infection is highlighted as a possible source of

inflammation, which may induce vascular calcification seen in severe PAD cases. It has

been well documented that Chlamydia Pneumoniae may be implicated with

atherosclerosis, but the association of this particular pathogen with arterial calcification

is still not clear. Bobryshev and colleaugues (2006) have demonstrated a significant

relationship between Chlamydia and medial calcification from 60 endarterectomy

carotid samples. They investigated the presence of the organism using PCR and

immunohistochemistry and showed 17 samples (28%) positive with both methods.

Another group (Lin et al., 2003), however, detected higher presence of cytomegalovirus

and not Chlamydia pneumoniae in 200 samples of atherosclerotic lesions from diabetic

cases undergoing lower limb amputations. Lin and others (2003) demarcated only

atherosclerotic lesions and not medial calcification. The samples included in chapter 6

however selectively differentiates diabetic and non-diabetic amputated samples and

representative of medial calcification (for the diabetic cases). Although the distribution

of Chlamydia pneumoniae was similar in both groups, the detection for diabetic and

non-diabetic patients was still high (50% and 67% respectively) with

immunofluorescent staining and (14% and 32% respectively) with PCR study.

Chapter 6 further explores the expression of TLR4 and CD14 on the ASMC using flow

cytometry, to identify whether the probable related pathways are involved. This was

assessed by incubating the ASMC with low level of LPS and comparing the expression

of the markers (TLR4 and CD14) without LPS incubation, using flow cytometry..

74

However, there is no significant difference between activated and non-activated ASMC

with LPS introduction. LPS, the outer glycolipid content in the outer leaflet of the outer

wall of Gram- negative bacteria can bind to TLR4 and is thought to induce the

expression of other endotoxin receptor such as LPS- binding protein, CD14 and MD-2

(Antal-Szalmás, 2000; Pasterkamp et al., 2004). These surface markers or receptors are

quite specific for circulating inflammatory cells, and there is evidence that human

smooth muscle cells can express similar endotoxin receptors. Although the TLR4

baseline expression is low in ASMC, LPS is shown to increase TLR4 expression in

Qiang Shi and others study (2010). Qiang Shi uses both flow cytometry for detection of

protein expression and reverse transcription-polymerase chain reaction for mRNA

quantification of the TLR4 protein expression in human and baboon ASMC. Results

from flow cytometry, presented in chapter 7 also showed similar expression with an up

regulated trend of TLR4 and CD14, although their expression were not as high as

CX3CR1 and RANK expression in PAD ASMC samples.

Interestingly, Zulli (2008) demonstrated leukocytic markers such as CD14 and

embryonic stem cell markers (i.e. Octomer 4 and SSEA 1, 3 and 4) in ASMC derived

from diseased arteries. This further supports the phenotypic plasticity of the ASMC,

where aberrant phenotypic and functional changes of ASMC changes into bone-like

cells or foam-like cells may contribute to the pathogenesis of vascular diseases such as

atherosclerosis and Monckeberg’s sclerosis.

9.7 Limitations of the study

9.7.1 Sample size

The first limitation encountered in this study was sample size since recruited diabetic

and non-diabetic cases in this study is only 17 compared to 58 patients in the study of

Soor and others (2008). However, this study sample managed to show highly significant

calcified lesions in amputated diabetic samples when compared to non-diabetic samples,

as presented by Soor’s group. This could probably be due to the higher percentage of

diabetic participants in both Soor’s (70%) and this study (59%). Interestingly, a study

by Mozes et al. (1998) did not show significant differences between calcified lesions

amongst their equally distributed diabetic amputees (N=14) and non-diabetic amputees

(N=14).

75

9.7.2 Variability in biological samples

Another limitations could be due to the variability of biological samples as

suggested by age distribution alone. For example, a given age for any case selected

from the cadaveric controls and PAD group, could be anywhere between 39 to 90 years

old. This may contribute to an experimental challenge to obtain minimal variation in the

extent of histological or molecular abnormalities within a small sample size. The arterial

wall changes observed could be a wide spectrum from a healthy young artery to a

senescent and diseased artery.

9.7.3 Methodological aspects

With viable cell lineage of the adherent cell type, the cells grown from human PAD

samples obtained in this study did not detach easily with EDTA-Trypsin methods at

0.05% diluted concentration. Enzymatic digestion with this detachment method may

also render the loss of surface markers under investigation. Scrapping method was used

instead and this is done before the cell lineage reach maximum confluence. However,

this may contribute to the difficulty in obtaining a single cell suspension when the

scrapped cells easily become clumped together, due to increased “stickiness” when

detached manually. This could lead to an unspecific binding when using

immunofluorescence-based techniques leading to a higher background staining in the

controls. Another issue is in handling a large number of cells to be run together for

several long experiments using flow cytometry.

9.8 Future direction

In the future, more attention can be given to the selected few inflammatory markers

chosen since this thesis mainly tested a list of probable inflammatory mediators under a

wide range of targets. With narrowed list of candidates, better experimental targets can

be designed using precious human samples. Further evaluation of the selected markers

can also be made at the transcriptional or translational level using different stimuli in

activated cells.

9.9 Conclusions

In conclusion, the main findings from this thesis project are as follows:

1) ASMC derived from severe PAD with medial wall calcification express RANK

and CX3CR1.

2) Phenotypic plasticity is displayed by ASMC derived from PAD in response to

chronic inflammatory condition.

76

3) Intracellular infection in cases of severe PAD might trigger inflammation in the

arterial wall.

Although the study has a small sample size, the cohort of 17 amputated cases might

give some insight to vascular immunopathobiology. The results of this work represent

an important step toward understanding medial wall calcification and its interplay with

recent inflammatory molecules. In addition to recognizing an extended role of

CX3CR1, which most likely contribute to the monocytes recruitment and activation into

osteoclasts, CX3CR1 expression could also be regulated by RANK/RANKL/OPG

activities. These regulatory molecules of bone biology seem to be at the same time

inflammatory mediators that may link the immune system to the vascular system, where

vascular cells, such as the ASMC, play an important role in maintaining vascular health

and integrity and may respond with pathological remodelling to inflammatory signals.

77

REFERENCES

AIHW (2011). Australian Institute of Health and Welfare. Diabetes prevalence inAustralia: detailed estimates for 2007-08. Diabetes series no. 17. Cat. no. CVD 56.Canberra: AIHW. http://www.aihw.gov.au/publication-detail/?id=10737419311.

