anti-hyperalgesic properties of a flavanone derivative ...€¦ · ruqayya afridi1, ashraf ullah...

RESEARCH ARTICLE Open Access

Anti-hyperalgesic properties of a flavanonederivative Poncirin in acute and chronicinflammatory pain models in miceRuqayya Afridi1, Ashraf Ullah Khan1, Sidra Khalid1, Bushra Shal1, Hina Rasheed1, Muhammad Zia Ullah1,Omer Shehzad2, Yeong Shik Kim3 and Salman Khan1,3*

Abstract

Background: Poncirin is flavanone derivative (isolated from Poncirus trifoliata) with known pharmacologicalactivities such as anti-tumor, anti-osteoporotic, anti-inflammatory and anti-colitic. The present study aimed toexplore the anti-allodynic and anti-hyperalgesic potentials of poncirin in murine models of inflammatory pain.

Methods: The analgesic potential of poncirin was evaluated in formalin-, acetic acid-, carrageenan- and CompleteFreund’s Adjuvant (CFA)-induced inflammatory pain models in mice. Anti-allodynic and anti-hyperalgesic activitieswere measured using Von Frey filaments, Randall Selitto, hotplate and cold acetone tests. The serum nitrite levelswere determined using Griess reagent. The Quantitative Real-time PCR (qRT-PCR) was performed to assess theeffect of poncirin on mRNA expression levels of inflammatory cytokines and anti-oxidant enzymes.

Results: Intraperitoneal administration of poncirin (30 mg/kg) markedly reduced the pain behavior in both aceticacid-induced visceral pain and formalin-induced tonic pain models used as preliminary screening tools. Theponcirin (30 mg/kg) treatment considerably inhibited the mechanical hyperalgesia and allodynia as well as thermalhyperalgesia and cold allodynia. The qRT-PCR analysis showed noticeable inhibition of pro-inflammatory cytokines(mRNA expression levels of TNF-α, IL-1β and IL-6) (p < 0.05) in poncirin treated group. Similarly, poncirin treatmentalso enhanced the mRNA expressions levels of anti-oxidant enzymes such as transcription factor such as nuclearfactor (erythroid-derived 2)-like 2 (Nrf2) (p < 0.05), heme oxygenase (HO-1) (p < 0.05) and superoxide dismutase(SOD2) (p < 0.05). Chronic treatment of poncirin for 6 days did not confer any significant hepatic and renal toxicity.Furthermore, poncirin treatment did not altered the motor coordination and muscle strength in CFA-inducedchronic inflammatory pain model.

Conclusion: The present study demonstrated that poncirin treatment significantly reduced pain behaviors in allexperimental models of inflammatory pain, suggesting the promising analgesic potential of poncirin ininflammatory pain conditions.

Keywords: Poncirin, Inflammatory pain, Cytokines, Hyperalgesia, Allodynia

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

* Correspondence: [email protected]; [email protected] of Pharmacy, Faculty of Biological Sciences, Quaid-i-AzamUniversity, Islamabad, Pakistan3College of Pharmacy, Seoul National University, Seoul 151-742, South KoreaFull list of author information is available at the end of the article

Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 https://doi.org/10.1186/s40360-019-0335-5

http://crossmark.crossref.org/dialog/?doi=10.1186/s40360-019-0335-5&domain=pdf

http://creativecommons.org/licenses/by/4.0/

http://creativecommons.org/publicdomain/zero/1.0/

mailto:[email protected]

mailto:[email protected]

BackgroundPain is the major protective response that is initiated byperipheral sensory neurons to protect the organism fromany harm by infection or tissue injury [1]. Pain helps thebody to take corrective actions in the presence of anynoxious stimuli. However, the presence of pain is notalways beneficial, in certain clinical scenarios; painincreases the suffering when there is a dysfunction innociceptive pathways for example in neuropathic painand abnormal central amplifications syndromes [1].Inflammatory pain results whenever injury to the tissuesensues, causing the release of inflammatory mediators,which decreases pain threshold by increasing thetransduction of painful stimuli [2]. These inflammatorymediators including tumor necrosis factor-α (TNF-α),interleukin-1β (IL-1β) and IL-6, reduces pain thresholdby directly sensitizing nociceptors and causing its in-creased responsiveness leading to a state of hyperalgesiaand allodynia [3, 4]. In addition to directly activatingnociceptive fibers, these cytokines also potentiate theinflammatory responses and increase the release ofproalgesic agents including nerve growth factor (NGF),extracellular protons, bradykinin, and prostaglandins,resulting in pain hypersensitivity [5]. These inflamma-tory mediators are also linked with an increased tran-scription of various inflammatory genes throughtranscription factors including mitogen activated proteinkinases (MAPKs), cAMP response element-bindingprotein (CREB) and Nuclear factor kappa B (NF-κB),which further aggravates the immune and pain re-sponses by altering the neuronal threshold [5–7].Although, painful conditions either acute or chronic

