application of plant biotechnology-plant transformation (2010)
TRANSCRIPT
-
CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS451
Agrobacterium-mediated transformation
Guo-qing Song
-
f G D li S t mf Gene Delivery Systemy Agrobacteriumy Viral vectorsy Biolisticy Microinjectiony PEG - Polyethylene Glycol y PEG Polyethylene Glycol y Electroporation
2
-
Biolistic TransformationBiolistic Transformation------- Advantage and Disadvantage
f Advantage:
y This method can be use to transform all plant species.y No binary vector is required.
T f ti t l i l ti l i ly Transformation protocol is relatively simple.
f Disadvantage:g
y Difficulty in obtaining single copy transgenic events.y High cost of the equipment and microcarriersy High cost of the equipment and microcarriers.y Intracellular target is random (cytoplasm, nucleus, vacuole,
plastid, etc.).
3
y Transfer DNA is not protected.
-
Learning Objectives
Understand what key changes had to be made to the Agro tumor-inducing (Ti) or root-inducing (Ri) plasmid for the transfer of novel genes into plantsfor the transfer of novel genes into plants
Understand the binary plasmid transformation system
Understand some mechanisms of gene transfer
4
-
OUTLINECSS451
Agrobacterium Tumefaciens & Crown Gall Disease
MechanismMechanism ofof Gene Transfer using Gene Transfer using A. tumefaciensA. tumefaciensf Ti pl smidf Ti-plasmidf Chromosomal and Vir Genesf T-DNA Transferf T-DNA IntegrationEngineering binary vectors for plant transformation Engineering binary vectors for plant transformation
f T-DNA Integration
Transformation protocols using Transformation protocols using AgrobacteriumAgrobacterium
Factors influencing transformation efficiencyFactors influencing transformation efficiency
5
-
CSS451
Why Agrobacterium?
fAgrobacteria are naturally occurring, ubiquitous soil bornepathogens.
y A. tumefaciens causes crown gall disease (tumors)y A. rhizogenes causes root hair disease (hairy root)f Other bacterial groups also contain species capable of
f A b i f i A b i
g p p pinterkingdom genetic exchange (Gelvin 2005).
f Agrobacterium tumefaciens- or Agrobacterium rhizogenes-mediated transformation is to date the most commonly used method for obtaining
ltransgenic plants.
f The tumorigenic host plant species for range A. t f i i l d L b f di t d
6
tumefaciens include: Large number of dicots and some monocots and Gymnosperms.
-
CSS451
7
-
A.Tumefaciens & Crown Gall DiseaseA.Tumefaciens & Crown Gall DiseaseCSS451
8Stanton B. Gelvin. Nature 433: 583-584 (2005).
http://arabidopsis.info/students/agrobacterium/
-
Gene Transfer using AgrobacteriumGene Transfer using AgrobacteriumTiTi l idl id
GGCAGGATATTCAATTGTAAAT
TiTi--plasmidplasmid
GGCAGGATATTCAATTGTAAAT
GGCAGGATATTCAATTGTAAAT
Left T-DNA border
Right T-DNA border
9
Right and left border (RB, LB) sequences are the only parts ofT-DNA needed to enable transfer into plants-Removal of other T-DNA genes creates a disarmed Ti plasmid
-
Gene Transfer using AgrobacteriumGene Transfer using Agrobacterium
Agro typesAgro typesHellens et al (2000; Trends in Plant Science 5:446-451)
AgropineAgropine--typetype (strain EHA105::pEHA105): (strain EHA105::pEHA105): Carry genes for agropine synthesis and catabolism. Tumors do not differentiate and die out.
OctopineOctopine--typetype (strain LBA4404::pAL4404):(strain LBA4404::pAL4404):Carry genes(3 required) to synthesize octopine in the plant and catabolism in the bacteria plant and catabolism in the bacteria. Tumors do not differentiate, but remain as callus tissue.
