Ad

JGa

b

a

ARRA

KAMCII

I

srr2abatpt

cG

C((

h1

International Journal of Medical Microbiology 304 (2014) 1209–1217

Contents lists available at ScienceDirect

International Journal of Medical Microbiology

j ourna l h o mepage: www.elsev ier .com/ locate / i jmm

rcobacter butzleri induces a pro-inflammatory response in THP-1erived macrophages and has limited ability for intracellular survival

ennifer zur Brueggea,∗, Carlos Hanischa, Ralf Einspaniera, Thomas Alterb,reta Gölzb, Soroush Sharbati a,∗

Institute of Veterinary Biochemistry, Department of Veterinary Medicine, Freie Universität Berlin, Oertzenweg 19b, 14163 Berlin, GermanyInstitute of Food Hygiene, Department of Veterinary Medicine, Freie Universität Berlin, Königsweg 69, 14163 Berlin, Germany

r t i c l e i n f o

rticle history:eceived 25 April 2014eceived in revised form 29 August 2014ccepted 30 August 2014

eywords:rcobacter butzleriacrophages

aspase acivationnflammation

a b s t r a c t

Recent case reports have identified Arcobacter (A.) butzleri to be another emerging pathogen of the fam-ily Campylobacteraceae causing foodborne diseases. However, little is known about its interaction withthe human immune system. As macrophages act as first defense against bacterial infections, we studiedfor the first time the impact of A. butzleri on human macrophages using THP-1 derived macrophagesas an in vitro infection model. Our investigations considered the inflammatory response, intracellularsurvival and activation of caspases as potential virulence mechanisms employed by A. butzleri. Induc-tion of IL-1�, IL-1ß, IL-6, IL-8, IL-12ß and TNF� demonstrated a pro-inflammatory response of infectedmacrophages towards A. butzleri. gentamycin protection assays revealed the ability of A. butzleri strainsto survive and resist the hostile environment of phagocytic immune cells for up to 22 h. Moreover, initial

ntracellular survival activation of intitiator- (CASP8) as well as effector caspases (CASP3/7) was observed without the onsetof DNA damage, suggesting a potential counter regulation. Intriguingly, we recognized distinct strainspecific differences in invasion and survival capabilities. This suggests the existence of isolate dependentphenotype variations and different virulence potentials as known for other intestinal pathogens such asSalmonella enterica ssp.

© 2014 Elsevier GmbH. All rights reserved.

ntroduction

Severe gastroenteritis has many origins. However, certain sub-pecies of Campylobacteraceae such as Campylobacter (C.) jejuni areecognized to be predominant pathogens in the etiology of bacte-ial gastroenteritis in industrialized countries (Acheson and Allos,001). Recent case reports suggest Arcobacter (A.) butzleri to benother emerging pathogen of this family causing food- and water-orne diseases (Lappi et al., 2013), (Lehner et al., 2005) with waterynd persistent diarrhea as typical characteristics of infection. Con-

aminated and undercooked meat products, mainly poultry andork, as well as polluted water constitute the main source of infec-ion (Collado and Figueras, 2011; Rivas et al., 2004). Arcobacter spp.

∗ Corresponding authors at: Freie Universität Berlin, Institute of Veterinary Bio-hemistry, Department of Veterinary Medicine, Oertzenweg 19b, 14163 Berlin,ermany. Tel.: +49 30 838 62225.

E-mail addresses: Jennifer.zur.Bruegge@fu-berlin.de (J.z. Bruegge),arlos.Hanisch@fu-berlin.de (C. Hanisch), Ralf.Einspanier@fu-berlin.deR. Einspanier), Thomas.Alter@fu-berlin.de (T. Alter), Greta.Goelz@fu-berlin.deG. Gölz), soroush.sharbati@fu-berlin.de (S. Sharbati).

ttp://dx.doi.org/10.1016/j.ijmm.2014.08.017438-4221/© 2014 Elsevier GmbH. All rights reserved.

are gram-negative, spiral shaped motile bacteria which were firstisolated from aborted bovine fetuses in 1977 (Ellis et al., 1977) andredefined to a new genus in 1991 (Vandamme and Ley, 1991). Sincethen different Arcobacter spp. have been isolated from stool samplesof human patients suffering from diarrhea with A. butzleri being thepredominant one associated with disease (Vandenberg et al., 2004).Additionally, there are single reports of peritonitis and bacteremia(Lau, 2002; On et al., 1995). However, the role of A. butzleri in thepathogenesis of bacterial gastroenteritis is still not clear and due tothe lack of routine diagnostic and standardized isolation and iden-tification methods the incidence of A. butzleri associated diseasescannot be properly evaluated (Vandenberg et al., 2004; Colladoand Figueras, 2011). The prevalence of Arcobacter spp. among diar-rheic patients was investigated in different studies throughout theworld and was reviewed by Figueras et al. It ranged from 0.1 to 13%,with A. butzleri being the most prevalent one, and highly dependedon the identification method (0.1–1.25% with culturing methods,

0.4–13% with PCR techniques) (Figueras et al., 2014). Houf andStephan examined the presence and characteristics of Arcobacterspp. in feces of asymptomatic humans in Switzerland and foundA. cryoaerophilus to be the only Arcobacter species present (1.4%

1 f Medical Microbiology 304 (2014) 1209–1217

o2

AtfPwohHbjarpiiepib2

rweamdadotiBdvmit2liavt2o(tifaimw

diiolauT

Table 1Bacterial strains used in this study.

Strain Source Supplier

A. butzleri CCUG30485(type strain)

Human isolatereference strain

Culture CollectionUniversity of Göteborg,Sweden

A. butzleri F0 also ref. toas FR1, H2

Human isolate NRZ Helicobacter,National ReferenceCentre for Helicobacterpylori; UniversityMedical CenterFreiburg, Germany

A. butzleri 88 Chicken meat isolate Bavarian Health andFood Safety Authority,Oberschleißheim,Germany

A. butzleri 89 Chicken meat isolate Bavarian Health andFood Safety Authority,Oberschleißheim,Germany

A. butzleri 94 Chicken meat isolate Bavarian Health andFood Safety Authority,Oberschleißheim,Germany

A. butzleri 102 Pork isolate Bavarian Health andFood Safety Authority,Oberschleißheim,

210 J.z. Bruegge et al. / International Journal o

f the samples). A. butzleri was not isolated (Houf and Stephan,007).

