AraC-type regulator Rsp adapts Staphylococcus aureus gene expression

to acute infection

Tianming Li, Lei He, Yan Song Amer E. Villaruz, Hwang-Soo Joo, Qian Liu, Yuanjun

Zhu, Yanan Wang, Juanxiu Qin, Michael Otto, Min Li

Supplemental Online Material

Tab. S1. Bacterial strains and plasmids used in this study. Strains/plasmids Relevant genotype and property Source/reference S. aureus strains RN4220 derived from NCTC8325-4;r-m+ [1] BD02-25 MRSA ST8 clinical wild-type clinical strain

(rsp+) This study

BD02-25△rsp BD02-25 rsp mutant (rsp-) This study BD02-25△rsp(pRB473) BD02-25 rsp mutant with pRB473 This study BD02-25△rsp(pRBrsp) BD02-25 rsp mutant with pRB473rsp This study MW2 CA-MRSA standard wild-type clinical strain

(rsp+) [2]

MW2△rsp MW2 rsp mutant (rsp-) This study MW2△rsp(pRB473) MW2 rsp mutant with pRB473 This study MW2△rsp(pRBrsp) MW2 rsp mutant with pRB473rsp This study MW2△agr MW2 agr mutant (agr-) This study MW2△agr△rsp MW2 agr and rsp double mutant (agr- rsp-) This study E. coli strains XL1 blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44

relA1 lac [F' proAB lacIqZΔM15 Tn10 (Tetr)]

Qiagen

SG13009 [pREP4] K12 derivative, Nals Strs Rifs Thi- Lac- Ara- Gal+ Mtl- F- RecA+ Uvr+ Lon+ [pREP4 KanR]

Qiagen

DH5α endA1 recA1 gyrA96 thi-1 hsdR17(rK- mK+) relA1 supE44 (lacZYA-argF)U169 F-80dlacZM15 deoR phoA

Invitrogen

Plasmids pKOR1 cmR and ampR, temperature-sensitive vector

for allelic replacement via lambda recombination and ccdB selection

[3]

pKOR1△rsp vector for allelic replacement of rsp in S. This study

aureus pKOR1△agr vector for allelic replacement of agr in S.

aureus This study

pRB473 E. coli/Staphylococcus shuttle cloning plasmid, cmR and ampR

[4]

pRB rsp Derived from pRB473 by insertion of rsp gene

This study

pQE-9 lacIq, 3.4 kb, Apr, T5, C-terminal 6 × His-tag Qiagen pQE-rsp pQE-9 containing the rsp gene of S. aureus This study pQE-rsp(191-192 mutant) pQE-9 containing the 191-192 mutant rsp

gene of S. aureus This study

pQE-rsp(182-185 mutant) pQE-9 containing the 182-185 mutant rsp gene of S. aureus

This study

pQE-rsp(176-179 mutant) pQE-9 containing the 176-179 mutant rsp gene of S. aureus

This study

1. de Azavedo JC, Foster TJ, Hartigan PJ, Arbuthnott JP, O'Reilly M, et al. (1985) Expression of the cloned

toxic shock syndrome toxin 1 gene (tst) in vivo with a rabbit uterine model. Infect Immun 50: 304-309.

2. CDC (1999) From the Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus--Minnesota and North Dakota, 1997-1999. Jama 282: 1123-1125.