NopalineNopaline--typetype (strain GV3101::pMP90 (pTiC58)):(strain GV3101::pMP90 (pTiC58)):NopalineNopaline typetype (strain GV3101::pMP90 (pTiC58)):(strain GV3101::pMP90 (pTiC58)):Carry gene for synthesizing nopaline in the plant and for utilization (catabolism) in the bacteria. Tumors can differentiate into shooty masses (teratomas).
10
-
Gene Transfer using AgrobacteriumGene Transfer using Agrobacterium
Agro typesAgro types
LBA4404: rifampicin (chromosomal) and streptomycin (on the Ti plasmid)
EHA105rifampicin (chromosomal) and streptomycin (on the Ti plasmid)
GV3101: streptomycin 500 mg/l
11Hellens et al (2000; Trends in Plant Science 5:446-451)
-
Gene Transfer using Gene Transfer using AgrobacteriumAgrobacteriumCSS451
h l d d GGChromosomal and vir genes of
bacterial cells are both
Chromosomal and Virand Vir GenesGenes
Virulence genes
bacterial cells are both involved in T-DNA transfer
gvir Avir Bvir C
Chemoreceptor, activator of vir G Transmembrane complexHost range specificityvir C
vir Dvir E
Host-range specificitySite-specific endonucleaseT-DNA processing and protection
vir Fvir G
Host range specificityPositive regulator of vir B, C, D, E, F
12
Chromosomal genes
Attachment to plant cell, vir gene regulation
-
Disarmed TiDisarmed Ti--plasmidplasmid
T-DNA
LB RBauxin cytokin opine
Oncogenic genes
vir genes ori opine catabolism
13
-
Disarmed TiDisarmed Ti--plasmidplasmid
LB RB
i i i t b livir genes ori opine catabolism
Disarmed Ti -plasmid
14
-
A Binary Vector MapA Binary Vector Map
15
-
A Binary Vector MapA Binary Vector Map
Plant selectable marker
KmR
Bacterial selectable marker
16From Dr. S. Gelvin, Purgue UniversityFrom Dr. S. Gelvin, Purgue University
-
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
ElectroporationElectroporationFreeze/ThawFreeze/ThawTriparental MatingTriparental MatingTriparental MatingTriparental Mating
Agrobacterium
17Competent Agrobacterial Cells
-
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
ElectroporationElectroporation
Freeze/ThawFreeze/ThawFreeze/ThawFreeze/Thaw
Liquid nitrogen (196C) 3 minLiquid nitrogen (196C) 3 min--------37C 30 min37C 30 min
18
-
Binary Vector SystemBinary Vector System
Agro only Agro/E Coli
Binary VectorBinary VectorTi Helper PlasmidTi Helper Plasmid
Agro only Agro/E. Coli
19Binary Vector SystemBinary Vector System
-
Plant selectable marker
KmR
Bacterial selectable marker
20
-
Introduction of Binary Vector into AgroIntroduction of Binary Vector into Agro
Agro cultureAgro colonies
Agro stock(-80C with Glycerol)
21
-
MechanismMechanism of Gene Transfer using of Gene Transfer using AgrobacteriumAgrobacteriumCSS451
External Signals such as
Acetosyringone
22Stanton B. Gelvin. Nature 433: 583-584 (2005)
Passage of T-DNA from Agrobacterium cells into plant genomic DNA
-
MechanismMechanism of of Gene Transfer using Gene Transfer using AgrobacteriumAgrobacterium------------ The Plant Cell StepThe Plant Cell Step
CSS451
Chromosomal and vir genes of bacterial cells are both involved in T-DNA transfer
The plant cell step of T-DNA transfer is poorly understood
Entry into plant cell?
Nuclear uptake?
Integration into chromosome?