Miller et al. (2007) published the whole genome sequence of an. butzleri human clinical strain and revealed the presence of puta-ive virulence factors. But if and to what extent these virulenceactors enhance A. butzleris pathogenicity still remains unknown.revious in vitro studies focused on the interaction of A. butzleriith intestinal epithelial cells to unravel underlying mechanisms

f host colonization. The ability to adhere to and invade host cellsas been demonstrated by several authors (Karadas et al., 2013;o et al., 2007; Levican et al., 2013). Another study showed that A.utzleri induces epithelial barrier dysfunction by changes in tightunction proteins and induction of epithelial cell apoptosis, whichre mechanisms that are consistent with a leak flux type of diar-hea in A. butzleri infection (Bücker et al., 2009) and indicate a highathogenic potential. On one hand, further evidence of pathogen-

city has been provided by proving cytotoxicity and induction ofnflammation in epithelial cells mediated by IL-8 (Villarruel-Lópezt al., 2003; Ho et al., 2007). On the other hand, A. butzleri does notossess any known gene for the cytolethal-distending toxin which

s found in C. jejuni and is known to cause cytotoxicity of host cellsy directly damaging eukaryotic DNA (Miller et al., 2007; Lee et al.,003; Jinadasa et al., 2011).

However, little is known about the cellular innate immuneesponse towards A. butzleri infection. Invasive microorganismshich are able to overcome anatomic host barriers such as

pithelial surfaces are immediately recognized by phagocytic andntigen-presenting cells of the innate immune system such asacrophages or dendritic cells. Macrophages therefore have a fun-

amental role in this first line of defense during infection. Theyre resident in almost all tissues (Murphy et al., 2012) and theirifferent abilities make them crucial for a successful eliminationf invading pathogens. Macrophages are able to phagocytize andherefore eradicate pathogens but also play a key role in connect-ng innate and adaptive immune response via antigen presentation.acterial pathogens have co-evolved with their hosts and thereforeeveloped mechanisms of escaping host immune defense. Sur-ival mechanisms are diverging and often depend on the specificolecular pathogenesis of the microbe. Some pathogens are able to

nvade eukaryotic cells and replicate intracellularly, others are ableo prevent their own uptake by phagocytes (Moine and Abraham,004). Another efficient way to escape host defense is to modu-

ate the apoptotic machinery of mononuclear phagocytic cells. Its commonly known that different bacteria act in both ways andre either able to inhibit or to induce apoptosis to enhance theirirulence potential. Intracellular bacteria such as Mycobacteriumuberculosis profit from decreased host cell death (Häcker et al.,006) whereas bacteria such as Salmonella spp. induce apoptosisf macrophages to lower down numbers of phagocytic host cellsNavarre and Zychlinsky, 2000). Host cell apoptosis is an evolu-ionarily ancient mechanism to contain infection at the expense ofnfected cells. As a consequence, intracellular bacteria are hinderedrom replicating inside by revoking the pathogen’s requirement ofn intracellular environment (Denes et al., 2012). In other cases,t is reasonable for the host to lower down apoptotic processes in

acrophages to prevent tremendous loss of phagocytic cells whichould facilitate pathogen invasion.

As cells of the innate immune system hold this crucial positionuring bacterial infection and are essential for a successful elim-

nation of invading pathogens, we were interested in A. butzlerismpact on human macrophages and the molecular mechanismsf infection. We therefore investigated the influence of A. butz-

eri on the inflammatory response, activation of initiator as wells executioner caspases and intracellular survival as possible vir-lence mechanisms modulating host defense. For this purpose,HP-1 derived macrophages served as an in vitro infection model.

GermanyC. jejuni 81-176 ATCC, # BAA-2151

Our findings provide a better insight into the pathophysiology ofthe infection which is important for evaluating the pathogenicityof isolates and to develop strategies to combat A. butzleri induceddiseases.

Material and methods

Bacterial strains and culture conditions

Employed bacterial strains are listed in Table 1. C. jejuni wasgrown at 37 ◦C, all A. butzleri strains were grown at 30 ◦C onMueller–Hinton blood agar for 48 h (MHB; Oxoid) before beingtransferred in Brucella Broth to grow an overnight liquid culture at37 ◦C and 30 ◦C, respectively. This liquid culture was then adjustedto an OD600 of 0.01 and cultured for another 24 h (A. butzleri)and 48 h, respectively (C. jejuni). Microaerobic atmosphere (5%O2, 10% CO2) was generated using the Anoxomat system (MartMicrobiology). To be used for infection experiments, cultures werecentrifuged, washed with PBS (Sigma-Aldrich) and resuspended incell culture medium (RPMI + 10% FCS superior, both Biochrom). Forquantification of bacteria the number of colony forming units wasdetermined by plating serial dilutions on MHB agar plates whichwere incubated for 48 h at 30 ◦C (A. butzleri) and 37 ◦C, respectively(C. jejuni).

Cell culture

The monocytic cell line THP-1 (DSMZ ACC 16) was cultured asdescribed earlier (Sharbati et al., 2012). Cells were used up to pas-sage 20. To perform infection experiments, cells were differentiatedinto macrophages by stimulation with phorbol-12-myristate-13-acetate (PMA, Sigma-Aldrich) 48 h prior to infection. For thatpurpose, cells were seeded in a 10 �M PMA-solution in RPMI and10% FCS without antibiotics at a density of 4–6 × 105 cells apply-ing a 1.5 ml volume together with a 6-well cell culture plate (TPP).

After 6 h of PMA stimulation the stimulus was removed by wash-ing the adherent cell-layer with PBS and fresh RPMI + 10% FCSwithout antibiotics was provided for another 42 h before being usedfor infection experiments.

J.z. Bruegge et al. / International Journal of Medical Microbiology 304 (2014) 1209–1217 1211

Table 2Oligonucleotides used for RT-qPCR (Annealing temperature 60 ◦C).

hsa Primer Sequence 5′–3′ fw Sequence 5′–3′ rev Product size bp

IL-1� ATCAGTACCTCACGGCTGCT TGGGTATCTCAGGCATCTCC 189IL-1ß TCCAGGGACAGGATATGGAG TCTTTCAACACGCAGGACAG 133IL-6 GAAAGCAGCAAAGAGGCACT TTTTCACCAGGCAAGTCTCC 109IL-8 GTGCAGTTTTGCCAAGGAGT CTCTGCACCCAGTTTTCCTT 196IL-10 AATAAGGTTTCTCAAGGGGCT AGAACCAAGACCCAGACATCAA 348IL-12� TCAGCAACATGCTCCAGAAG TACTAAGGCACAGGGCCATC 234IL-12ß GGACATCATCAAACCTGACC AGGGAGAAGTAGGAATGTGG 123TNF� CCCTGAAAACAACCCTCAGA AAGAGGCTGAGGAACAAGCA 217iNOS ACAAGCCTACCCCTCCAGAT TCCCGTCAGTTGGTAGGTTC 158Caspase 8 GACCACGACCTTTGAAGAGC TCCTGTCCATCAGTGCCATA 180TBP CCACAGCTCTTCCACTCACA GCGGTACAATCCCAGAACTC 136