Abbott, R. D., Brand, F. N., & Kannel, W. B. (1990). Epidemiology of some peripheralarterial findings in diabetic men and women: experiences from the FraminghamStudy. The American Journal of Medicine, 88(4), 376–81. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/2327425

Ahdjoudj, S., Fromigué, O., & Marie, P. J. (2004). Plasticity and regulation of humanbone marrow stromal osteoprogenitor cells : potential implication in the treatment of age-related bone loss. Histology & Histopathologyl, 19, 151–158.

Al-Aly, Z. (2007). Medial vascular calcification in diabetes mellitus and chronic kidneydisease: the role of inflammation. Cardiovascular & Haematological Disorders-Drug Targets, 7(1), 1–6. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/17346122

Antal-Szalmás, P. (2000). Evaluation of CD14 in host defence. European Journal ofClinical Investigation, 30(2), 167–79. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10651843

Aponte, J. (2012). The prevalence of peripheral arterial disease (PAD) and PAD riskfactors among different ethnic groups in the US Population. Journal of VascularNursing : official publication of the Society for Peripheral Vascular Nursing,30(2), 37–43. doi:10.1016/j.jvn.2011.11.004

Bensidhoum, M., Chapel, A., Francois, S., Demarquay, C., Mazurier, C., Fouillard, L.,… Lopez, M. (2004). Homing of in vitro expanded Stro-1- or Stro-1+ humanmesenchymal stem cells into the NOD/SCID mouse and their role in supportinghuman CD34 cell engraftment. Blood, 103(9), 3313–9. doi:10.1182/blood-2003-04-1121

Billiard, J., Moran, R. a, Whitley, M. Z., Chatterjee-Kishore, M., Gillis, K., Brown, E.L., … Bodine, P. V. N. (2003). Transcriptional profiling of human osteoblastdifferentiation. Journal of Cellular Biochemistry, 89(2), 389–400.doi:10.1002/jcb.10514

Blumenthal, H. T., Lansing, A. I., & Wheeler P.A. (1944). Calcification of the media ofthe human aorta and its relation to intimal arteriosclerosis, ageing and disease. TheAmerican Journal of Pathology, XX(4), 665.

Bobryshev, Y. V, Lord, R. S. a, & Tran, D. (2006). Chlamydia pneumoniae in foci of“early” calcification of the tunica media in arteriosclerotic arteries: an incidentalpresence? American Journal of Physiology - Heart and Circulatory Physiology,290(4), H1510–9. doi:10.1152/ajpheart.01055.2005

78

Boström, K., Watson, K. E., Horn, S., Wortham, C., Herman, I. M., & Demer, L. L.(1993). Bone morphogenetic protein expression in human atherosclerotic lesions.The Journal of Clinical Investigation, 91(4), 1800–9. doi:10.1172/JCI116391

Bucay, N., Sarosi, I., Dunstan, C. R., Morony, S., Tarpley, J., Capparelli, C., …Simonet, W. S. (1998). Osteoprotegerin-Deficient Mice Develop Early OnsetOsteoporosis and Arterial Calcification. Genes & development, 12(9), 1260–8.Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=316769&tool=pmcentrez&rendertype=abstract

Butoi, E. D., Gan, A. M., Manduteanu, I., Stan, D., Calin, M., Pirvulescu, M., …Simionescu, M. (2011). Cross talk between smooth muscle cells andmonocytes/activated monocytes via CX3CL1/CX3CR1 axis augments expressionof pro-atherogenic molecules. Biochimica et Biophysica Acta, 1813(12), 2026–35.doi:10.1016/j.bbamcr.2011.08.009

Byon, C. H., Sun, Y., Chen, J., Yuan, K., Mao, X., Heath, J. M., … Chen, Y. (2011).Runx2-upregulated receptor activator of nuclear factor κB ligand in calcifying smooth muscle cells promotes migration and osteoclastic differentiation ofmacrophages. Arteriosclerosis, thrombosis, and vascular biology, 31(6), 1387–96.doi:10.1161/ATVBAHA.110.222547

Campbell, C. K. (n.d.). Detection of Chlamydia pneumoniae in Arterial Tissues. TheJournal of Infectious Diseases, 181. Retrieved fromhttp://www.jstor.org/stable/30110397

Chan, E. P., Mhawi, A., Clode, P., Saunders, M., & Filgueira, L. (2009). Effects oftitanium(iv) ions on human monocyte-derived dendritic cells. Metallomics : Integrated Biometal Science, 1(2), 166–74. doi:10.1039/b820871a

Charo, I. F., & Ransohoff, R. M. (2006). The many roles of chemokines and chemokinereceptors in inflammation. The New England Journal of Medicine, 354(6), 610–21.doi:10.1056/NEJMra052723

Chi, Y. W., & Jaff, M. R. (2008). Optimal risk factor modification and medicalmanagement of the patient with peripheral arterial disease. Catheterization andCardiovascular Interventions : Official Journal of the Society for Cardiac Angiography & Interventions, 71(4), 475–89. doi:10.1002/ccd.21401

Criqui, M.H, Langer, R. ., Fronek, A., Feigelson, H. ., & et al. (1992). Mortality over aperiod of 10 years in patients with peripheral arterial disease. The New EnglandJournal of Medicine, 326(6), 381.

Criqui, Michael H, & Ix, J. H. (2012). Highs and lows in the peripheral vasculature.Journal of the American College of Cardiology, 59(4), 408–9.doi:10.1016/j.jacc.2011.10.861

Demer, Linda and Tintut, Y. (2011). The roles of lipid oxidation products and receptoractivator of nuclear factor-kappa B signaling in atherosclerotic calcification.Circulation Research., 108(12), 1482–1493.doi:10.1161/CIRCRESAHA.110.234245.The

79

Ducy, P., Zhang, R., Geoffroy, V., Ridall, a L., & Karsenty, G. (1997). Osf2/Cbfa1: atranscriptional activator of osteoblast differentiation. Cell, 89(5), 747–54.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9182762

Epstein, S. E., Zhou, Y. F., & Zhu, J. (1999). Infection and Atherosclerosis : Emerging Mechanistic Paradigms. Circulation, 100(4), e20–e28.doi:10.1161/01.CIR.100.4.e20

Fadini, G. P., Rattazzi, M., Matsumoto, T., Asahara, T., & Khosla, S. (2012). EmergingRole of Circulating Calcifying Cells in the Bone-Vascular Axis. Circulation,125(22), 2772–2781. doi:10.1161/CIRCULATIONAHA.112.090860

Filgueira, L. (2004). Fluorescence-based staining for Tartrate-resistant AcidicPhosphatase (TRAP) in osteoclasts combined with other fluorescent dyes andprotocols. Journal of Histochemistry & Cytochemistry, 52(3), 411–414.doi:10.1177/002215540405200312

Fishbein, G. A., & Fishbein, M. C. (2009). Rethinking the Current Classification.Archive of Pathology & Laboratory Medicine, 133, 1309–1316.