23
-
CSS451
24
-
Expression of the TransgeneExpression of the TransgeneCSS451
External Signal
Cell Receptor
Regulatory Elements Promoter Gene Terminator
p
Where When How much
Go STOP
TranscriptionWhere When How much
Translation
mRNAConstitutive promoters: CaMV35S Actin Ubi
a stop codon (or termination Translation
Protein
CaMV35S, Actin, Ubi
Inducible prompters: rbcS
Tissue specific promoters: Cab
termination codon): UAG (in RNA) / TAG (in DNA) ("amber"), UAA / TAA ("ochre"), and UGA / TGA ("opal" or
25
ProteinTissue specific promoters: Cab UGA / TGA ( opal or "umber"
-
Summary: TSummary: T--DNA transferDNA transferSummary: TSummary: T--DNA transferDNA transferCSS451
1. Agrobacteria attach to plant cell surfaces at wound sites. g p2. The plant releases wound signal compounds, such as acetosyringone. 3. Vir C and/or Vir F recognize the host plant cells. 4. The signal binds to vir A on the Agrobacterium membrane. 5 Vir A with signal bound activates vir G 5. Vir A with signal bound activates vir G. 6. Activated vir G turns on other vir genes, including vir D and E. 7. Vir D cuts at a specific site in the Ti plasmid (tumor-inducing), the left
border. 8. Single stranded T-DNA is bound by vir E product as the DNA unwinds
from the vir D cut site. Binding and unwinding stop at the right border. 9. Vir B + T-DNA complex is transferred to the plant cell, where it
integrates in nuclear DNA integrates in nuclear DNA.
T-DNA codes for proteins that produce hormones and opines. Hormonesencourage growth of the transformed plant tissue Opines feed bacteria ----a
26Zhu et al. Journal of Bacteriology (2000)
encourage growth of the transformed plant tissue. Opines feed bacteria a carbon and nitrogen source.
-
Agrobacterium PreparationAgrobacterium Preparation
Agro-transformation Streak the plateTemperature: 30CTemperature: 30C Medium: LB Antibiotic: Km vector. Time: 2-3 days.
Temperature: 30C Medium: LB, YEB, or YEPAntibiotic: Km or based on the
i h
27
SMG in the vector. Time: 24-48 hr.Concentration: O.D.600=0.5-1.0
-
CSS451
Agrobacterium Protocols---TransformationAgrobacterium Protocols---Transformation
T b Ri Tobacco RiceRe-growth 4
Tobacco Rice Tobacco Rice
Inoculation1Molecular verification of gene 5
2
Molecular verification of gene presence & expression
Co-cultivation
5
PCR2
SouthernBlot
Selection and regeneration3 Flowering and setting seeds 6
28
-
The Floral Dip MethodCSS451
A good stage for floral dipping
Co-cultivation
A good stage for floral dipping
Infection
Seed setting Harvest seeds SelectionSeed setting Harvest seeds Selection
A b t i di t d t f ti f
29
Zhang et al. Nature Protocols 1(2) (2006)
Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method
-
Experiment 2: Tobacco Transformation
Objectives: To get familiar with A tumefaciens mediated transformation To get familiar with A. tumefaciens-mediated transformation,
such as explants, T-DNA, infection, co-cultivation, selection, binary vector, right border and left border, selectable marker gene (SMG), markers for screening, regeneration, antibiotics, and etcand etc.
To understand the differences between the wild-type T-DNA and the disarmed T-DNA.