I

twa5plABww(mTauipsietb

S

rnd41t3elbbdawcFcbu

B2M GTGCTCGCGCTACTCTCTCT

GAPDH CCATCTTCCAGGAGCGAGAT

ß-ACT GGACTTCGAGCAAGAGATGG

nfection experiments for determination of mRNA by RT-qPCR

For determining the ability of A. butzleri to induce the produc-ion of typical inflammatory cytokines, A. butzleri liquid cultureas inoculated to infect 4–6 × 105 THP-1 derived macrophages

t a multiplicity of infection (MOI) of 100 for 2 h at 37 ◦C and% CO2. Non-infected cells served as negative control. C. jejuni, aathogen of the family Campylobacteraceae was used as an estab-

ished stimulus to infect THP-1 derived macrophages, respectively.fter incubation, cells were washed with PBS, lysed with RNA Lysisuffer (miRVana Isolation Kit, Life Technologies) and total RNAas isolated according to the manufacturer’s instruction. cDNAas synthesized by reverse-transcription as previously described

Scholven et al., 2009). RT-qPCR arrays were used to quantifyRNA expression of IL-1�, IL-1ß, IL-6, IL-8, IL-10, IL-12�, IL-12ß,

NF� and iNOS as well as caspase 8. Assays were performed with Step One Plus device (Applied Biosystems, Life Technologies)sing SYBR green Hi-ROX chemistry (Bioline) and normalized to

n parallel amplified TBP, B2 M, GAPDH and ß-ACT as describedreviously (Sharbati et al., 2011). All oligonucleotides were synthe-ized by Metabion or Sigma-Aldrich, respectively (sequences listedn Table 2). Infection experiments were repeated three times andach mRNA expression level was measured additionally in threeechnical replicates. The presented data reflect the means of threeiological replicates.

urvival assays

A. butzleris ability to survive the hostile intracellular envi-onment of macrophages was investigated by determining theumber of living intracellular bacteria 5 h and 22 h after infection asescribed elsewhere with slight modifications (Hickey et al., 2005).–6 × 105 THP-1 derived macrophages were infected at an MOI of00 for 3 h at 37 ◦C and 5% CO2. After incubation, cells were washedhree times with PBS and incubated with RPMI + 10% FCS containing00 �g/ml gentamycin for another two hours to remove remainingxtracellular bacteria. After this 5 h incubation, cells were eitherysed (by the addition of 1 ml 1% SDS in PBS for 10 min) or incu-ated for another 17 h with the addition of 20 �g/ml gentamycinefore lysis (22 h time point). Total numbers of living bacteria wereetermined by plating serial dilutions of respective lysates on MHBgar, which were incubated for 48 h at 30 ◦C. THP-1 cell numbersere determined in parallel at the respective time points to finally

alculate numbers of living intracellular bacteria per macrophage.

or that purpose infected THP-1 cells were detached from the cellulture plate with Accutase (Sigma Aldrich) and stained with trypanlue (Biochrom). Unstained and therefore viable cells were countedsing a c-chip Neubauer cell counting chamber (Carl Roth). Each

GGATGGATGAAACCCAGACA 135CTAAGCAGTTGGTGGTGCAG 249AGCACTGTGTTGGCGTACAG 234

experiment was performed in triplicates and average bacterial andTHP-1 cell numbers were calculated.

Motility assays

Strain-dependent variations in motility were investigated bymeans of motility assays as described elsewhere with slight mod-ifications (Lavrencic et al., 2012). Briefly, 1 �l of bacterial liquidcultures (approximately 1 × 106 cells) of different A. butzleri iso-lates were inoculated on semisoft agar plates (Brucella broth with0.4% agar) in parallel to the A. butzleri type strain CCUG 30485 andincubated at 37 ◦C under microaerobic conditions for 48 h. Swarm-ing halos were measured and compared to the swarming halo ofthe in parallel inoculated type strain.

Caspase activity

For evaluating the ability of A. butzleri to trigger caspase acti-vation via the extrinsic as well as intrinsic apoptotic pathways,5 × 104 THP-1 derived macrophages per well were infected in a96 well plate with five different isolates of A. butzleri (MOI 100) aswell as heat killed culture of the type strain CCUG 30485 (60 ◦C,40 min) as described above (3 h of infection, followed by a treat-ment with 300 �g/ml gentamycin for another 2 h and for the 24 htime point with an additional incubation time of 19 h with thesupplementation of 20 �g gentamycin per ml). Caspase 8 and cas-pase 3/7 activities were analyzed 5 h and 24 h after infection usingthe luminescence based Caspase glo 8 assay system and Caspaseglo 3/7 assay system (Promega), respectively. Mitomycin C (Roche),a known inducer of apoptosis was used as a positive control ata concentration of 5 �g/ml. Non-infected cells served as a neg-ative control. For normalization of caspase activity, numbers ofviable THP-1 were determined using Calcein AM (Sigma-Aldrich)as described elsewhere (Malhotra et al., 2012). For this purpose, a4 mM Calcein-solution was prepared in cell culture medium andincubated for 30 min at 37 ◦C and 5% CO2 after rinsing the celllayer with PBS. Calcein AM is a cell-permeable dye. In viable cellsthe non-fluorescent Calcein AM is converted to fluorescing Calceinafter acetoxymethyl ester hydrolysis by eukaryotic intracellularesterases. After acquiring the Calcein fluorescence, the cell layerwas washed three times with PBS before Caspase glo reagentswere added and luminescence was determined using the FLUOstarOPTIMA (BMG Labtech).

In addition to activity assays, activation of caspase 3 was demon-strated by immunostaining of infected cells with an antibody

recognizing cleaved and therefore active caspase 3 (Cell SignalingTechnology, (Asp175) (5A1E) Rabbit mAb, #9664). For thatpurpose, THP-1 derived macrophages were seeded in 8-well cham-ber slides (Sarstedt) (2 × 105/well) and infected with viable as

1 f Medical Microbiology 304 (2014) 1209–1217

wfiatrav(lc

T

Siiwasawwaao(

S

swp

R

AT

tdwa�Iw(tpviczpaii

Ad

b

Fig. 1. Relative fold increase of mRNA amounts of cytokines expressed 2 h after infectionof THP-1 derived macrophages. Shown figures reflect data from three independentinfection experiments with A. butzleri strains 89 (chicken isolate), F0 (human iso-late) and the human type strain (CCUG) as well as a pathogenic representativeof Campylobacteraceae, C. jejuni strain 81-176. Macrophages responded with highmRNA expression levels of pro-inflammatory cytokines IL-1�, IL-1ß, IL-6, IL-8, IL-12ß and TNF� but only moderate induction of the anti-inflammatory cytokine IL-10.Except for IL-12ß C. jejuni infection also induced the expression of the investigated

212 J.z. Bruegge et al. / International Journal o

ell as heat killed A. butzleri (reference strain) as described aboveor 5 h and 24 h. LPS treated (1 �g/ml) (Sigma, Salmonella enter-ca serovar Typhimurium), Mitomycin C treated (5 �g/ml) (Roche)nd non-infected cells served as controls. Subsequent to infec-ion cells were stained with active caspase 3 antibody (1:400) andespective secondary antibody (1:200) (Thermo scientific, Goat-nti-Rabbit, #35561) according to the manufacturer’s protocol andisualized with the fluorescence inverted microscope DMI6000 BLeica). DAPI as well as phalloidin staining (Sigma-Aldrich, Phal-oidin Atto 488) were used to visualize DNA and the eukaryoticytoskeleton, respectively. Experiments were repeated three times.