inflammatory pain, constitute a major health prob-lem. There is still need for safe and effective therapeuticoptions. For example, non-steroidal anti-inflammatorydrugs (NSAIDs) are widely used for the management ofinflammatory pain conditions, are unable to completelyabolish pain and are associated with several serious ad-verse effects including gastrointestinal bleeding andrenal toxicity [8]. On the other hand, opioid analgesicrepresents a potent class of analgesics are also associatedwith major adverse effects including physical and psy-chological dependence, lethargy, euphoria, respiratorydepression [8]. Current therapies available for treatingacute and chronic inflammatory are inadequate andthere is a need of newer and safer analgesics and anti-in-flammatory drugs, that have better efficacy and tolerabil-ity [9, 10].Medicinal plants have been used for centuries for pain

management, which can be used as a potential sourcefor the development of novel analgesics for treating pain[11]. Poncirin is a flavanone derivative obtained fromdried immature fruits of Poncirus trifoliata. Poncirustrifoliata belongs to genus Citrus, which have been used

in Chinese medicine for the treatment of asthma and in-flammation [12]. Several studies reported that poncirinexhibit anti-inflammatory [13], anti-tumor [14], anti-osteoporotic activity [15] and anti-colitic properties(Kang and Kim 2016). Therefore, in the present studyvarious animal models of pain were carried out to assessthe anti-allodynic, anti-hyperalgesic and anti-nociceptiveproperties of poncirin as a potential new analgesic totreat different types of inflammatory pain.

MethodsChemicals and reagentsCarrageenan, Complete Freund’s adjuvant (CFA), forma-lin, acetic acid, dexamethasone, Griess reagent, acetone,piroxicam, and poncirin were obtained from Sigmachemical company (St. Louis, MO, USA). Trizol reagentwas obtained from Invitrogen (USA).

Ethics approval and consent to participateAll procedures were complied with “Animal care guide-lines of QAU” Islamabad. The study was also approvedby Bioethical Committee (Approval No: BEC-FBS-QAU2017–2) of QAU University, Islamabad. All the experi-ments were designed to cause minimum harm toanimals.

AnimalsAll experiments were performed on male albino (BALB/c mice, 4–5 weeks of age, weighing 25–30 g), purchasedfrom National Institute of Health (NIH), Islamabad,Pakistan. All behavioral assays were carried out in patho-gen-free environment of laboratory of Pharmacology, De-partment of Pharmacy, QAU, Islamabad, Pakistan. Sevenanimals were housed per cage in controlled temperatureand humidity, with free access to food and water. All ex-periments were performed between 8:00 a.m. to 6:00 p.m.During the current study, fresh/separate set of animalswere procured for each model (acetic acid, formalin, carra-geenan and CFA) and used once as per institutional ethicalguidelines.

Experimental groups and treatment protocolsThe animals were randomly arranged into variousgroups and each group consists of 6–7 animals. The ve-hicle control received only normal saline with 2% DMSOand no other treatment or inducer was given. The nega-tive control group received either acetic acid, formalin,Carrageenan or CFA and no other treatment was admin-istered. The positive control either received Piroxicam(in case of formalin and acetic acid-induced models),while dexamethasone was administered in case of theCarrageenan and CFA-induced inflammatory models.The treatment control received the poncirin at three dif-ferent doses such as 5mg/kg, 15 mg/kg and 30mg/kg in

Afridi et al. BMC Pharmacology and Toxicology (2019) 20:57 of 16

case of formalin, acetic acid and Carrageenan-inducedmodels, while only 30 mg/kg dose was administered toonly CFA-induced models. The inclusion and exclusioncriteria was followed as reported previously [16]. Theanimals were anesthetized with the Xylazine + ketamineinjection (16 mg + 60mg, i.p) to avoid distress to themice (to make them unconscious and reduce the painfulfeeling associated with the euthanasia) and then CO2chamber was used to euthanize the mice. Theinstitutional ethical committee regulated the overallprocess of euthanasia. Prior to the disposal, the animaldeath was confirmed by observing the movement, heart-beat, respiration and eye reflex.

Randomization, blinding and sample size selectionThe animals were assigned to various groups randomlyas reported previously [16]. Similarly, to avoid experi-mental biasness double blindness was maintained duringthe whole experiment as mentioned [16]. The samplesize (n = 6–7) was selected according to the previouslyestablished protocols [16–19]. At the end of the experi-ments the mice were euthanized using CO2 chamber.