Foo, C., Frey, S., Yang, H. H., Zellweger, R., & Filgueira, L. (2007). Downregulationof beta-catenin and transdifferentiation of human osteoblasts to adipocytes underestrogen deficiency. Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 23(9), 535–40.doi:10.1080/09513590701556483

Fowler, B., Jamrozik, K., Norman, P., & Allen, Y. (2002). Prevalence of peripheralarterial disease: persistence of excess risk in former smokers. Australian and NewZealand Journal of Public Health, 26(3), 219–24. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12141616

Gabbiani, G., Schmid, E., Winter, S., Chaponnier, C., Chastonay, D., Vandekerckhove,J., & Franke, W. W. (1981). Vascular smooth muscle cells differ from othersmooth muscle cells : Predominance of vimentin filaments and a specific a-type actin. Proceedings of the National Academy of Sciences of the United States ofAmerica, 78.

Gan, A.-M., Butoi, E. D., Manea, A., Simion, V., Stan, D., Parvulescu, M.-M., …Simionescu, M. (2013). Inflammatory effects of resistin on human smooth musclecells: up-regulation of fractalkine and its receptor, CX3CR1 expression by TLR4and Gi-protein pathways. Cell and Tissue Research, 351(1), 161–74.doi:10.1007/s00441-012-1510-9

Golomb, B. a, Dang, T. T., & Criqui, M. H. (2006). Peripheral arterial disease:morbidity and mortality implications. Circulation, 114(7), 688–99.doi:10.1161/CIRCULATIONAHA.105.593442

Grayston, J. T. (2000). Background and current knowledge of Chlamydia pneumoniaeand atherosclerosis. The Journal of Infectious Diseases, 181(Suppl 3), S402–10.doi:10.1086/315596

80

Green, S. R., Han, K. H., Chen, Y., Almazan, F., Charo, I. F., Miller, Y. I., &Quehenberger, O. (2006). The CC chemokine MCP-1 stimulates surfaceexpression of CX3CR1 and enhances the adhesion of monocytes tofractalkine/CX3CL1 via p38 MAPK. The Journal of Immunology, 176(12), 7412–20. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16751386

Guo, J., de Waard, V., Van Eck, M., Hildebrand, R. B., van Wanrooij, E. J. a, Kuiper,J., … Van Berkel, T. J. C. (2005). Repopulation of apolipoprotein E knockout micewith CCR2-deficient bone marrow progenitor cells does not inhibit ongoingatherosclerotic lesion development. Arteriosclerosis Thrombosis and VascularBiology, 25(5), 1014–9. doi:10.1161/01.ATV.0000163181.40896.42

Gutiérrez, J., Luna, J. D. D., Linares, J., Montes, R., Quesada, E., Rojas, A., …Sorlozano, A. (2005). Relationship between peripheral arterial occlusive disease(PAOD) and chronic Chlamydophila (Chlamydia) pneumoniae infection. ThrombHaemost, 93, 1153–1160. doi:10.1160/TH04

Heymann, M.-F., Herisson, F., Davaine, J.-M., Charrier, C., Battaglia, S., Passuti, N.,… Heymann, D. (2012). Role of the OPG/RANK/RANKL triad in calcifications ofthe atheromatous plaques: comparison between carotid and femoral beds. Cytokine,58(2), 300–6. doi:10.1016/j.cyto.2012.02.004

Hjortnaes, J., Butcher, J., Figueiredo, J.-L., Riccio, M., Kohler, R. H., Kozloff, K. M.,… Aikawa, E. (2010). Arterial and aortic valve calcification inversely correlateswith osteoporotic bone remodelling: a role for inflammation. European HeartJournal, 31(16), 1975–84. doi:10.1093/eurheartj/ehq237

Hoshino, A., Ueha, S., Hanada, S., Imai, T., & Ito, M. (2012). Roles of chemokinereceptor CX3CR1 in maintaining murine bone homeostasis through the regulationof both osteoblsats and osteoclasts. Journal of Cell Science, 126(December).

Hoshino, A., Ueha, S., Hanada, S., Imai, T., Ito, M., Yamamoto, K., … Iimura, T.(2013). Roles of chemokine receptor CX3CR1 in maintaining murine bonehomeostasis through the regulation of both osteoblasts and osteoclasts. Journal ofCell Science, 126(Pt 4), 1032–45. doi:10.1242/jcs.113910

Hunt, J. L. (2002). Bone Formation in Carotid Plaques: A Clinicopathological Study.Stroke, 33(5), 1214–1219. doi:10.1161/01.STR.0000013741.41309.67

Iyemere, V. P., Proudfoot, D., Weissberg, P. L., & Shanahan, C. M. (2006). Vascularsmooth muscle cell phenotypic plasticity and the regulation of vascularcalcification. Journal of Internal Medicine, 260(3), 192–210. doi:10.1111/j.1365-2796.2006.01692.x

Jeffcoate, W. J., Rasmussen, L. M., Hofbauer, L. C., & Game, F. L. (2009). Medialarterial calcification in diabetes and its relationship to neuropathy. Diabetologia,52(12), 2478–88. doi:10.1007/s00125-009-1521-6

Jeziorska, M., McCollum, C., & Woolley, D. (1998). Calcification in atheroscleroticplaque of human carotid arteries: associations with mast cells and macrophages.Journal Of Pathology, 185, 10–17.

81

Jones, D. H., Kong, Y.-Y., & Penninger, J. M. (2002). Role of RANKL and RANK inbone loss and arthritis. Annals of the Rheumatic Diseases, 61 Suppl 2, ii32–9.Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1766717&tool=pmcentrez&rendertype=abstract

Knudsen, S. T., Foss, C. H., Poulsen, P. L., Andersen, N. H., Mogensen, C. E., &Rasmussen, L. M. (2003). Increased plasma concentrations of osteoprotegerin intype 2 diabetic patients with microvascular complications. European Journal ofEndocrinology / European Federation of Endocrine Societies, 149(1), 39–42.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12824864

Koizumi, K., Saitoh, Y., Minami, T., Takeno, N., Tsuneyama, K., Miyahara, T., …Saiki, I. (2009). Role of CX3CL1/fractalkine in osteoclast differentiation and boneresorption. Journal of immunology (Baltimore, Md. : 1950), 183(12), 7825–31.doi:10.4049/jimmunol.0803627

Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., …Kishimoto, T. (1997). Targeted disruption of Cbfa1 results in a complete lack ofbone formation owing to maturational arrest of osteoblasts. Cell, 89(5), 755–64.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9182763

Kumar, A. H. S., Metharom, P., Schmeckpeper, J., Weiss, S., Martin, K., & Caplice, N.M. (2010). Bone marrow-derived CX3CR1 progenitors contribute to neointimalsmooth muscle cells via fractalkine CX3CR1 interaction. The FASEB Journal : Official Publication of the Federation of American Societies for ExperimentalBiology, 24(1), 81–92. doi:10.1096/fj.09-132225

Lehto, S., Niskanen, L., Suhonen, M., Rönnemaa, T., Saikku, P., & Laakso, M. (2002).Association between Chlamydia pneumoniae antibodies and intimal calcificationin femoral arteries of nondiabetic patients. Archives of Internal Medicine, 162(5),594–9. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11871929

Leinonen, M., & Saikku, P. (2002). Evidence for infectious agents in cardiovasculardisease and atherosclerosis. Lancet Infectious Diseases, 2, 11–17.