UNEL assay

Trevigen TACS 2 TdT-Fluor In Situ Apoptosis Detection Kit (R&Dystems) was used as an end-point apoptosis assay. To visual-ze DNA strand breaks, THP-1 derived macrophages were seededn 8-well chamber slides (Sarstedt) (2 × 105/well) and infected

ith viable and heat killed A. butzleri strain CCUG30485 for 24 hs described for the caspase activity assay. Non-infected cellserved as a negative control. Mitomycin C treated cells (5 �g/ml)s well as nuclease treated cells (intra assay control, Trevigen)ere used as positive controls. DNA strand breaks were labeledith modified nucleotides using an exogenous terminal transferase

ccording to the manufacturer’s protocol (Trevigen, R&D Systems)nd visualized by means of a green FITC staining signal using the flu-rescent fully automated inverted research microscope DMI6000 BLeica).

tatistical analysis

Unpaired t tests were performed using GraphPad Prism ver-ion 6.00 for Windows, GraphPad Software, La Jolla California USA,ww.graphpad.com. Asterisks in figures summarize p values (*

< 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001).

esults

. butzleri infection induces a pro-inflammatory response inHP-1 derived macrophages

To evaluate if A. butzleri infection leads to induction of inflamma-ory cytokines, an array of 9 different cytokines typically produceduring bacterial infections was established and mRNA expressionas analyzed by means of RT-qPCR. Relative fold change of mRNA

mounts was calculated compared to the negative control using the�CT method. The pro-inflammatory cytokines IL-1�, IL-1ß, IL-6,

L-8, IL-12ß and TNF� were highly induced by all tested strainshile the expression of iNOS and IL-12� remained unaffected

Fig. 1). The anti-inflammatory cytokine IL-10 was also induced buto a much lesser extent compared to the pro-inflammatory counter-arts (Fig. 1). Although cytokine expression levels in macrophagesaried after infection with different strains – type strain (humansolate), F0 (human isolate), 89 (chicken isolate) – the overallytokine profiles exhibited by macrophages in response to A. but-leri infection did not seem to be strain specific since no specificattern of induction was observed. C. jejuni was used in parallel as

pathogenic control. Except for IL-12ß, C. jejuni infection revealednduction of investigated cytokines, although to a lesser extent thannfection with A. butzleri isolates did.

. butzleri is able to survive in macrophages for at least 22 h with

istinct strain-specific differences

To assess the ability of A. butzleri to escape host immune defensey surviving and replicating inside macrophages as described for

cytokines although to a smaller degree. Columns show the mean of 3 biologicalreplicate measurements while bars indicate the SD.

C. jejuni (Kiehlbauch et al., 1985) and many other pathogens, agentamycin protection assay was performed. To deepen our inves-

tigations, we furthermore considered the strains 88 and 94 (isolatedfrom chicken) as well as strain 102 (isolated from pork). Except forisolate 94 all A. butzleri strains were able to survive up to 22 h in

J.z. Bruegge et al. / International Journal of Medical Microbiology 304 (2014) 1209–1217 1213

Fig. 2. A. butzleri are able to survive in THP-1 derived macrophages. ((A)–(F)) A gen-tamycin protection assay revealed the ability of 5 out of 6 different A. butzleri isolatesto survive inside macrophages for up to 22 h although bacteria were depleted to aminimal amount of originally inoculated cell numbers. Macrophages were lysed at 5and 22 h after infection and numbers of living bacteria per macrophage were deter-mined. (C, D, F). Highest invasion and survival capabilities were achieved by chickenisolate 88 (0.583 bacteria per macrophage 5 h p.i.; 0.42 bacteria per macrophage22 h p.i.) followed by pork isolate 102 and chicken isolate 89. (G) Most striking dif-ferences were observed among the isolates comparing bacterial intracellular cellnw

TrllnpMra

Fig. 3. Strains of A. butzleri exhibit differences in motility. Motility assays were per-formed on semisoft agar plates to correlate invasion and survival capabilities withstrain-dependent differences in motility. Swarming halos of each strain were mea-sured and compared with swarming halos of the in parallel inoculated referencestrain. After 48 h of cultivation on semi-soft agar plates at 37 ◦C isolates 102, 89 and88 showed higher motility compared with the human type strain whereas isolate

umbers 5 h after infection. Columns show the mean of 3 replicate measurementshile bars indicate the SD (** p < 0.01; *** p < 0.001).

HP-1 derived macrophages although surviving intracellular bacte-ia were depleted to a small fraction of the inoculum (0.0015–0.42iving intracellular bacteria per macrophage of originally inocu-ated 100 bacterial cells per macrophage) (Fig. 2A–F). Bacterial cellumbers of all strains decreased between the 5 h and 22 h time

oints with the highest survival rate for isolate 88 (Fig. 2C).ost interestingly, tremendous differences in intracellular bacte-

ial numbers per macrophage were observed at 5 h post infectionmong the different A. butzleri isolates (Fig. 2G). Significant

94 exhibited lower motility. Columns show the mean of 8 replicate measurementswhile bars indicate the SD (* p < 0.05; **** p < 0.0001).

differences were found for isolates 88 (0.583 bacteria permacrophage, p < 0.001) and 102 (0.223 bacteria per macrophage,p < 0.001) followed by isolate 89 (0.113 bacteria per macrophage,p < 0.01) compared to the human type strain CCUG30485 (0.003bacteria per macrophage).