3. Bae T, Schneewind O (2006) Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55: 58-63.

4. Bruckner R (1997) Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol Lett 151: 1-8.

Tab. S2. Oligonucleotides used in this study. Name DNA sequence(5`-3`) Oligonucleotides for rsp analytical PCR rsp-F gatgcgcacttgtctttaaaagatatagcg rsp-R ctatttaacaggttgtaattcgtttggc Oligonucleotides for isogenic deletion mutant rsp-att1 ggggacaagtttgtacaaaaaagcaggctgttacagcataaatcaatttataccct rsp-rev1 atttctctctcctgcctaatatatattgaaatc rsp-rev2 caatatatattaggcaggagagagaaatatactaacagtcctcttgtgtttagtttc rsp-att2 ggggaccactttgtacaagaaagctgggtcattaaaccatgtggtacatcgtcatggtcaac agr-att1 tacttccaatccaatgttttagtgtgaataaaagtggcc agr-rev1 gatgaataattaattactttcattgtaaatttg agr-rev2 caatgaaagtaattaattattcatcacttacctatttaacgtttgtctacaaagttg agr-att2 ttatccacttccaatggtcactgtagtcatttatacgat Oligonucleotides for complementation Crsp-BamH ggcaggagagggatccatgacatgccaacttaaaatac Crsp-EcoR cacaagaggactgtgaattcttagcttggtttaaagc Oligonucleotides for qRT-PCR gyrB-F caaatgatcacagcatttggtacag gyrB-R cggcatcagtcataatgacgat ureA F gtggcggcggaagttg

ureA R cctcaggatgatttagtttcaaacc ureB F tcgaacgtgaaatggcatatg ureB R ccccaggttcaaatcgaaca ureD F ccgtatgaatgtgaatgtcgaaga ureD R cttgtatatttttgttgcaccttgaga ureG F agtcgtatcattggtgttgaaactg ureG R tctaataattcgtctattgctgcaaag argH F gtctgttgcaacttgatcgtttcta argH R tcggtgatgctggtggtaag fadD F cgcggcccatagctactg fadD R tcaacggcgaagatgatgaa fadE F aacgaccacacaccggtctac fadE R ccatccgaagtcgaaaatgc icaA-F cgcttgccatgtgttggat icaA-R tcacgcgttgcttccaaag icaB F agtcgcagaaaactatagcctatcct icaB R ccgtattttaacccagcttttttg icaC F gggtggatccttagtgttacaatttt icaC R actttttggtaattcaaggttgtcagt agrA F gcacatacacgcttacaattgttg agrA R acactgaattactgccacgttttaat agrC F gcaagttccgtcatgattatgtca agrC R ggcatgtcatcttctcgaatgtat agrD F atgaatacattatttaactta agrD R ttattcgtgtaattgtgttaattc hla-F aataactgtagcgaagtctggtgaaa hla-R gcagcagataacttccttgatcct hld-F ttcactgtgtcgataatccattttact hld-R ggagtgatttcaatggcacaag fnbA F tcgcgttactagcttccttagctt fnbA R cagccaagaacggcatcag Oligonucleotides for construction and purification of His-tag fusion protein Rsp-saII aggcaggagaggtcgacatgacatgccaacttaaaatac Rsp-pstI caagaggactgtctgcagttagcttggtttaaagc Oligonucleotides for EMSA agr promoter -F tacatttaacagttaagt agr promoter -R cattatattgcctaactgtag sarR promoter-F aacatagttggatagagtttcg sarR promoter -R gatgcacatcttgttgtagc ica promoter -F tttttataaccccctactgaaaatt ica promoter -R tttctttacctacctttcgttagtt Oligonucleotides for site-directed mutagenesis 176-179 mut-R acaagctgctgcagcgatgttgcaatgcatcgcta 176-179 mut-F atcgctgcagcagcttgttctaatctttttgttcg 182-185 mut-R atcgagcagcaagagcagaacaatatgattcagag

182-185 mut-F ttctgctcttgctgctcgatatttgagtatgaatt 191-192 mut-R ctttagcagccatactcaaatatcgaacaaaaaga 191-192 mut-F tatggctgctaaagattattttacaagtattaaac

Tab. S3. 20 KEGG pathways representing DAVID-enriched genes regulated by rsp (p<0.1) Category Term Count % PValue Fold