Levy, P. J. (2002). Epidemiology and pathophysiology of peripheral arterial disease.Clinical Cornerstone, 4(5), 1–15. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/16472007

Lian, N., Lin, T., Liu, W., Wang, W., Li, L., Sun, S., … Yang, X. (2012). Transforminggrowth factor β suppresses osteoblast differentiation via the vimentin activating transcription factor 4 (ATF4) axis. The Journal of biological chemistry, 287(43),35975–84. doi:10.1074/jbc.M112.372458

Lian, N., Wang, W., Li, L., Elefteriou, F., & Yang, X. (2009). Vimentin inhibits ATF4-mediated osteocalcin transcription and osteoblast differentiation. The Journal ofBiological Chemistry, 284(44), 30518–25. doi:10.1074/jbc.M109.052373

Libby, P. (2002). Inflammation and Atherosclerosis. Circulation, 105(9), 1135–1143.doi:10.1161/hc0902.104353

82

Lin, T. M., Chen, W. J., Chen, H. Y., Wang, P. W., & Eng, H. L. (2003). Increasedincidence of cytomegalovirus but not CP in athelosclerotic lesions of arteries oflower extremities from patients with diabetes mellitus undergoing amputation.Journal of Clinical Pathology, 56, 429–433.

Liu, P., Yu, Y.-R. a, Spencer, J. a, Johnson, A. E., Vallanat, C. T., Fong, A. M., …Patel, D. D. (2008). CX3CR1 deficiency impairs dendritic cell accumulation inarterial intima and reduces atherosclerotic burden. Arteriosclerosis Thrombosisand Vascular Biology, 28(2), 243–50. doi:10.1161/ATVBAHA.107.158675

Lucas, A. D., Bursill, C., Guzik, T. J., Sadowski, J., Channon, K. M., & Greaves, D. R.(2003). Smooth muscle cells in human atherosclerotic plaques express thefractalkine receptor CX3CR1 and undergo chemotaxis to the CX3C chemokinefractalkine (CX3CL1). Circulation, 108(20), 2498–504.doi:10.1161/01.CIR.0000097119.57756.EF

Mabilleau, G., Petrova, N. L., Edmonds, M. E., & Sabokbar, a. (2008). Increasedosteoclastic activity in acute Charcot’s osteoarthopathy: the role of receptoractivator of nuclear factor-kappaB ligand. Diabetologia, 51(6), 1035–1040.doi:10.1007/s00125-008-0992-1

Manolakis, A. ., Kapsoritakis, A. ., Tiaka, E. ., Sidiropoulos, A., Gerovassili, A., Satra,M., … Vamvakopoulos, N. (2011). TLR4 gene polymorphisms: evidence forprotection against type 2 diabetes but not for diabetes-associated ischaemic heartdisease. European Journal of Endocrinology / European Federation of EndocrineSocieties, 165(2), 261–7. doi:10.1530/EJE-11-0280

Massy, Z. a, Mentaverri, R., Mozar, A., Brazier, M., & Kamel, S. (2008). Thepathophysiology of vascular calcification: are osteoclast-like cells the missinglink? Diabetes & Metabolism, 34 Suppl 1, S16–20. doi:10.1016/S1262-3636(08)70098-3

Matsumoto, T., Kobayashi, T., & Kamata, K. (2010). Diabetic conditions act asmatchmaker for monocytes and vascular smooth muscle cells. American Journal ofPhysiology. Heart Circ Physiol, 298(3), H731–3. doi:10.1152/ajpheart.01157.2009

Mitchell, G. F., Parise, H., Benjamin, E. J., Larson, M. G., Keyes, M. J., Vita, J. a, …Levy, D. (2004). Changes in arterial stiffness and wave reflection with advancingage in healthy men and women: the Framingham Heart Study. Hypertension,43(6), 1239–45. doi:10.1161/01.HYP.0000128420.01881.aa

Moe, S. M., & Chen, N. X. (2005). Inflammation and vascular calcification. BloodPurification, 23(1), 64–71. doi:10.1159/000082013

Moser, B., Wolf, M., Walz, A., & Loetscher, P. (2004). Chemokines: multiple levels ofleukocyte migration control. Trends in immunology, 25(2), 75–84.doi:10.1016/j.it.2003.12.005

Mozes, G., Keresztury, G., Kadar, a, Magyar, J., Sipos, B., Dzsinich, S., & Gloviczki,P. (1998). Atherosclerosis in amputated legs of patients with and without diabetesmellitus. International angiology : a journal of the International Union of

83

Angiology, 17(4), 282–6. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10204663

Ndip, A., Williams, A., Jude, E. B., & Serracino-inglott, F. (2011). TheRANKL/RANK/OPG Signaling Pathway Mediates Medial Arterial Calcificationin Diabetic Charcot Neuroarthropathy. Diabetes Journal, 60(8), 2187.