Invasion and survival capabilities might be correlated withstrain-dependent differences in motility

Since A. butzleri possess two short flagellins (Ho et al., 2008)which could also play a role in colonization and invasion of hostcells, we reasoned that A. butzleri strain specific differences inthe invasion and survival ability might be correlated with vari-ations in motility. Therefore motility assays were performed onsemisoft agar plates to explain the vast differences in intracellu-lar bacterial cell-numbers found in THP-1 derived macrophagesat 5 h post infection. Swarming halos were measured and com-pared to swarming halos of in parallel inoculated type strain. After48 h of cultivation on semi-soft agar plates at 37 ◦C, isolates 102(2.69 cm diameter swarming halo, p < 0.001), 89 (2.2 cm swarminghalo, p < 0.05) and 88 (2.1 cm swarming halo) showed higher motil-ity compared to the human type strain (1.93 cm swarming halo)(Fig. 3). The motility, especially of isolates 102 and 89, correlatedwith their higher capability to infect and invade macrophages 5 hafter infection in the survival assays (Fig. 2G). Accordingly, strain94 possessed lowest motility rates (1.83 cm swarming halo) amongtested strains being associated with lowest invasiveness and intra-cellular numbers (Fig. 2G and Fig 3).

A. butzleri transiently activates caspases in early stages ofinfection without obvious initiation of apoptosis in THP-1 derivedmacrophages

The ability of A. butzleri to induce caspase 8 activation was ana-lyzed at 5 h and 24 h after infection. As illustrated in Fig. 4A, caspase8 showed significantly increased activity in early stages of infectioncaused by all strains as well as the heat killed type strain (p < 0.001)compared to non-infected cells. However, at 24 h after infection lev-

els of caspase 8 activity dropped down to the level of the negativecontrol (Fig. 4A). In contrast to increased caspase 8 activity, 5 h afterinfection the mRNA expression of caspase 8 was downregulated

1214 J.z. Bruegge et al. / International Journal of Medical Microbiology 304 (2014) 1209–1217

Fig. 4. Caspase 8, 3 and 7 activity is transiently induced in early stages of A. butzleri infection but does not result in DNA damage in THP-1 derived macrophages. (A) Cells wereinfected with 5 different A. butzleri isolates as well as the heat killed (hk) type strain. Mitomycin C was used as a positive control, non-infected cells served as a negativecontrol (nc). 5 h and 24 h after infection, activity of the initiator caspase 8 was analyzed with the luminescent Caspase glo assay system and normalized to viable THP-1 cellsusing Calcein. All strains induced activity of caspases 8, 3 and 7 at 5 h after infection. The activity declined to levels of non-infected cells 24 h after infection. Columns show themean of 5 biological replicate measurements while bars indicate the SD. Significant differences were calculated relative to non-infected cells (* p < 0.05; ** p < 0.01, *** p < 0.001;**** p < 0.0001). (B) Relative amounts of caspase 8 mRNA were determined by means of RT-qPCR. For this purpose, RNA was isolated from infected THP-1 and fold changeswere determined at 1, 5 and 24 h post infection. After 5 h mRNA amounts decreased significantly compared to other time points. Columns show the mean of 5 biologicalreplicate measurements while bars indicate the SD. (* p < 0.05; ** p < 0.01). (C) Experiments were performed exactly as described in section A except that caspase 3 and 7activity was measured. (D) THP-1 cells were infected with viable and heat killed A. butzleri (reference strain) to detect cleaved and active caspase 3 with via immunostaining.A distinct signal for cleaved and therefore active caspase 3 (red) was detected 5 h but not 24 h after infection with viable and heat killed A. butzleri whereas Mitomycin C andLPS treatment of cells resulted in continuous caspase 3 signal for up to 24 h. (green: phalloidin staining of eukaryotic cytoskeleton, blue: DAPI staining of DNA). White scalebars indicate 50 �m. (E) TUNEL assays did not indicate obvious DNA strand breaks (green FITC staining co-localized with blue DAPI staining of cellular DNA) occurring at 24 hafter infection using viable and heat killed A. butzleri type strain compared with the negative control. White scale bars indicate 50 �m.

f Med

bi

d3p(b2fcvbl3

ptwvcmo(tot

D

iciartfinwgs

o2rccsrinttbs

mipHtmmr

J.z. Bruegge et al. / International Journal o

ut converged to the basal level of the negative control at 24 h afternfection (Fig. 4B) indicating a potential counter regulation.

To determine whether A. butzleri triggered caspase 8 activationuring early infection leads to activation of executioner caspases

and 7, respective activity assays were performed. Similar to cas-ase 8, activities of caspases 3 and 7 were significantly increasedp < 0.01) by all strains at 5 h compared to non-infected cells (Fig. 4C)ut were significantly (p < 0.01) lower than the negative control at4 h after infection (Fig. 4C). Immunostaining of cleaved and there-ore activated caspase 3 confirmed the observations made in theaspase activity assay since active caspase 3 was detected only iniable and heat killed cells that were infected with A. butzleri at 5 hut not 24 h after infection. Stimulation with Mitomycin C and LPS

ed to consistent detection of cleaved and therefore active caspase (Fig. 4D).

Due to caspase activation at 5 h but not 24 h after infection andotential counter regulation mechanisms of host cells indicated byhe downregulation of caspase 8 expression (Fig. 4B), a TUNEL assayas performed to determine onset of apoptosis. For this purpose,

iable as well as heat killed A. butzleri type strain were generi-ally used to follow up if infection finally leads to DNA damage inacrophages. As shown in Fig. 4E, TUNEL assays did not reveal obvi-

us apoptotic effects in response to A. butzleri at 24 h after infectionviable and heat killed) compared to non-infected cells supportinghe observations made before. This suggests an initial activationf caspases followed by potential counter regulation mechanismshat prevent DNA damage as a measure for apoptosis.

iscussion

Since Arcobacter was first described as a new zoonotic agentn 1991 (Kiehlbauch et al., 1991) the relevance of Arcobacter asso-iated with disease still remains to be evaluated. Case reportsdentifying Arcobacter spp. as the causing agent of severe diseasesre sparse (Figueras et al., 2014) which might be due to missingoutine diagnostic. Therefore, evaluation of the pathogenic poten-ial is hardly possible. Macrophages have a fundamental role in therst line of host defense during bacterial infections. Since there iso data on A. butzleri-macrophage interaction, the aim of this studyas to investigate A. butzleris impact on human macrophages to

ain further insight into the response of cells of the innate immuneystem towards A. butzleri infection.

The question first addressed was if A. butzleri leads to activationf the inflammatory machinery as known for C. jejuni (Hu et al.,006; Jones et al., 2003). Infection of THP-1 derived macrophagesesulted in high induction of all kinds of pro-inflammatoryytokines but only moderate induction of the anti-inflammatoryytokine IL-10. This result suggests that cells of the innate immuneystem recognize A. butzleri via TLRs which leads to synthesis andelease of cytokines, alert of further immune cells and might resultn systemic inflammation. TLR4 detecting LPS/LOS and TLR5 recog-izing bacterial flagellins are most probably the Toll-like-receptorshat mainly participate in A. butzleri infection. A previous study ofhe infected human intestinal cell line Caco-2 demonstrated that A.utzleri also induces epithelial cell secretion of IL-8 confirming thisuggestion (Ho et al., 2007).