Enrichment sac03010 Ribosome 20 8.70 0.00 17.79 sae00290 Valine, leucine and isoleucine biosynthesis* 9 3.91 0.00 28.81 saw00330 Arginine and proline metabolism* 8 3.48 0.00 16.70 sar00190 Oxidative phosphorylation* 7 3.04 0.00 16.01 saa02010 ABC transporters 12 5.22 0.00 6.00 sae00230 Purine metabolism* 9 3.91 0.00 8.64 sae00910 Nitrogen metabolism* 6 2.61 0.00 16.95 saa02020 Two-component system* 8 3.48 0.00 8.17 sam00240 Pyrimidine metabolism* 7 3.04 0.00 8.20 sae00770 Pantothenate and CoA biosynthesis* 5 2.17 0.00 16.01 sah00791 Atrazine degradation 3 1.30 0.00 36.02 sae03020 RNA polymerase 3 1.30 0.00 36.02

saa00520 Amino sugar and nucleotide sugar metabolism 5 2.17 0.00 8.28

saa00052 Galactose metabolism 4 1.74 0.01 10.67 sax00970 Aminoacyl-tRNA biosynthesis 4 1.74 0.01 8.35 saa00620 Pyruvate metabolism 4 1.74 0.03 6.20 sae00340 Histidine metabolism 3 1.30 0.04 9.00 saa00550 Peptidoglycan biosynthesis 3 1.30 0.06 7.58 saa00051 Fructose and mannose metabolism 3 1.30 0.06 7.58 saa00260 Glycine, serine and threonine metabolism 3 1.30 0.08 6.26

* Pathways used for the construction of the biofilm-/virulence focused interaction network shown in Fig. 4A Tab. S4. Gene list of the final interaction relationship of rsp-regulated genes obtained by the STRING database Gene Gene number in

USA300 FPR3757 Product Factor of

regulation Down-regulated

aur SAUSA300_2572 zinc metalloproteinase aureolysin 12.32 accB SAUSA300_1564 acetyl-CoA carboxylase, biotin carboxyl carrier

protein 11.3

accC SAUSA300_1563 acetyl-CoA carboxylase, biotin carboxylase 6.17 cap5F SAUSA300_0157 capsular polysaccharide biosynthesis protein Cap5F 5.16 ddh SAUSA300_2463 D-lactate dehydrogenase 5.05 narJ SAUSA300_2341 respiratory nitrate reductase, delta subunit 4.95 nuc SAUSA300_0776 thermonuclease precursor 4.74 hisC SAUSA300_2610 histidinol-phosphate aminotransferase hisC 4.61 ureA SAUSA300_2238 urease, gamma subunit 4.49 phnE SAUSA300_0142 phosphonate ABC transporter, permease protein 4.36 bioD SAUSA300_2373 dethiobiotin synthase 4.33 fadE SAUSA300_0228 acyl-CoA synthetase FadE 4.20 cap5A SAUSA300_0152 capsular polysaccharide biosynthesis protein Cap5A 4.18 ureC SAUSA300_2240 urease, alpha subunit 4.13 sak SAUSA300_1922 staphylokinase precursor 4.09 hisG SAUSA300_2612 ATP phosphoribosyltransferase hisG 4.09 alsS SAUSA300_2166 alpha-acetolactate synthase 3.85 icaA SAUSA300_2600 intercellular adhesion protein A 3.82 ilvD SAUSA300_2006 dihydroxy-acid dehydratase 3.76 ilvC SAUSA300_2009 ketol-acid reductoisomerase 3.72 opuCD SAUSA300_2390 glycine betaine/carnitine/choline transport system