Nedkoff, L., Briffa, T. G., Knuiman, M., Hung, J., Norman, P. E., Hankey, G. J., …Hobbs, M. (2012). Temporal trends in the incidence and recurrence of hospitalisedatherothrombotic disease in an Australian population, 2000-07: data linkage study.Heart, 98(19), 1449–56. doi:10.1136/heartjnl-2012-302181

Newby, a C., & Zaltsman, a B. (1999). Fibrous cap formation or destruction--the criticalimportance of vascular smooth muscle cell proliferation, migration and matrixformation. Cardiovascular research, 41(2), 345–60. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10341834

Ngeh, J., Anand, V., & Gupta, S. (2002). Chlamydia pneumoniae and atherosclerosis --what we know and what we don’t. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and InfectiousDiseases, 8(1), 2–13. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/11906495

Nishio, Y., Dong, Y., Paris, M., O’Keefe, R. J., Schwarz, E. M., & Drissi, H. (2006).Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene, 372, 62–70.doi:10.1016/j.gene.2005.12.022

Norgren, L., Hiatt, W. R., Dormandy, J. a, Nehler, M. R., Harris, K. a, & Fowkes, F. G.R. (2007). Inter-Society Consensus for the Management of Peripheral ArterialDisease (TASC II). Journal of Vascular Surgery, 45 Suppl S, S5–67.doi:10.1016/j.jvs.2006.12.037

Norman, P. E., Eikelboom, J. W., & Hankey, G. J. (2004). Peripheral arterial disease:prognostic significance and prevention of atherothrombotic complications. TheMedical Journal of Australia, 181(3), 150–4. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/15287833

Panizo, S., Cardus, A., Encinas, M., Parisi, E., Valcheva, P., López-Ongil, S., …Valdivielso, J. M. (2009). RANKL increases vascular smooth muscle cellcalcification through a RANK-BMP4-dependent pathway. Circulation Research,104(9), 1041–8. doi:10.1161/CIRCRESAHA.108.189001

Parfitt, a M. (1984). The cellular basis of bone remodeling: the quantum conceptreexamined in light of recent advances in the cell biology of bone. Calcified TissueInternational, 36 Suppl 1, S37–45. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/6430521

Pasterkamp, G., Van Keulen, J. K., & De Kleijn, D. P. V. (2004). Role of Toll-likereceptor 4 in the initiation and progression of atherosclerotic disease. Europeanjournal of clinical investigation, 34(5), 328–34. doi:10.1111/j.1365-2362.2004.01338.x

84

Phinney, D. G., & Prockop, D. J. (2007). Concise review: mesenchymalstem/multipotent stromal cells: the state of transdifferentiation and modes of tissuerepair--current views. Stem cells (Dayton, Ohio), 25(11), 2896–902.doi:10.1634/stemcells.2007-0637

Plasschaert, H., Heeneman, S., & Daemen, M. J. (2009). Progression in atherosclerosis:histological features and pathophysiology of atherosclerotic lesions. Topics inmagnetic resonance imaging : TMRI, 20(4), 227–37.doi:10.1097/RMR.0b013e3181ea2869

Poulsen, M. K., Nybo, M., Dahl, J., Hosbond, S., Poulsen, T. S., Johansen, A., …Henriksen, J. E. (2011). Plasma osteoprotegerin is related to carotid and peripheralarterial disease, but not to myocardial ischemia in type 2 diabetes mellitus.Cardiovascular diabetology, 10(1), 76. doi:10.1186/1475-2840-10-76

Proudfoot, D., Skepper, J. N., Shanahan, C. M., & Weissberg, P. L. (1998).Calcification of Human Vascular Cells In Vitro Is Correlated With High Levels ofMatrix Gla Protein and Low Levels of Osteopontin Expression. Arteriosclerosis,Thrombosis, and Vascular Biology, 18(3), 379–388. doi:10.1161/01.ATV.18.3.379

Reinhard, H., Lajer, M., Gall, M.-A., & Tarnow, L. (2010). Osteoprotegerin andMortality in Type 2 Diabetic Patients. Diabetes Care, 33(12), 2561.doi:10.2337/dc10-0858.

Rödel, J., Woytas, M., Groh, a, Schmidt, K. H., Hartmann, M., Lehmann, M., &Straube, E. (2000). Production of basic fibroblast growth factor and interleukin 6by human smooth muscle cells following infection with Chlamydia pneumoniae.Infection and immunity, 68(6), 3635–41. Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=97653&tool=pmcentrez&rendertype=abstract

Roijers, R. B., Debernardi, N., Cleutjens, J. P. M., Schurgers, L. J., Mutsaers, P. H. a, &van der Vusse, G. J. (2011). Microcalcifications in early intimal lesions ofatherosclerotic human coronary arteries. The American journal of pathology,178(6), 2879–87. doi:10.1016/j.ajpath.2011.02.004

Rosenfeld, M. E., Blessing, E., Lin, T. M., Moazed, T. C., Campbell, L. a, & Kuo, C.(2000, June). Chlamydia, inflammation, and atherogenesis. The Journal ofinfectious diseases. doi:10.1086/315618

Ross, R. (1999). Atherosclerosis-An inflammatory disease. The New England Journalof Medicine, 340(2), 115–126.

Saitoh, Y., Koizumi, K., Sakurai, H., Minami, T., & Saiki, I. (2007). RANKL-induceddown-regulation of CX3CR1 via PI3K/Akt signaling pathway suppressesFractalkine/CX3CL1-induced cellular responses in RAW264.7 cells. Biochemicaland Biophysical Research Communications, 364(3), 417–22.doi:10.1016/j.bbrc.2007.09.137

Salabei, J. K., Cummins, T. D., Singh, M., Jones, S. P., Bhatnagar, A., & Hill, B. G.(2013). PDGF-mediated autophagy regulates vascular smooth muscle cell

85

phenotype and resistance to oxidative stress. The Biochemical journal, 451(3),375–88. doi:10.1042/BJ20121344

Sangiorgi, G., Rumberger, J. a, Severson, a, Edwards, W. D., Gregoire, J., Fitzpatrick,L. a, & Schwartz, R. S. (1998). Arterial calcification and not lumen stenosis ishighly correlated with atherosclerotic plaque burden in humans: a histologic studyof 723 coronary artery segments using nondecalcifying methodology. Journal ofthe American College of Cardiology, 31(1), 126–33. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/9426030

Schoppet, M., Al-Fakhri, N., Franke, F. E., Katz, N., Barth, P. J., Maisch, B., …Hofbauer, L. C. (2004). Localization of osteoprotegerin, tumor necrosis factor-related apoptosis-inducing ligand, and receptor activator of nuclear factor-kappaBligand in Mönckeberg’s sclerosis and atherosclerosis. The Journal of clinicalendocrinology and metabolism, 89(8), 4104–12. doi:10.1210/jc.2003-031432

Secchiero, P., Corallini, F., Pandolfi, A., Consoli, A., Candido, R., Fabris, B., … Zauli,G. (2006). An increased osteoprotegerin serum release characterizes the early onsetof diabetes mellitus and may contribute to endothelial cell dysfunction. TheAmerican Journal of Pathology, 169(6), 2236–44. doi:10.2353/ajpath.2006.060398

Shanahan, C. M., Cary, N. R. B., Salisbury, J. R., Proudfoot, D., Weissberg, P. L., &Edmonds, M. E. (1999). Medial Localization of Mineralization-RegulatingProteins in Association With Monckeberg s Sclerosis : Evidence for Smooth Muscle Cell-Mediated Vascular Calcification. Circulation, 100(21), 2168–2176.doi:10.1161/01.CIR.100.21.2168