Intracellular survival as well as replication of C. jejuni inononuclear phagocytes has been demonstrated in several stud-

es and is considered as a virulence mechanism employed by theathogen to escape host immune defense (Kiehlbauch et al., 1985;ickey et al., 2005; Jones et al., 2003). Therefore, we examined

he ability of A. butzleri to survive the hostile environment ofacrophages. Our data demonstrate that A. butzleri is able to resistacrophage defense for up to 22 h although intracellular bacte-

ia were minimized to a minimal fraction of originally inoculated

ical Microbiology 304 (2014) 1209–1217 1215

cell-numbers. Jones et al. demonstrated intracellular survival of C.jejuni in THP-1 cells for up to 24 h after infection. Similar to ourobservations bacterial cell numbers were diminished to a smallerfraction (Jones et al., 2003). Intracellular survival in THP-1 cells hasalso been proven for other pathogens such as M. tuberculosis orSalmonella (Sly et al., 2003; Forest et al., 2010). Survival of thesepathogens within macrophages is known to be an essential step inpathogenesis.

Most striking were the vast strain-dependent differences inintracellular bacterial numbers found in macrophages at 5 h afterinfection with highest invasion and survival capabilities observedfor meat isolates. Isolate dependent differences in gene patternsof A. butzleri have been described (besides others) by Merga et al.(2013) and explained with an adaptation to different host-niches.The authors claim that adaptations occur to suit different envi-ronments and result in genetic differences between the strains.Therefore, variations in survival and sensing systems might berelated to the origin of isolates. Intracellular invasion and sur-vival of bacterial pathogens are considered a virulence mechanismand in case of A. butzleri might be supported by the flagellumwhich confers its motility. Strain-dependent variations in the abil-ity to enter host cells therefore might be correlated with distinctvirulence gene expression. Karadas et al. (2013) tested adhe-sion and invasion capabilities of same isolates that were usedin this study in intestinal epithelial cells and were not able tocorrelate different virulence gene patterns (esp. adhesion and inva-sion genes cadF, cj1349, ciaB) with variations in adhesive andinvasive phenotypes. To correlate differences in invasion capabil-ities with variations in motility, we inoculated A. butzleri liquidculture on a semisoft agar and measured the swarming halos.Interestingly, the strains that were most invasive in macrophagespossessed also enhanced motility. Nevertheless, conclusions fromthis data have to be drawn very carefully since invasion wasdetermined 5 h after infection whereas agar plates for the motil-ity assay were incubated for 48 h under microaerobic conditions,although Ho et al. demonstrated that different oxygen levels hadno impact on flagellin gene transcription (flaA and flaB) (Ho et al.,2008). Therefore, more in-depth studies are needed to verify thishypothesis.

Another reported strategy to attenuate host defense is to influ-ence apoptotic processes in cells of the innate immune system.Apoptosis is either mediated through the extrinsic or the intrinsicapoptotic pathway depending on the death-stimuli. The extrinsicpathway is triggered through FAS or the TNF-receptor family andactivates initiator caspase 8 which leads to downstream activationof executioner caspases 3 and 7 and other proapoptotic moleculesand finally the programmed cell death. The intrinsic pathway, how-ever, occurs as a response to different intracellular stimuli and ismediated by cytochrome c release of mitochondria. In both path-ways, late apoptotic events occur after activation of the executionercaspases and result in exposure of phosphatidylserine on the extra-cellular surface of the plasma membrane, cleavage and inactivationof PARP (an enzyme involved in DNA repair) and internucleosomalDNA fragmentation. Bücker et al. (2009) demonstrated induction ofapoptosis by A. butzleri in intestinal epithelial cells which directlycontributed to epithelial barrier dysfunction. In our study, infectionof THP-1 derived macrophages with different A. butzleri strains ledto increased activity of the initiator caspase 8 as well as executionercaspases 3 and 7 at 5 h but not 24 h after infection. Interestingly,and in contrast to increased caspase 8 activity, mRNA expressionof caspase 8 was downregulated 5 h after infection and rose upagain to the basal level at 24 h. The initial caspase induction dur-

ing early stages of infection may be counteracted by the host cellto reconstitute survival and undisturbed function during infec-tion by avoiding apoptosis. This mechanism has been describedby Perera and Waldmann (1998) who observed a rapid repression

1 f Med

oovmfpot

sTcfimhmvi(1

piromceat

sisuttolafrh2caogos2gvuaidStobmntd

Levican, A., Alkeskas, A., Gunter, C., Forsythe, S.J., Figueras, M.J., 2013. Adherence toand Invasion of human intestinal cells by Arcobacter species and their virulence

216 J.z. Bruegge et al. / International Journal o

f caspase 8 synthesis in activated monocytes during early stagesf infection as a counter regulation to ensure macrophage sur-ival and to execute their function especially in an inflammatoryicroenvironment rich in cytotoxic cytokines such as TNF� and

ree radical metabolites. Accordingly, the conducted end-point apo-tosis assay (TUNEL) did not reveal obvious DNA fragmentationf THP-1 derived macrophages 24 h after A. butzleri infection andherefore supports this hypothesis.

Taken together, to our knowledge we were the first to demon-trate that A. butzleri has an impact on human innate immune cells.here are indications of pathogenic potential demonstrated byytokine production and the ability to survive inside macrophagesor up to 22 h. On one hand, only a minimal fraction of initiallynoculated bacteria invaded and survived, similar to observations

ade for C. jejuni in THP-1 cells (Jones et al., 2003). On the otherand, reports regarding the ability of C. jejuni to survive withinacrophages are quite contradictory and vary from “ability to sur-

ive for up to seven days with an approximate 3-log-level increasen bacterial counts” to “eradication by host phagocytes within 24 h”Hickey et al., 2005; Watson and Galán, 2008; Kiehlbauch et al.,985; Wassenaar et al., 1997).

Opposed to the hypothesis of A. butzleri possessing pathogenicotential, it is widely known that stimulation of TLRs leads to

ncrease of pro-inflammatory cytokines and does not necessarilyesult in systemic disorder but might also lead to a fast eradicationf invading microbes without manifestation of disease. Further-ore, macrophages showed a mechanism to counter regulate

aspase activation possibly retaining their undisturbed functionven though burdened with a bacterial load. The development ofppropriate animal models would be helpful to address these ques-ions in the future.