30
-
Experiment 2: Tobacco Transformation CSS451
Agro strains: LBA4404:pBI121 & ACH5
1. LBA4404 has the Ach5 chromosomal background1. LBA4404 has the Ach5 chromosomal background
2. ACH5 (pTiAch5---a wild-type octopine plasmid)
3. LBA4404 (pAL4404---a disarmed octopine plasmid)
NOS-pro NPT II (KanR) NOS-ter 35S-pro GUS NOS-ter
pBI121
31LBA 4404 with the Ach5 chromosomal background exhibits clumping
-
CSS451
Experiment 2
Plant materials: Tobacco cv. Samsun
Seeds Seed germination Seedling Plant
Mature seeds harvested from wild type tobacco plant cv. Samsun
Sterile seedling was maintained in Magenta box GA7 containing 50 mlplant cv. Samsun
1. Surface sterilization (50% clorox + 0.02% Tween 20, 15 min; 4 washes in sterile water).
Magenta box GA7 containing 50 ml MS medium. Subcuture cy cutting the internodes. Culture conditions: 25C, 16 h-
32
2. Seed germination on MS medium. ,
photoperiod, 35-50 E m-2s-1.
-
Explant preparation 1 Explant size: 0 5-0 8 cm X 0 5-0 8 cm
Experiment 2Explant preparation 1. Explant size: 0.5-0.8 cm X 0.5-0.8 cm.
2. To prepare the explants using sterile techniques. 3. Do not let the explants too dry.
1Inoculation 1. Agro concentration: O.D.600 = 0.5-0.8.
2. Infection time: 10-15 min.
2
3. Infection medium: Regeneration medium (RM)4. Acetosyringone (Ac): 100 M
Co cultivation 1 Co cultivation medium: RM2 Co-cultivation2-3 d A. tumefaciens5 d S. meliloti5 d M. loti5-11Rhizobium sp. NGR234
1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3. Environmental conditions: in the dark4 Ac: 100 M
3
5 11Rhizobium sp. NGR234 4. Ac: 100 M
Selection and regeneration
1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn
33
2. Subculture: every 3 wk
-
CSS451
Explant preparation 1. Segments from hypocotyl, cotyledons, epicotyl, leaf, internodes and petiole (Dicot)
2 E b i ll (M t)2. Embryogenic calluses (Monocot)3. Well developed regeneration system via either
organogenesis or somatic embryogenesis Inoculation 1 Agro concentration: O D 0 5 0 8Inoculation 1. Agro concentration: O.D.600 = 0.5-0.8.
2. Infection time: 10-15 min.3. Infection medium: Regeneration medium (RM)4 A t i (A ) 100 M4. Acetosyringone (Ac): 100 M
Co-cultivation2-3 d A. tumefaciens5 d S. meliloti
1. Co-cultivation medium: RM2. Co-cultivation time: 2-4 d 3 i l di i i h d k5 d M. loti
5-11Rhizobium sp. NGR2343. Environmental conditions: in the dark4. Ac: 100 M
Selection and ti
1. Selection medium: RM + 100 mg/l Km + 500 mg/l Tn
34
regeneration 2. Subculture: every 3 wk
-
CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS/HRT 451 CSS451
Biolistic-mediated transformation
GuoGuo--qingqing Song Song GuoGuo--qingqing Song Song
-
f G D li S t mf Gene Delivery Systemy Agrobacteriumy Viral vectorsy Biolisticy Microinjectiony PEG - Polyethylene Glycol y PEG Polyethylene Glycol y Electroporation
-
Biolistic TransformationBiolistic Transformation------- Advantage and Disadvantage
f Advantage:
y This method can be use to transform all plant species.y No binary vector is required.
T f ti t l i l ti l i ly Transformation protocol is relatively simple.
f Disadvantage:g
y Difficulty in obtaining single copy transgenic events.y High cost of the equipment and microcarriersy High cost of the equipment and microcarriers.y Intracellular target is random (cytoplasm, nucleus, vacuole,
plastid, etc.).y Transfer DNA is not protected.
-
Gene Delivery System------Biolistic-mediated transformation
Known as:
Particle BombardmentParticle BombardmentBiolisticsMicroprojectile bombardmentParticle accelerationParticle inflow gunGene gun
Using a gene gun directly shoots a piece of DNA into the recipient plant tissue.