permease 3.67

rpoF SAUSA300_2022 RNA polymerase sigma-37 factor 3.61 cap5C SAUSA300_0154 capsular polysaccharide biosynthesis protein Cap5C 3.60 ureG SAUSA300_2243 urease accessory protein UreG 3.59 frp SAUSA300_2462 NAD(P)H-flavin oxidoreductase 3.49 rpmC SAUSA300_2196 50S ribosomal protein L29 3.48 cap5G SAUSA300_0158 capsular polysaccharide biosynthesis protein Cap5G 3.40 rplV SAUSA300_2199 50S ribosomal protein L22 3.38 rsbW SAUSA300_2023 anti-sigma-B factor, serine-protein kinase 3.36 gyrA SAUSA300_0006 DNA gyrase, A subunit 3.33 phnC SAUSA300_0144 phosphonate ABC transporter, ATP-binding protein 3.33 narH SAUSA300_2342 respiratory nitrate reductase, beta subunit 3.29 atpD SAUSA300_2058 ATP synthase F1, beta subunit 3.26 leuD SAUSA300_2013 3-isopropylmalate dehydratase, small subunit 3.25 cap5B SAUSA300_0153 capsular polysaccharide biosynthesis protein Cap5B 3.25 rpoC SAUSA300_0528 DNA-directed RNA polymerase, beta' subunit 3.24 rplR SAUSA300_2188 50S ribosomal protein L18 3.18 amt SAUSA300_1996 ammonium transporter 3.17 leuA SAUSA300_2010 2-isopropylmalate synthase 3.17 ureD SAUSA300_2244 urease accessory protein UreD 3.13 leuB SAUSA300_2011 3-isopropylmalate dehydrogenase 3.10 atpG SAUSA300_2059 ATP synthase F1, gamma subunit 3.07 bioA SAUSA300_2372 adenosylmethionine-8-amino-7-oxononanoate

transaminase 3.05

epiC SAUSA300_1765 lantibiotic epidermin biosynthesis protein EpiC 3.03 phnE SAUSA300_0143 phosphonate ABC transporter, permease protein 2.97

rsbV SAUSA300_2024 anti-sigma-B factor, antagonist 2.93 ureE SAUSA300_2241 urease accessory protein UreE 2.91 atpC SAUSA300_2057 ATP synthase F1, epsilon subunit 2.88 rplN SAUSA300_2194 50S ribosomal protein L14 2.84 ureF SAUSA300_2242 urease accessory protein UreF 2.84 ureB SAUSA300_2239 urease, beta subunit 2.81 atpA SAUSA300_2060 ATP synthase F1, alpha subunit 2.79 moaB SAUSA300_2226 molybdenum cofactor biosynthesis protein B 2.75 rplB SAUSA300_2201 50S ribosomal protein L2 2.75 fruB SAUSA300_0684 fructose 1-phosphate kinase 2.74 cysE SAUSA300_0514 serine acetyltransferase 2.72 epiB SAUSA300_1766 lantibiotic epidermin biosynthesis protein EpiB 2.70 moeA SAUSA300_2224 molybdopterin biosynthesis protein A 2.70 rpsE SAUSA300_2187 30S ribosomal protein S5 2.70 rpsN SAUSA300_2191 30S ribosomal protein S14 2.66 rplE SAUSA300_2192 50S ribosomal protein L5 2.62 rpsS SAUSA300_2200 30S ribosomal protein S19 2.60 leuC SAUSA300_2012 3-isopropylmalate dehydratase, large subunit 2.59 polA SAUSA300_1423 phage related DNA polymerase, family A 2.57 rpsH SAUSA300_2190 30S ribosomal protein S8 2.57 cap5M SAUSA300_0164 capsular polysaccharide biosynthesis protein Cap5M 2.56 gutB SAUSA300_0242 sorbitol dehydrogenase 2.54 nanA SAUSA300_0315 N-acetylneuraminate lyase subunit 2.54 gyrB SAUSA300_0005 DNA gyrase, B subunit 2.51 alaS SAUSA300_1575 alanyl-tRNA synthetase 2.50 opuCb SAUSA300_2392 glycine betaine/carnitine/choline ABC transporter 2.47 rplQ SAUSA300_2177 50S ribosomal protein L17 2.45 thrS SAUSA300_1629 threonyl-tRNA synthetase 2.44 opuCa SAUSA300_2393 glycine betaine/carnitine/choline ABC transporter