Most surprising observations made in our study were the strainpecific invasion and survival capabilities as well as variationsn motility. Although A. butzleri strains can be grouped based onimilar virulence gene patterns, they do not exhibit the same vir-lence phenotype (Karadas et al., 2013). This does not blank outhe fact that there are isolate dependent differences in pheno-ypes conferring distinct virulence potentials. In a prevalence studyf Arcobacter spp. in Belgian pigs, van Driessche et al. revealed aarge heterogeneity among A. butzleri isolates in individual animalsnd also determined a large number of genotypes per species onarm level. Colonization of multiple parent genotypes or genomicearrangement of parent genotypes during passage through theost might portray possible explanations (van Driessche et al.,004). These strain specific differences may be responsible for thelinical differences observed in A. butzleri infected human patientsnd animals since some infections lead to severe disease whereasthers do not exhibit any clinical symptoms. In addition, wholeenome sequencing and MLST of A. butzleri isolates of multiplerigins indicated strain and isolate specific genomic differencesuggesting potential niche adaptation to some degree (Miller et al.,007; Merga et al., 2013). These processes of adaptation result inenetic differences among strains which also might be related toirulence. Based on this knowledge we might have to rethink ournderstanding of pathogenicity of a certain emerging organismnd rather take into consideration that there might be importantntraspecies differences in virulence leading to the formation ofifferent subspecies as known for other enteric pathogens such asalmonella enterica ssp. To finally evaluate if A. butzleri is a severehreat to human health and an opportunistic foodborne pathogenr rather plays a minor role in the development of gastroenteritiseing only associated to disease in single cases, optimized in vivoodels have to be developed. Moreover, further investigations are

ecessary, possibly including bacterial RNAseq, to evaluate if and

o what extent the putative virulence factors are essential and favorisease.

ical Microbiology 304 (2014) 1209–1217

Acknowledgements

We are grateful to Barbara Kutz-Lohroff and Laura Lehmann forexcellent technical assistance. This work was funded by the GermanResearch Foundation (DFG) through SFB852 and supported by theH. Wilhelm Schaumann Stiftung.

References

Acheson, D., Allos, B.M., 2001. Campylobacter jejuni infections: update on emergingissues and trends. Clin. Infect. Dis. 32 (8), S.1201–S.1206.

Bücker, Roland, Troeger, Hanno, Kleer, Josef, Fromm, Michael, Schulzke, Jörg-Dieter,2009. Arcobacter butzleri induces barrier dysfunction in intestinal HT-29/B6Cells. J. Infect. Dis. 200 (5), S.756–S.764.

Collado, L., Figueras, M.J., 2011. Taxonomy, epidemiology, and clinical relevance ofthe genus arcobacter. Clin. Microbiol. Rev. 24 (1), S.174–S.192.

Denes, A., Lopez-Castejon, G., Brough, D., 2012. Caspase-1: is IL-1 just the tip of theICEberg? Cell Death Dis. 3 (7), Se338.

Ellis, W.A., Neill, S.D., O’Brien, J.J., Ferguson, H.W., Hanna, J., 1977. Isolationof Spirillum/Vibrio-like organisms from bovine fetuses. Vet. Rec. 100 (21),S.451–S.452.

Figueras, M.J., Levican, A., Pujol, I., Ballester, F., Rabada Quilez, M.J., Gomez-Bertomeu,F., 2014. A severe case of persistent diarrhoea associated with Arcobactercryaerophilus but attributed to Campylobacter sp. and a review of the clinicalincidence of Arcobacter spp. New Microb. New Infect. 2 (2), S.31–S.37.

Forest, Chantal G., Ferraro, Elyse, Sabbagh, Sébastien C., Daigle, France, 2010. Intra-cellular survival of Salmonella enterica serovar Typhi in human macrophages isindependent of Salmonella pathogenicity island (SPI)-2. Microbiology 156 (Pt12), S.3689–S.3698.

Häcker, Georg, Kirschnek, Susanne, Fischer, Silke F., 2006. Apoptosis in infectiousdisease: how bacteria interfere with the apoptotic apparatus. Med. Microbiol.Immunol. 195 (1), S.11–S.19.

Hickey, T.E., Majam, G., Guerry, P., 2005. Intracellular survival of Campylobacterjejuni in human monocytic cells and induction of apoptotic death by cytholethaldistending toxin. Infect. Immun. 73 (8), S.5194–S.5197.

Ho, Hoa T.K., Lipman, Len J.A., Hendriks, Henno G.C.J.M., Tooten, Peter C.J., Ultee,Ton, Gaastra, Wim, 2007. Interaction of Arcobacter spp. with human and porcineintestinal epithelial cells. FEMS Immunol. Med. Microbiol. 50 (1), S.51–S.58.

Ho, Hoa T.K., Lipman, Len, J.A., Wösten, Marc, M.S.M., van Asten, Alphons, J.A.M.,Gaastra, Wim, 2008. Arcobacter spp. possess two very short flagellins of whichFlaA is essential for motility. FEMS Immunol. Med. Microbiol. 53 (1), S.85–S.95.

Houf, Kurt, Stephan, Roger, 2007. Isolation and characterization of the emergingfoodborn pathogen Arcobacter from human stool. J. Microbiol. Methods 68 (2),S.408–S.413.

Hu, L., Bray, M.D., Osorio, M., Kopecko, D.J., 2006. Campylobacter jejuni induces mat-uration and cytokine production in human dendritic cells. Infect. Immun. 74 (5),S.2697–S.2705.

Jinadasa, R.N., Bloom, S.E., Weiss, R.S., Duhamel, G.E., 2011. Cytolethal distendingtoxin: a conserved bacterial genotoxin that blocks cell cycle progression, leadingto apoptosis of a broad range of mammalian cell lineages. Microbiology 157 (7),S.1851–S.1875.

Jones, M.A., Totemeyer, S., Maskell, D.J., Bryant, C.E., Barrow, P.A., 2003. Induction ofproinflammatory responses in the human monocytic cell line THP-1 by Campy-lobacter jejuni. Infect. Immun. 71 (5), S.2626–S.2633.

Karadas, G., Sharbati, S., Hänel, I., Messelhäußer, U., Glocker, E., Alter, T., Gölz, G.,2013. Presence of virulence genes, adhesion and invasion of Arcobacter butzleri.J. Appl. Microbiol. 115 (2), S.583–S.590.

Kiehlbauch, J.A., Albach, R.A., Baum, L.L., Chang, K.P., 1985. Phagocytosis of Campy-lobacter jejuni and its intracellular survival in mononuclear phagocytes. Infect.Immun. 48 (2), S.446–S.451.

Kiehlbauch, J.A., Brenner, D.J., Nicholson, M.A., Baker, C.N., Patton, C.M., Steiger-walt, A.G., Wachsmuth, I.K., 1991. Campylobacter butzleri sp. nov. isolated fromhumans and animals with diarrheal illness. J. Clin. Microbiol. 29 (2), S.376–S.385.

