Enhancing the efficiency of cell-free protein synthesis

system by systematic titration of transcription and

translation componentsYuchen Zhang1, Qianyin Huang2, Zixin Deng1, Yancheng Xu2,

Tiangang Liu1 *

1Key laboratory of Combinatorial Biosynthesis and Drug Discovery, Ministry of Education and Wuhan University School of Pharmaceutical Sciences, Wuhan 430071, China2Department of Endocrinology, Zhongnan Hospital of Wuhan University, Wuhan 430071, China

*Correspondence: Tiangang Liu, School of Pharmaceutical Sciences, Wuhan University, Wuhan 430071, PR China

E-mail address: liutg@whu.edu.cn

Supplementary Information

Supplementary Figures S1-S3Supplementary Table S1 and S2

Appendix S1

1

2

3

456789101112131415161718

19

202122232425262728293031323334353637383940

Figure S1. SDS-PAGE analysis of purified components used in this study.

4142434445464748495051525354555657585960616263646566676869707172737475767778798081828384

Figure S2. Standard curves of protein concentrations vs. fluorescent intensity (arbitrary unit A.u.). The curves were

established with purified proteins whose concentrations were measured using a Pierce BCA protein assay kit.

858687888990919293949596979899100101102103104105106107108109110111112113114115116117118119120121122123124125126127128

Figure S3. Comparison of eGFP production in CFPS system using different expression vectors and the sfGFP

production in CFPS system using the pJL1-sfGFP plasmid.

129

130131132133134135136137138139140141142143144145146147148149150151152153154

Table S1. Strains and plasmids used in this study.

E. coli Strains Description Reference

BL21(DE3) E. coli B dcmompThsdS(rB-mB

-) gal Invitrogen

M15（pREP4） E. colilac ara gal mtlrecA+ uvr+ [pREP4lacIkanaR] Qiagen

Plasmids Description Source organism Reference

pQE30-AlaRS N-terminal His-tagged AlaRS, inserted between SphI

and HindIII sites of pQE30

Escherichia coli This study

pQE30-AsnRS N-terminal His-tagged AsnRS, inserted

betweenBamHI and HindIII sites of pQE30

Escherichia coli This study

pQE30-ThrRS N-terminal His-tagged ThrRS, inserted

betweenBamHI and HindIII sites of pQE30)

Escherichia coli This study

pQE30-IF1 N-terminal His-tagged IF1, inserted betweenBamHI

and HindIII sites of pQE30))

Escherichia coli This study

pQE30-IF2 N-terminal His-tagged IF2, inserted betweenBamHI

and HindIII sites of pQE30)

Escherichia coli This study

pQE30-IF3 N-terminal His-tagged IF3, inserted betweenBamHI

and HindIII sites of pQE30)

Escherichia coli This study

pQE30-RF3 N-terminal His-tagged RF3, inserted betweenBamHI

and HindIII sites of pQE30)

Escherichia coli This study

pQE60-tufA C-terminal His-tagged tufA, inserted between NcoI

and BglII sites of pQE60

Escherichia coli This study

pQE60-EFTS C-terminal His-tagged EF-Ts, inserted between NcoI

and BglII sites of pQE60

Escherichia coli This study

pQE60-RRF C-terminal His-tagged RRF, inserted between NcoI

and BamHI sites of pQE60

Escherichia coli This study

pQE70-EFG C-terminal His-tagged EF-G, inserted between SphI

and BglII sites of pQE70

Escherichia coli This study

pQE70-tufB C-terminal His-tagged tufB, inserted between SphI

and BglII sites of pQE70

Escherichia coli This study

pET28-ArgRS Both N and C terminal His-tagged ArgRS, inserted

between NdeI and BamHI sites of pET28a(+)

Escherichia coli This study

pET28-T7RNAP Both N and C terminal His-tagged T7-RNAP, inserted

between NheI and XhoI sites of pET28a(+)

T7 phage This study

pET28-RF2 C-terminal His-tagged RF2, inserted between NcoI

and XhoI sites of pET28a(+)

Escherichia coli This study

pET21-AspRS C-terminal His-tagged AspRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-CysRS C-terminal His-tagged CysRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-GlnRS C-terminal His-tagged GlnRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-GluRS C-terminal His-tagged GluRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

155

pET21-GlyQ C-terminal His-tagged GlyQ, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-GlyS C-terminal His-tagged GlyS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-HisRS C-terminal His-tagged HisRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-IleRS C-terminal His-tagged IleRS, inserted between NdeI

and HindIII sites of pET21a(+)

Escherichia coli This study

pET21-LeuRS C-terminal His-tagged LeuRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-LysRS C-terminal His-tagged LysRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-MetRS C-terminal His-tagged MetRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-ProRS C-terminal His-tagged ProRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-SerRS C-terminal His-tagged SerRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-TrpRS C-terminal His-tagged TrpRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-TyrRS C-terminal His-tagged TyrRS, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

pET21-MTF C-terminal His-tagged MTF, inserted between NdeI

and XhoI sites of pET21a(+)

Escherichia coli This study

RNA Helicase C-terminal His-tagged RF2, inserted between NcoI

and XhoI sites of pET28a(+)

Escherichia coli This study

156157158159160161162163164165166167168169170171172

Table S2. Purified proteins used in this study.