ATP-binding protein 2.43

ilvB SAUSA300_2007 acetolactate synthase, large subunit 2.40 rpsC SAUSA300_2198 30S ribosomal protein S3 2.39 menD SAUSA300_0946 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-

carboxylic acid synthase/2-oxoglutarate decarboxylase

2.36

upp SAUSA300_2066 uracil phosphoribosyltransferase 2.35 bccT SAUSA300_2549 choline/carnitine/betaine transporter, BCCT family 2.34 cap5N SAUSA300_0165 capsular polysaccharide biosynthesis protein Cap5N 2.34 rplW SAUSA300_2202 50S ribosomal protein L23 2.32 rplL SAUSA300_0525 ribosomal protein L7/L12 2.29 atpH SAUSA300_2061 ATP synthase F1, delta subunit 2.27 rpoB SAUSA300_0527 DNA-directed RNA polymerase, beta subunit 2.25 rplX SAUSA300_2193 50S ribosomal protein L24 2.24 rpmD SAUSA300_2186 50S ribosomal protein L30 2.23 rplF SAUSA300_2189 50S ribosomal protein L6 2.23

lacA SAUSA300_2155 galactose-6-phosphate isomerase 2.21 atpE SAUSA300_2063 ATP synthase F0, C subunit 2.21 cap5O SAUSA300_0166 capsular polysaccharide biosynthesis protein Cap5O 2.21 gltB SAUSA300_0445 glutamate synthase, large subunit 2.20 opuCc SAUSA300_2391 glycine betaine/carnitine/choline ABC transporter 2.19 rpsM SAUSA300_2180 30S ribosomal protein S13 2.19 fadD SAUSA300_0227 acyl-CoA dehydrogenase FadD 2.19 atl SAUSA300_0955 autolysin 2.19 lacC SAUSA300_2153 tagatose-6-phosphate kinase 2.19 lacB SAUSA300_2154 galactose-6-phosphate isomerase 2.18 hisC SAUSA300_0708 histidinol-phosphate aminotransferase 2.17 rplP SAUSA300_2197 50S ribosomal protein L16 2.17 argF SAUSA300_1062 ornithine carbamoyltransferase 2.15 nirB SAUSA300_2346 nitrite reductase [NAD(P)H], large subunit 2.12 narK SAUSA300_2333 nitrite extrusion protein 2.10 sbcC SAUSA300_1243 exonuclease SbcC 2.08 dapB SAUSA300_1289 dihydrodipicolinate reductase 2.08 ilvE SAUSA300_0539 branched-chain amino acid aminotransferase 2.08 infA SAUSA300_2182 translation initiation factor IF-1 2.07 oppD SAUSA300_0889 oligopeptide ABC transporter, ATP-binding protein 2.07 lytM SAUSA300_0270 peptidoglycan hydrolase 2.07 fusA SAUSA300_0532 translation elongation factor G 2.06 rpoA SAUSA300_2178 DNA-directed RNA polymerase alpha subunit 2.06 cysS SAUSA300_0515 cysteinyl-tRNA synthetase 2.05 fruA SAUSA300_0685 fructose specific permease 2.04 atpF SAUSA300_2062 ATP synthase F0, B subunit 2.03 cap5H SAUSA300_0159 capsular polysaccharide biosynthesis protein Cap5H 2.03

Up-regulated arcR SAUSA300_2566 transcriptional regulator, Crp/Fnr family 4.46 sirC SAUSA300_0115 iron compound ABC transporter, permease protein

SirC 4.12

arcD SAUSA300_2568 arginine/ornithine antiporter 3.80 arcC SAUSA300_2567 carbamate kinase 3.78 kdpC SAUSA300_2032 K+-transporting ATPase, C subunit 3.66 arcB SAUSA300_2569 ornithine carbamoyltransferase 3.49 pyrR SAUSA300_1091 PyrR bifunctional protein 3.22 mraW SAUSA300_1073 S-adenosyl-methyltransferase MraW 3.01 rpsB SAUSA300_1149 30S ribosomal protein S2 2.91 arcA SAUSA300_2570 arginine deiminase 2.88 ftsL SAUSA300_1074 cell division protein 2.77 nagA SAUSA300_0686 N-acetylglucosamine-6-phosphate deacetylase 2.76 hlgB SAUSA300_2367 gamma-hemolysin component B 2.72 tag SAUSA300_1612 DNA-3-methyladenine glycosidase 2.65 betA SAUSA300_2545 choline dehydrogenase 2.59 betB SAUSA300_2546 glycine betaine aldehyde dehydrogenase 2.57