T t ld b d t d i th f i t tTungsten or gold beads are coated in the gene of interestand fired through a stopping screen, accelerated by Helium, into the plant tissue. The particles pass through the plant cells leaving the DNA insidecells, leaving the DNA inside.
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Mechanism
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment
The Helios Gene GunPDS 1000/He The Helios Gene Gun
http://www.oardc.ohio-state.edu/plantranslab/PIG.htm
www.bio-rad.com/genetransfer/
PDS-1000/He
Particle Inflow Guns (PIG)
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- PDS-1000/He
PDS-1000/He
DNA-coated microcarriers are loaded on microcarrier.Micro-carriers are shot towards Micro-carriers are shot towards target tissues during helium gas decompression. A stopping screen placed allowing
www.bio-rad.com/genetransfer/
A stopping screen placed allowing the coated microprojectiles to pass through and reach the target cells.
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- PDS-1000/He References
Arnold D et al., Proc Natl Acad Sci USA 91, 99709974 (1994)Castillo AM et al Biotechnology 12 13661371 (1994)Castillo AM et al., Biotechnology 12, 1366 1371 (1994)Duchesne LC et al., Can J For Res 23, 312316 (1993)Fitzpatrick-McElligott S, Biotechnology 10, 10361040 (1992)p g , gy , ( )Hartman CL et al., Biotechnology 12, 919923 (1994)Heiser WC, Anal Biochem 217, 185196 (1994)Lo DC et al., Neuron 13, 12631268 (1994)Sanford JC et al., Technique 3, 316 (1991)Sh k KB t l 480 485 (1991)Shark KB et al., 480485 (1991)Smith FD et al., J Gen Microbiol 138, 239248 (1992)Svab Z and Maliga P Proc Natl Acad Sci USA 90 913917 (1993)Svab Z and Maliga P, Proc Natl Acad Sci USA 90, 913 917 (1993)Toffaletti DL et al., J Bacteriol 175, 14051411 (1993)
www.bio-rad.com/genetransfer/
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- Particle Inflow Gun
Finer JJ, P Vain, MW Jones, MD McMullen (1992) Development of the particle inflow gun for DNA delivery to plant cells. Plant Cell Reports 11:232-238.V i P N K J M ill C R h C N JJ Fi (1993) Vain P, N Keen, J Murillo, C Rathus, C Nemes, JJ Finer (1993) Development of the Particle Inflow Gun. Plant Cell Tiss Org Cult 33:237-246.
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Equipment- Helios Gene Gun
www.bio-rad.com/genetransfer/
f The helium pulse sweeps the DNA- or RNA-coated gold f The helium pulse sweeps the DNA or RNA coated gold microcarriers from the inside wall of the sample cartridge.
f The microcarriers accelerate for maximum penetration as they f The microcarriers accelerate for maximum penetration as they move through the barrel, while the helium pulse diffuses outward.
f The spacer maintains the optimal target distance for in vivo f The spacer maintains the optimal target distance for in vivo applications and vents the helium gas away from the target to minimize cell surface impact.
-
BiolisticBiolistic--Mediated Gene TransferMediated Gene Transfer------- Helios Gene Gun System References
Fynan EF et al., DNA vaccines: Protective immunizations by parenteral, mucosal, and gene-gun inoculations, Proc Natl Acad Sci USA 90, 1147811482 (1993)9 , ( 99 )
Qiu P et al., Gene gun delivery of mRNA in situ results in efficient transgene expression and genetic immunization, Gene Ther 3, 262268 (1996)
Sun WH et al., In vivo cytokine gene transfer by gene gun reduces t th i i P N tl A d S i USA 92 2889 2893 (1995)tumor growth in mice, Proc Natl Acad Sci USA 92, 28892893 (1995)
Sundaram P et al., Particle-mediated delivery of recombinant expression vectors to rabbit skin induces high titered polyclonal expression vectors to rabbit skin induces high-titered polyclonal antisera (and circumvents purification of a protein immunogen), Nucleic Acids Res 24, 13751377 (1996)
www.bio-rad.com/genetransfer/
Tang DC et al., Genetic immunization is a simple method for eliciting an immune response, Nature 356, 152154 (1992)
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation------- Parameters
A number of parameters has been d f d d d b d d identified and need to be considered carefully in experiments involving particle bombardmentparticle bombardment
Parameter categories:Parameter categories:
- Physical parametersBiological parameters- Biological parameters
- Environmental parameters
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation
Ph i l t------- Parameters
- Physical parametersf Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNA
Particles should be high enough mass in order to possess adequate momentum to penetrate into appropriate tissue.