Shi, Q., Cox, L., Glenn, J., Tejero, M. E., Hodara, V., VandeBerg, J. L., & Wang, X. L.(2010). Molecular pathways mediating differential responses to lipopolysaccharidebetween human and baboon arterial endothelial cells. Clin Exp PharmacolPhysiol., 37(2), 178–184. doi:10.1111/j.1440-1681.2009.05260.x.MOLECULAR

Soor, G. S., Vukin, I., Leong, S. W., Oreopoulos, G., & Butany, J. (2008). Peripheralvascular disease: who gets it and why? A histomorphological analysis of 261arterial segments from 58 cases. Pathology, 40(4), 385–391.doi:10.1080/00313020802036764

Speer, M. Y., Yang, H.-Y., Brabb, T., Leaf, E., Look, A., Lin, W.-L., … Giachelli, C.M. (2009). Smooth muscle cells give rise to osteochondrogenic precursors andchondrocytes in calcifying arteries. Circulation research, 104(6), 733–41.doi:10.1161/CIRCRESAHA.108.183053

Spirig, R., Tsui, J., & Shaw, S. (2012). The Emerging Role of TLR and InnateImmunity in Cardiovascular Disease. Cardiology research and practice, 2012,181394. doi:10.1155/2012/181394

Steitz, S. a., Speer, M. Y., Curinga, G., Yang, H.-Y., Haynes, P., Aebersold, R., …Giachelli, C. M. (2001). Smooth muscle cell phenotypic transition associated withcalcification: ppregulation of Cbfa1 and downregulation of smooth muscle lineagemarkers. Circulation Research, 89(12), 1147–1154. doi:10.1161/hh2401.101070

86

Stoll, L. L., Denning, G. M., Li, W., James, B., Harrelson, A. L., Romig, S. A., …Weintraub, N. L. (2004). Regulation of endotoxin-induced proinflammatoryactivation in human coronary artery cells: Expression of functional membrane-bound CD14 by Human Coronary Artery Smooth Muscle Cells. The Journal ofImmunology, 173, 1336–1343.

Stöllberger, C., & Finsterer, J. (2002). Role of infectious and immune factors incoronary and cerebrovascular arteriosclerosis. Clinical and Diagnostic LaboratoryImmunology, 9(2), 207–215. doi:10.1128/CDLI.9.2.207

Tang, Z., Wang, A., Yuan, F., Yan, Z., Liu, B., Chu, J. S., … Li, S. (2012).Differentiation of multipotent vascular stem cells contributes to vascular diseases.Nature communications, 3, 875. doi:10.1038/ncomms1867

Tervaert, J. W. C. (2009). Translational mini-review series on immunology of vasculardisease: accelerated atherosclerosis in vasculitis. Clinical and experimentalimmunology, 156(3), 377–85. doi:10.1111/j.1365-2249.2009.03885.x

Thomas, M., Wong, Y., Thomas, D., Ajaz, M., Tsang, V., Gallagher, P. J., & Ward, M.E. (1999). Relation Between Direct Detection of Chlamydia pneumoniae DNA inHuman Coronary Arteries at Postmortem Examination and Histological Severity(Stary Grading) of Associated Atherosclerotic Plaque. Circulation, 99(21), 2733–2736. doi:10.1161/01.CIR.99.21.2733

Umehara, H., Bloom, E. T., Okazaki, T., Nagano, Y., Yoshie, O., & Imai, T. (2004).Fractalkine in vascular biology: from basic research to clinical disease.Arteriosclerosis Thrombosis and Vascular Biology, 24(1), 34–40. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12969992

Vattikuti, R., & Towler, D. a. (2004). Osteogenic regulation of vascular calcification: anearly perspective. American Journal of Physiology. Endocrinology andMetabolism, 286(5), E686–96. doi:10.1152/ajpendo.00552.2003

Vukovic, I., Arsenijevic, N., Lackovic, V., & Todorovic, V. (2006). The origin anddifferentiation potential of smooth muscle cells in coronary atherosclerosis.Experimental and Clinical Cardiology, 11(2), 123–8. Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2274860&tool=pmcentrez&rendertype=abstract

Wada, T., McKee, M. D., Steitz, S., & Giachelli, C. M. (1999). Calcification ofVascular Smooth Muscle Cell Cultures : Inhibition by Osteopontin. Circ. Res.,84(2), 166–178. doi:10.1161/01.RES.84.2.166

Ward, M. R., Pasterkamp, G., Yeung, a. C., & Borst, C. (2000). Arterial Remodeling : Mechanisms and Clinical Implications. Circulation, 102(10), 1186–1191.doi:10.1161/01.CIR.102.10.1186

Wattanakit, K., Folsom, A. R., Selvin, E., Weatherley, B. D., Pankow, J. S., Brancati, F.L., & Hirsch, A. T. (2005). Risk factors for peripheral arterial disease incidence inpersons with diabetes: the Atherosclerosis Risk in Communities (ARIC) Study.Atherosclerosis, 180(2), 389–97. doi:10.1016/j.atherosclerosis.2004.11.024

87

Weitzmann, M. N., & Pacifici, R. (2006). Estrogen deficiency and bone loss : an inflammatory tale. The Journal of Cinical Investigation, 116(5), 1186.doi:10.1172/JCI28550.1186

Wong, B. W. C., Wong, D., & McManus, B. M. (2002). Characterization of fractalkine(CX3CL1) and CX3CR1 in human coronary arteries with native atherosclerosis,diabetes mellitus, and transplant vascular disease. Cardiovascular Pathology. TheOfficial Journal of the Society for Cardiovascular Pathology, 11(6), 332–338.Retrieved fromhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12459434

Yoshiba, N., Yoshiba, K., & Ohkura, N. (2012). Immunohistochemical analysis of twostem cell markers of a-smooth muscle actin and STRO-1 during wound healing ofhuman dental pulp. Histochem Cell Biol, 138, 583–592. doi:10.1007/s00418-012-0978-4

Yuan, Y. Y., Kostenuik, P. J., Ominsky, M. S., Morony, S., Adamu, S., Simionescu, D.T., … Bateman, T. a. (2008). Skeletal deterioration induced by RANKL infusion: amodel for high-turnover bone disease. Osteoporosis International : A journal established as result of cooperation between the European Foundation forOsteoporosis and the National Osteoporosis Foundation of the USA, 19(5), 625–35. doi:10.1007/s00198-007-0509-7