Lappi, Victoria, Archer, John R., Cebelinski, Elizabeth, Leano, Fe, Besser, John M., Klos,Rachel F., et al., 2013. An outbreak of foodborne Illness among attendees of awedding reception in Wisconsin likely caused by Arcobacter butzleri. FoodbornePathog. Dis. 10 (3), S.250–S.255.

Lau, S.K.P., 2002. Identification by 16S ribosomal RNA gene sequencing of Arcobac-ter butzleri bacteraemia in a patient with acute gangrenous appendicitis. Mol.Pathol. 55 (3), S.182–S.185.

Lavrencic, Peter, Kaakoush, Nadeem O., Huinao, Karina D., Kain, Nupur, Mitchell,Hazel M., 2012. Investigation of motility and biofilm formation by intestinalCampylobacter concisus strains. Gut Pathog. 4 (1), S.22.

Lee, R.B., Hassane, D.C., Cottle, D.L., Pickett, C.L., 2003. Interactions of Campylobacterjejuni cytolethal distending toxin subunits CdtA and CdtC with HeLa cells. Infect.Immun. 71 (9), S.4883–S.4890.

Lehner, A., Tasara, T., Stephan, R., 2005. Relevant aspects of Arcobacter spp. as poten-tial foodborne pathogen. Int. J. Food Microbiol. 102 (2), S.127–S.135.

denotypes. Appl. Environ. Microbiol. 79 (16), S.4951–S.4957.Malhotra, Shashwat, Bauer, Hannah, Tschiche, Ariane, Staedtler, Anna Maria, Mohr,

Andreas, Calderón, Marcelo, et al., 2012. Glycine-terminated dendritic

f Med

M

M

M

M

N

O

P

R

S

S

ferential uptake and killing potential of Campylobacter jejuni by human

J.z. Bruegge et al. / International Journal o

amphiphiles for nonviral gene delivery. Biomacromolecules 13 (10),S.3087–S.3098.

erga, J. Yvette, Williams, Nicola J., Miller, William G., Leatherbarrow, Andrew J.H.,Bennett, Malcolm, Hall, Neil, et al., 2013. Exploring the diversity of Arcobacterbutzleri from cattle in the UK using MLST and whole genome sequencing. PLoSOne 8 (2), Se55240.

iller, William G., Parker, Craig T., Rubenfield, Marc, Mendz, George L., Wösten,Marc M.S.M., Ussery, David W., et al., 2007. The complete genome sequenceand analysis of the epsilonproteobacterium Arcobacter butzleri. PLoS One 2 (12),Se1358.

oine, Pierre, Abraham, Edward, 2004. Immunomodulation and sepsis: impact ofthe pathogen. Shock 22 (4), S.297–S.308.

urphy, Kenneth, Janeway, Charles A., Travers, Paul, Walport, Mark, 2012. Janeway’sImmunobiology, eighth ed. Taylor & Francis, Oxford.

avarre, W.W., Zychlinsky, A., 2000. Pathogen-induced apoptosis of macrophages:a common end for different pathogenic strategies. Cell. Microbiol. 2 (4),S.265–S.273.

n, S.L., Stacey, A., Smyth, J., 1995. Isolation of Arcobacter butzleri from a neonatewith bacteraemia. J. Infect. 31 (3), S.225–S.227.

erera, L.P., Waldmann, T.A., 1998. Activation of human monocytes induces differ-ential resistance to apoptosis with rapid down regulation of caspase-8/FLICE.Proc. Natl. Acad. Sci. U.S.A. 95 (24), S.14308–S.14313.

ivas, Lucia, Fegan, Narelle, Vanderlinde, Paul, 2004. Isolation and characterisationof Arcobacter butzleri from meat. Int. J. Food Microbiol. 91 (1), S.31–S.41.

cholven, Jutta, Taras, David, Sharbati, Soroush, Schön, Jennifer, Gabler, Christoph,

Huber, Otmar, et al., 2009. Intestinal expression of TFF and related genes duringpostnatal development in a piglet probiotic trial. Cell. Physiol. Biochem. 23 (1–3),S.143–S.156.

harbati, Jutta, Lewin, Astrid, Kutz-Lohroff, Barbara, Kamal, Elisabeth,Einspanier, Ralf, Sharbati, Soroush, Agrewala, Javed N., 2011. Integrated

ical Microbiology 304 (2014) 1209–1217 1217

microRNA-mRNA-analysis of human monocyte derived macrophages uponMycobacterium avium subsp. hominissuis infection. PLoS One 6 (5), Se20258.

Sharbati, Soroush, Sharbati, Jutta, Hoeke, Lena, Bohmer, Marc, Einspanier, Ralf, 2012.Quantification and accurate normalisation of small RNAs through new customRT-qPCR arrays demonstrates Salmonella-induced microRNAs in human mono-cytes. BMC Genomics 13 (1), S.23.

Sly, L.M., Hingley-Wilson, S.M., Reiner, N.E., McMaster, W.R., 2003. Survival ofMycobacterium tuberculosis in host macrophages involves resistance to apopto-sis dependent upon induction of antiapoptotic Bcl-2 family member Mcl-1. J.Immunol. 170 (1), S.430–S.437.

van Driessche, Ellen, Houf, Kurt, Vangroenweghe, Frédéric, Nollet, Nathalie, Zutter,Lieven de, Vandamme, Peter, van Hoof, Jan, 2004. Occurrence and strain diversityof Arcobacter species isolated from healthy Belgian pigs. Res. Microbiol. 155 (8),S.662–S.666.

Vandamme, P., Ley, J. de, 1991. Proposal for a new family, Campylobacteraceae. Int.J. Syst. Bacteriol. 41 (3), S.451–S.455.

Vandenberg, Olivier, Dediste, Anne, Houf, Kurt, Ibekwem, Sandra, Souayah, Hichem,Cadranel, Sammy, et al., 2004. Arcobacter species in Humans. Emerg. Infect. Dis.10 (10), S.1863–S.1867.

Villarruel-López, A., Márquez-González, M., Garay-Martínez, L.E., Zepeda, H.,Castillo, A., La Mota de Garza, L., et al., 2003. Isolation of Arcobacter spp. fromretail meats and cytotoxic effects of isolates against vero cells. J. Food Prot. 66(8), S.1374–S.1378.

Wassenaar, T.M., Engelskirchen, Mark, Park, Simon, Lastovica, Albert, 1997. Dif-

peripheral monocytes/macrophages. Med. Microbiol. Immunol. 186 (2–3),S.139–S.144.

Watson, Robert O., Galán, Jorge E., 2008. Campylobacter jejuni survives within epithe-lial cells by avoiding delivery to lysosomes. PLoS Pathog. 4 (1), Se14.