Name Description Source organism Reference

AlaRS Alanine-tRNA ligase Escherichia coli This study

ArgRS Arginine-tRNA ligase Escherichia coli This study

AsnRS Asparagine-tRNA ligase Escherichia coli This study

AspRS Aspartate-tRNA ligase Escherichia coli This study

CysRS Cysteine-tRNA ligase Escherichia coli This study

GlnRS Glutamine-tRNA ligase Escherichia coli This study

GluRS Glutamate-tRNA ligase Escherichia coli This study

GlyQ Glycine-tRNA ligase alpha subunit Escherichia coli This study

GlyS Glycine-tRNA ligase beta subunit Escherichia coli This study

HisRS Histidine-tRNA ligase Escherichia coli This study

IleRS Isoleucine-tRNA ligase Escherichia coli This study

LeuRS Leucine-tRNA ligase Escherichia coli This study

LysRS Lysine-tRNA ligase Escherichia coli This study

MetRS Methionine-tRNA ligase Escherichia coli This study

ProRS Proline-tRNA ligase Escherichia coli This study

SerRS Serine-tRNA ligase Escherichia coli This study

ThrRS Threonine-tRNA ligase Escherichia coli This study

TrpRS Tryptophan-tRNA ligase Escherichia coli This study

TyrRS Tyrosine-tRNA ligase Escherichia coli This study

T7-RNAP T7 RNA polymerase Escherichia coli This study

MTF Methionyl-tRNAfolmyltransferase Escherichia coli This study

IF1 Translation initiation factor IF-1 Escherichia coli This study

IF2 Translation initiation factor IF-2 Escherichia coli This study

IF3 Translation initiation factor IF-3 Escherichia coli This study

EF-G Elongation factor G Escherichia coli This study

tufA Elongation factor Tu 1 Escherichia coli This study

tufB Elongation factor Tu 2 Escherichia coli This study

EF-Ts Elongation factor Ts Escherichia coli This study

RF2 Peptide chain release factor RF2 Escherichia coli This study

RF3 Peptide chain release factor RF3 Escherichia coli This study

RRF Ribosome-recycling factor Escherichia coli This study

RNA Helicase RNA helicase Escherichia coli This study

173174

175176177178179180181

Appendix S1. Synthesized DNA sequences used in this study

eGFP gene

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAAC

GGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCT

GCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAG

CCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGC

ACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGA

ACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTA

CAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAA

CATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCT

GCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATG

GTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

sfGFP gene

ATGCGTAAAGGCGAGGAACTGTTCACCGGTGTGGTTCCGATCCTGGTGGAGCTGGACGGCGATGTTAACGGTCA

CAAGTTTAGCGTGCGTGGCGAGGGCGAAGGTGACGCGACCAACGGCAAGCTGACCCTGAAATTCATTTGCACC

ACCGGTAAACTGCCGGTGCCGTGGCCGACCCTGGTTACCACCCTGACCTACGGTGTGCAGTGCTTTGCGCGTTA

TCCGGACCACATGAAGCAACACGATTTCTTTAAAAGCGCGATGCCGGAGGGCTACGTTCAGGAACGTACCATCA

GCTTCAAGGACGATGGTACCTATAAAACCCGTGCGGAAGTGAAGTTTGAAGGCGACACCCTGGTTAACCGTATCG

AGCTGAAGGGTATTGACTTCAAAGAAGATGGCAACATCCTGGGTCACAAGCTGGAGTACAACTTTAACAGCCACA

ACGTTTATATTACCGCGGATAAGCAGAAAAACGGCATCAAGGCGAACTTTAAAATTCGTCACAACGTGGAAGACG

GTAGCGTTCAACTGGCGGATCACTACCAGCAAAACACCCCGATCGGTGACGGTCCGGTGCTGCTGCCGGATAAC

CACTATCTGAGCACCCAAAGCGTTCTGAGCAAGGACCCGAACGAGAAACGTGATCACATGGTGCTGCTGGAATT

CGTTACCGCGGCGGGCATTACCCACGGTATGGATGAACTGTACAAATAATAA

Pins-eGFP gene

ATGTTTGTTAATCAACATTTGTGTGGTTCTCATCTTGTTGAAGCTCTTTATCTTGTTTGTGGTGAACGTGGATTTTTC

TATACACCAAAAACTCGTAGAGAAGCAGAAGATTTGCAAGTTGGACAAGTTGAATTAGGAGGTGGACCAGGTGCT

GGAAGTCTTCAACCTTTGGCATTAGAAGGTTCATTACAAAAAAGAGGAATTGTTGAACAATGTTGTACATCAATTTG

TTCTCTTTATCAATTGGAAAATTATTGTAATCCTAGTTGTAGTAGTCCTAGTCCTATGGTGAGCAAGGGCGAGGAGC

TGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGG

CGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTG

CCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGC

AGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC

AACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCG

ACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGG

CCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCT

CGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGC

ACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCG

CCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

182183184185186187188189190191192193194195196197198199200201202203204205206207208209210211212213214215216217218219220221222223