Zhang, S., Wang, X., Zhang, L., Yang, X., Pan, J., & Ren, G. (2011). Characterizationof monocyte chemoattractant proteins and CC chemokine receptor 2 expressionduring atherogenesis in apolipoprotein E-null mice. Journal of Atherosclerosis andThrombosis, 18(10), 846–56. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/21712615

Ziegler, S., Kudlacek, S., Luger, A., & Minar, E. (2005). Osteoprotegerin plasmaconcentrations correlate with severity of peripheral artery disease. Atherosclerosis,182(1), 175–80. doi:10.1016/j.atherosclerosis.2005.01.042

Zulli, A., Buxton, B. F., Merrilees, M., & Hare, D. L. (2008). Human diseased arteriescontain cells expressing leukocytic and embryonic stem cell markers. HumanPathology, 39(5), 657–65. doi:10.1016/j.humpath.2007.09.022

88

Appendix I

89

Information and Consent for Blood/Tissue/DNA (Genetic)Collection, Storage and Testing for Research

The role of inflammatory factors in peripheral arterial disease

REQUIREMENTS OF STUDY: (this form to be completed by Researcher)

In general, the South Metropolitan Area Health Service Human Research EthicsCommittee requires that the collection, use and storage of blood/tissue/DNAsamples be conducted in accordance with the NHMRC National Statement onEthical Conduct in Human Research (2007) and the Guidelines for Genetic Registersand Associated Genetic Material (2000).

Accordingly, in this study patients’ samples will be used in the following ways(these are to be explained to the patient by the study nurse or doctor):

A. SPECIFICITY OF RESEARCH

1. Samples will be used only for the purposes specified for thisstudy:

Yes

2. Samples will be used for other unspecified research purposes: No

B. STORAGE OF SAMPLES

1. Place of storage:The School of Anatomy and Human Biology, University of Western Australia

2. Body responsible for storage procedures:Professor Luis Figueria of the School of Anatomy and Human Biology, University ofWestern Australia

3. Contact details for patient use to arrange for retrieval or destruction of samples, orto obtain information about results:Professor Paul Norman, UWA School of Surgery, Fremantle Hospital. Tel:0894312500. Fax: 0894312623.

4. Duration of storage:

current storage for specific use: Yes

90

long-term storage for specific use: Yes

long-term storage for unspecified use: No

5. Can stored samples and information be traced back (directly orindirectly) to the patient?

(If the answer to 5 is “No” then all answers to “C” must be “No”)

No

C. ACCESS TO SAMPLES AND RESEARCH RESULTS

1. Will the patient be able to receive results of their testing? No

2 . Will the patient be able to retrieve/destroy samples if theywithdraw from the study or wish to at a later date?

No

3. Could future testing of the sample reveal paternity/maternity? No

4. Will the test results be available to family members?

Upon the patient’s request No

Upon the family’s request No

Under any other circumstances (specify) No

CONSENT

I, ___________________________________of _____________________________________

______________________________________________________________________________

have read and understand the nature of this study as stated in the above details.The Information and any questions I have asked have been answered to mysatisfaction.

91

............………………………………… ……………………..…………. ……...............Name of Patient Signature of Patient Date

……………………………………........ ..……………………………….. ...........………..

Name of Witness to Patient Signature Signature of WitnessDate

..………………………………………… .………………................…….. ...............………Name of Investigator Signature of Investigator Date

* The NHMRC advises the Australian community and Commonwealth and State Governments onstandards of individual and public health, and supports research to improve those standards.

The South Metropolitan Area Health Service Human Research Ethics Committee has given ethicsapproval for the conduct of this project. If you have any ethical concerns you can contact the Chairof the Human Research Ethics Committee on (08) 9431 2929. All study participants will beprovided with a copy of the Information Sheet and Consent Form for their personal records.

92

SOUTH METROPOLITAN HEALTH SERVICE

FREMANTLE HOSPITAL

PATIENT INFORMATION SHEET

The role of inflammatory factors in peripheral arterial disease

Investigator: PROFESSOR PAUL NORMAN

INTRODUCTION

We invite you to participate in a research project which we believe is of potential

importance. However, before you decide whether or not you wish to participate, we

need to be sure that you understand why we are doing the research and what it would

involve if you agreed.

Please read this information carefully and be sure to ask any questions you have. The

doctor conducting the research will be happy to discuss it with you and to answer any

questions. You are free to discuss it with other people if you wish (i.e. family, friends

and/or your local doctor).

Your participation is purely voluntary and you are under no pressure to participate.

Should you agree to enter the study, you may change your mind and withdraw at any

stage.

This study has been approved by the South Metropolitan Area Health Service Human

Research Ethics Committee. This study is under the direction of Professor Paul

Norman, one of the Vascular Surgeons at Fremantle Hospital.

1. WHAT IS THE PURPOSE OF THIS STUDY?

Hardening of the arteries (atherosclerosis) may cause severe lower limb problems

including ulcers and gangrene. This is due to blockages of the main arteries that supply

blood to the legs. In some cases, particularly in patients with diabetes, the only leg

arteries that are diseased are those in the calf - these are called the tibial arteries. The

reason why these arteries are particularly prone to damage by diabetes, often in the

absence of blockages in other arteries, is unknown. Another feature of diabetes is

nerve damage (peripheral neuropathy) and abnormalities in the skin circulation. It is

unclear how important the neuropathy and the skin changes are in making the

circulation in the foot so bad that an amputation is needed. This research aims to

93

compare the tibial arteries and nerves and the skin in patients with and without

diabetes in order to find out more about the changes that result in poor circulation.

2. WHAT DOES PARTICIPATION IN THIS RESEARCH PROJECT INVOLVE?

The vascular surgeon looking after you has recommended that you need an

amputation of your leg. This is because of severe arterial disease resulting in loss of

blood supply to the foot or leg. In your case this may or may not be due to diabetes.

The nature and level of amputation and the possible complications will be described

separately by the team looking after you. We are seeking your consent to the following:

(a) obtain some basic information from your hospital records about your health – this

includes information such as age, medical history, medication history and whether you

have been a smoker; some routine blood test results (eg blood sugar) and the reports

of scans (CT, MR or ultrasound) of your arteries (if available).

(b) after the amputation, remove a 10cm length of a tibial artery, a 5cm length of nerve,

a 2cm ellipse of skin from calf part of your leg and the tip of a toe. These samples will

be removed from the leg after it has been amputated. This does not affect your

operation in any way.

(c) take a 10ml (~one tablespoon) sample of blood from a vein in your arm. If at all

possible this will be done at the same time as routine blood tests, thereby avoiding an

extra needle.

