ap biology 2006-2007 quickie intro to dna technologies
TRANSCRIPT
![Page 1: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/1.jpg)
AP Biology 2006-2007
Quickie Intro to DNA Technologies
![Page 2: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/2.jpg)
AP Biology
Watson and Crick1953 article in Nature
![Page 3: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/3.jpg)
AP Biology
Double helix structure of DNA
![Page 4: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/4.jpg)
AP Biology
Cut DNA Restriction enzymes
restriction endonucleases discovered in 1960s evolved in bacteria to cut up foreign DNA
“restriction” protection against viruses & other bacteria
bacteria protect their own DNA chemically & by not using the base sequences recognized by the enzymes in their own DNA
![Page 5: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/5.jpg)
AP Biology
Discovery of restriction enzymes1960s | 1978
Werner Arber Daniel Nathans Hamilton O. Smith
Restriction enzyme movie
Restriction enzymes are named for the organism they come from:EcoR1 = 1st restriction enzyme found in E. coli
![Page 6: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/6.jpg)
AP Biology
Restriction enzymes Action of enzyme
cut DNA at specific sequences restriction site
symmetrical “palindrome” produces protruding ends
sticky ends
Many different enzymes named after organism they are found in
EcoR1, HindIII, BamH1, Sma1
Madam I’m Adam
CTGAATTCCGGACTTAAGGC
CTG|AATTCCGGACTTAA|GGC
![Page 7: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/7.jpg)
AP Biology
AATTC
AATTC
AATTC
GAATTC
G
G
GG
G
GAATTC
CTTAAG
GAATTCCTTAAG
CTTAA
CTTAA
CTTAAG
DNA ligasejoins the strands.
DNA
Sticky ends (complementarysingle-stranded DNA tails)
Recombinant DNA molecule
AATTCGG
CTTAA
Biotech use of restriction enzymes
Restriction enzymecuts the DNA
Add DNA from another source cut with same restriction enzyme
![Page 8: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/8.jpg)
AP Biology
Paste DNA Sticky ends allow:
H bonds between complementary bases to anneal
Ligase enzyme “seals”
strands bonds sugar-
phosphate bonds covalent bond of
DNA backbone
![Page 9: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/9.jpg)
AP Biology
Gel Electrophoresis Separation of DNA fragments by size
DNA is negatively charged moves toward + charge in electrical field
agarose gel “swimming through Jello” smaller fragments move faster
cut DNA with restriction enzymes
![Page 10: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/10.jpg)
AP Biology
Gel Electrophoresis
![Page 11: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/11.jpg)
AP Biology
Gel Electrophoresis
![Page 12: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/12.jpg)
AP Biology
![Page 13: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/13.jpg)
AP Biology
Measuring fragment size compare bands to a known “standard”
usually lambda phage virus cut with HindIII nice range of sizes with a distinct pattern
![Page 14: AP Biology 2006-2007 Quickie Intro to DNA Technologies](https://reader035.vdocuments.mx/reader035/viewer/2022062800/56649e0c5503460f94af5b65/html5/thumbnails/14.jpg)
AP Biology
And from that comes a host of…
Biotech Tools