Suitable metal particles include gold, tungsten, palladium, rhodium,platinum and iridium.
Metals should be chemically inert to prevent adverse reaction with
Additional desirable properties for the metal include size and shape, ll l ti d di i ti di t 0 36 6
Metals should be chemically inert to prevent adverse reaction withDNA and cell components.
as well as agglomeration and dispersion propertiesdiameter 0.36-6m.f Nature, preparation and binding of DNA onto the particlesfTarget tissue
- Biological parameters- Environmental parameters
fTarget tissue
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation
Ph i l t------- Parameters
- Physical parametersf Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNA
Th t f DNA ( i l d bl t d d i l li i d
f Nature, preparation and binding of DNA onto the particles
The nature of DNA (single vs double stranded, circular vs linerizedDNA). Optimal: double stranded circular DNA molecules (e.g. plasmid)
In the process of coating the metal particls with DNA certain additivesh d d d C Cl b f l such as spermididne and CaCl2 appear to be useful.
fTarget tissue
- Biological parameters- Environmental parameters
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation
Ph i l t------- Parameters
- Physical parametersf Nature, chemical and physical properties of the metal particles used as
a macrocarrier for the foreign DNAf Nature, preparation and binding of DNA onto the particlesfTarget tissue It is important to target the appropriate cells that are competent for
both transformation and regeneration.
Depth of penetration is one of the most important variables in order to Depth of penetration is one of the most important variables in order toachieve particle delivery to particular cells.
- Biological parameters- Environmental parameters
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation
Ph i l t------- Parameters
- Physical parameters- Biological parametersfTemperature, photoperiod and humidity
These parameters have a direct effect on the physiology of tissues.
Such factors will influence receptiveness of target tissue to foreign DNA delivery and also affect its susceptibility to damage and injury DNA delivery and also affect its susceptibility to damage and injury that may adversely affect the outcome of transformation process.
Some explants may require a healing period after bombardment underspecial regiments of light temperature and humidityspecial regiments of light, temperature, and humidity.
- Environmental parameters
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation
Ph i l t------- Parameters
- Physical parameters- Biological parameters
E i l- Environmental parameters
Nature of explants as well as pre- and post-bombardment culture conditions.
Explants derived from plants that are under stress will provide inferior materials for bombardment experiments.
Metal particles need to be directed to the nucleus. Transformation frequencies may also be influenced by cell cycle stage.
O f h l b h b f Osmotic pretreatment of target tissues has also been shown to be of importance.
Physical trauma and tungsten toxicity were found to reduce efficiencyf tr nsf rm ti n in experiments perf rmed ith t b cc cell of transformation in experiments performed with tobacco cell
suspension culture.
-
Biolistic TransformationBiolistic TransformationBiolistic TransformationBiolistic Transformation------- Summary
For biolistic transformation, tungsten or gold particles are coated with DNA and accelerated ptowards target plant tissues. Most devices use compressed helium as the force to accelerate the particles.particles.
The particles punch holes in the plant cell and ususally petetrate only 1-2 cell layerswall . Particle y p y ybombardment is a physical method for DNA introduction.
h d l d h The DNA-coated particles can end up either near or in the nucleus,where the DNA comes off the particles and integrated into plant chromosomal DNA.