3. WHAT WILL HAPPEN TO MY INFORMATION AND SAMPLES?

Only information necessary for the purposes of the study will be collected by the

researchers. This information includes your: age, medical history and diagnosis,

smoking history, current medications, results of X-rays and scans of your arteries,

routine blood test results any medical procedures that you undergo. All information

collected will be confidential and will be labelled with a code number and not your

name. Only Professor Norman will know your name. You can request to have access

to information collected and held about you during the study by contacting Professor

Norman (on 94312500). You may request that any incorrect personal data be

corrected.

The samples of artery, nerve, skin and blood will be taken to a laboratory in the School

of Anatomy and Human Biology at the University of Western Australia. The samples

will be identified by a number only and your name will not appear on them. The

samples will be studied by a PhD Student (Rasheeda Zamin) using a range of

laboratory techniques including examination under a microscope and the measurement

of various molecules relevant to arterial disease. The blood sample will be used to

94

measure the concentration of certain proteins that may be relevant to arterial disease.

It will not be possible to make the results of any of these laboratory tests available to

you as your name will be removed from all samples.

4. WHAT ARE THE POSSIBLE BENEFITS?

There are no specific benefits for you personally. You will not receive any form of

payment for participation in this study. If successful, the research may help explain why

the calf arteries become so diseased in patients with diabetes. This has the potential to

help a future patient avoid an amputation.

5. WHAT ARE THE POSSIBLE DISCOMFORTS AND RISKS?

The removal of samples of artery, nerve and skin from the leg after amputation is of no

risk to you personally. Taking a blood sample from a vein in your arm may be

associated with a small risk of bruising.

6. CAN I HAVE OTHER TREATMENTS DURING THIS RESEARCH PROJECT?

The research will not alter your usual treatment in any way.

7. HOW WILL I BE INFORMED OF THE RESULTS OF THIS RESEARCH

PROJECT?

The results from individual patients are only analysed as part of the whole study and

your personal results will not be made available. Any published results of the study can

be obtained from the researchers (Professor Paul Norman) on request. Publication

may not occur for several years. When the results of the study are published,

participant data will be de-identified and all results supplied will be grouped. This

means that it will not be possible to identify individual participants from the results. As

part of West Australian law regarding research, all information about this study and its

participants will be kept for a minimum of 15 years.

8. WHAT IF I WITHDRAW FROM THIS RESEARCH PROJECT?

This study is entirely voluntary and you will be given time to decide whether you wish to

participate. If you do not wish to take part you don’t have to. If you decide to take part

and later change your mind, you are free to withdraw from the project at any stage

without having to give any reasons. However, once your name has been removed from

tissue (artery, skin, nerve and blood) samples it will no longer be possible to discard

your samples. Your decision whether to take part or not, or to take part and then

withdraw will not affect your current or future treatment. If you decide to withdraw,

95

please notify your vascular surgeon or Professor Paul Norman via nursing or medical

staff looking after you on the ward.

9. WHAT ARE MY RIGHTS?

If you choose to participate and you become injured in this study and your injury is a

direct result of the effects of the study procedures, Fremantle Hospital will provide

reasonable medical treatment. By participating in this study, your normal legal rights

under common law will not be affected.

Your study doctor and colleagues are available to answer any questions you may have

regarding the treatment described or the study procedures. If you have any questions

regarding this research trial, you may contact:

PROFESSOR PAUL NORMAN on 9431 2500 or via nursing staff on the ward

The South Metropolitan Area Health Service (SMAHS) Human Research Ethics

Committee has approved this study. Should you wish to speak to a person not directly

involved in the study in relation to

matters concerning policies,

information about the conduct of the study,

your rights as participant, or

should you wish to make a confidential complaint, you may contact Chairman of this

Committee, on 9431 2929.

As a participant in this study you will be provided with a copy of the Information Sheet and

Consent Form for your personal records if requested.

96

FREMANTLE HOSPITAL PATIENT CONSENT FORMThe role of inflammatory factors in peripheral arterial disease

Investigator: PROFESSOR PAUL NORMAN

I, the undersigned (print name)________________________________________

hereby consent to my involvement in the research project explained above.

I am over 18 years of age. I have read the information sheet entitled ‘The role of

inflammatory factors in peripheral arterial disease’, and I understand the

reasons for this study.

The details of the study have been explained to me by Professor Norman,

including:

The nature of the procedures being performed

Any risks or discomforts which I may experience

My questions have been answered to my satisfaction.

My consent is given voluntarily.

I understand I am free to withdraw from the study at any time without having to

give a reason, and without my medical care or legal rights being affected.

I understand that my tissue samples cannot be withdrawn once my name has

been removed from them.

I understand that the information in my medical records is essential to evaluate

the results of this study. I agree to the release of this information to the research

staff and on the understanding that it will be treated confidentially. I understand

that I will not be referred to by name in any report concerning this study. In turn,

I cannot restrict in any way the use of the results that arise from this study.

I understand that my normal legal rights to compensation under common law

will not be affected by participating in this study.

I understand that the purpose of this research project is to improve the quality of

medical care, but my involvement may not be of benefit to me.

I have been given the opportunity to have a member of family or a friend

present while the project was explained to me.

SIGNED DATE

WITNESSINVESTIGATOR

97

Appendix II

Figure 1 Stacked bar graphs demonstrating the number of samples (and sections per artery) and

subjective evaluation of PCR positivity by the C. pneumoniae-species specific PCR assay by Adam

Polkinghornes’ group (unpublished data). PCR (polymerase chain reaction).

98

Appendix IIITable 1. Non-diabetic PAD arterial samples assessed for CP detection using IF

(immunofluorescence) and PCR (polymerase chain reaction).

No. Sample ID Positive

sections tested

for IF

Positive sections

tested for PCR

Total sections

tested for PCR

1 P3 POP 0 3 4

2 P3 FIB 0 1 3

3 P3 ATA 0 0 2

4 P4 POP 1 1 5

5 P4 PTA 1 0 1

6 P10 ATA 1 1 4

7 P10 POP 1 0 3

8 P10 DPA 1 1 3

9 P10 PTA 1 2 3

Total positives 6 9 28

Positive (%) 67% 32%

Table 2. Diabetic PAD arterial samples assessed for CP detection using IF

(immunofluorescence) and PCR (polymerase chain reaction).

No. Sample ID Positive

sections tested

for IF

Positive sections

tested for PCR

Total sections

tested for PCR

1 P1 PTA 1 1 4

2 P1 POP 1 0 3

3 P2 ATA 1 2 4

4 P9 PTA 0 0 4

5 P9 POP 0 0 4

6 P9 ATA 0 0 3

Total positives 3 3 22

Positive (%) 50% 14%

99