pbuX SAUSA300_0387 xanthine permease 2.53 tagA SAUSA300_0623 teichoic acid biosynthesis protein 2.50 gcvT SAUSA300_1498 aminomethyltransferase (glycine cleavage system T

protein) 2.44

ndk SAUSA300_1358 nucleoside diphosphate kinase superfamily 2.43 epiF SAUSA300_1762 lantibiotic epidermin immunity protein F 2.37 trpS SAUSA300_0897 tryptophanyl-tRNA synthetase 2.28 sgtA SAUSA300_1676 probable transglycosylase 2.25 scrR SAUSA300_1995 sucrose operon repressor 2.22 epiE SAUSA300_1761 lantibiotic epidermin immunity protein F 2.21 tagG SAUSA300_0625 teichoic acid ABC transporter protein 2.17 hutG SAUSA300_2281 formimidoylglutamase 2.12 pth SAUSA300_0480 peptidyl-tRNA hydrolase 2.12 manA SAUSA300_2096 mannose-6-phosphate isomerase 2.10 phoP SAUSA300_1639 alkaline phosphatase synthesis transcriptional

regulatory protein PhoP 2.08

oppB SAUSA300_0895 oligopeptide ABC transporter, permease protein 2.07 mtnN SAUSA300_1558 5'-methylthioadenosine/S-adenosylhomocysteine

nucleosidase 2.02

agrD SAUSA300_1990 accessory gene regulator protein D 2.01 hla SAUSA300_1058 alpha-hemolysin precursor 2.00 hld SAUSA300_1988 delta-hemolysin precursor 2.00

Fig. S1. Growth curves of strains used in this study. Growth was measured by

determination of CFU during growth in TSB at 37°C under agitation. The BD02-25 series

is shown at the top; the MW2 series shown at the bottom.

Fig. S2. Biological processes and genes regulated by Rsp. Relationships of

differentially expressed (according to RNA Seq data) and DAVID-enriched genes. Circle

nodes represent genes, while rectangle nodes with blue border color indicate biological

processes. For genes, borders of the nodes represent the type of the gene (up-regulated in

red, down-regulated in green), the centers of the nodes indicate the gene expression

changes, and color intensity is proportional to the level of regulation. Protein-protein

interactions are depicted as grey solid lines.

Fig. S3. Prediction of Rsp-binding sites in the agrP2 and icaADBC promoters. The

DNA binding site of Rsp was first determined using alignment with similar proteins using

the NCBI database and the resulting consensus domain (predicted as

pfam00165: HTH_AraC) was used to predict the binding sites in the respective promoters

using RSA tools (http://rsat.ulb.ac.be/). The predicted repeated binding sequence in the

agrP2 promoter is shown at the top. In the icaADBC promoter analysis (bottom), the top

two predicted binding sites differ only by a 1-bp shift and represent a virtually identical

binding site.

Fig. S4. Purification of recombinant Rsp. E. coli SG13009 (pREP4) cells containing

the recombinant vector pQE-rsp were grown, induced and lysed as described in Materials

and methods. To assess production and purity, 10 µl each of the obtained culture filtrate

and the purified protein fraction were applied to the SDS-PAGE shown. The gel was

stained with Coomassie blue. Low-range molecular marker (Biorad) is on the left.

Fig. S5. Comparison of binding of Rsp to agrP2 and sarR promoters. An EMSA of

the agrP2 promoter and sarR promoter with Rsp protein is shown. The sarR promoter

fragment is 67 bp in length.