Acetic acid-induced visceral pain modelAcetic acid-induced writhing test was performed in miceas described previously [20]. The acetic acid-inducedpain model simulate the visceral pain model and initi-ated by the release of inflammatory mediators, whichtrigger the sensitization of the sensitization of nocicep-tors [20, 21]. Briefly, acetic acid (0.8% v/v, 10 ml/kg) wasinjected into peritoneal cavity of the mice. Mice werethen placed in large glass cylinder (10 cm diameter) andwrithing response was measured i.e. number of writhesoccurring between 0 and 30min after acetic acid injec-tion. Drugs were administered by i.p route 40 min priorto acetic acid induction, control group was treated withvehicle (2% DMSO in 300 μl saline, i.p), positive controlwas treated with piroxicam (5 mg/kg, i.p) and thetreatment group received poncirin (5 mg/kg, 15 mg/kgor 30mg/kg, i.p).

Formalin-induced tonic pain modelPaw licking was induced by intraplantar injection of for-malin as described previously with some modification[22]. Before the initiation of formalin-induction, themice were transferred to the formalin testing boxes andobserved for 30 min. Following the induction of the for-malin-induced nociception, animals were furtherobserved for 30 min and the total time taken was 60minas reported previously with necessary modification [23].Mice were observed for first 10 min (early phase) andfrom 10 to 30 min (late phase) and total time spent inlicking the injected paw was calculated for both phases.The mice were administered drugs through i.p. route 40

min prior to formalin induction. Control group wastreated with vehicle (2% DMSO in 300 μl saline, i.p) andpositive control was treated with piroxicam (5 mg/kg),while treatment group received poncirin (5 mg/kg, 15mg/kg or 30mg/kg, i.p).

Carrageenan-induced acute inflammatory pain modelThe anti-inflammatory potential of the poncirinagainst the Carrageenan-induced inflammatory modelwas explored [24]. The animals were randomlydivided into various groups as described above. TheCarrageenan-induced inflammation was established byinjecting 1% carrageenan solution into the right hindpaw as reported [24].

Assessment of mechanical hyperalgesia in carrageenan-induced inflammatory painThe mechanical hyperalgesia test was performed byusing Randall Selitto (Digital Paw Pressure RandallSelitto Meter, IITC Life Science Inc. Wood land Hills,CA) according to the method described previously[24–26]. Animals were pretreated with poncirin (30mg/kg) or vehicle (2% DMSO in 300 μl saline, i.p) ordexamethasone (5 mg/kg) 1 h before the injection ofcarrageenan (100 μg/paw). The anti-hyperalgesicresponse of poncirin was recorded 4 h after the carra-geenan injection.

Assessment of mechanical allodynia in carrageenan-treated miceIn order to evaluate the anti-allodynic effects of poncirinin acute inflammatory pain model was noted 4 h aftercarrageenan injection (100 μg /paw). One day before theexperiment, baseline withdrawal threshold was deter-mined for all animals. On the day of the experiment,animals were treated with poncirin (30 mg/kg) orvehicle (2% DMSO in 300 μl saline, i.p) ordexamethasone (5 mg/kg) 1 h before the injection ofcarrageenan. Mechanical allodynia was measured inall the treated groups using previously describedprotocol [27, 28].

Assessment of thermal hyperalgesia in carrageenan-treated miceSpontaneous nociception to heat stimuli was measuredaccording to previously described methods [29]. Micewere placed in quiet room 30min before starting the testand were observed for the signs of the nociceptionincluding licking of the hind paws. The response latencywas considered as nociceptive behavior with a cut offtime of 35 s, in order to avoid any tissue damage.


Paw edema test in carrageenan-treated micePaw edema was measured in carrageenan-inducedinflammatory pain model according to the methodspreviously described [26, 28]. Briefly, paw thickness wasmeasured by using a dial thickness gauge (No. 2046F,Mitutoyo, Kawasaki, Japan) one day before and aftercarrageenan (100 μg/paw) administration for all thetreated groups.

CFA-induced chronic inflammatory pain modelFor the evaluation of anti-hyperalgesic activity of pon-cirin in chronic inflammatory pain model, CFA-inducedpain model was employed [28, 30]. For the evaluation ofthe effect of poncirin on acute inflammation and pain,readings were taken at 2, 4 and 6 h post CFA injection.While to investigate the effect of chronic treatment ofponcirin on mechanical and thermal sensitivity, micewere treated with poncirin once a day for the period of6 days. However, the dose of poncirin was skipped at day5 in order to check any tolerance effects (to see whetherthe effect of the drug remains persistent or it should beadministered daily to achieve the response) as describedpreviously [28].

Assessment of mechanical hyperalgesia and allodyniainduced by CFATo evaluate mechanical hyperalgesia induced by CFA,mice were treated with poncirin (30 mg/kg), vehicle (2%DMSO in 300 μl saline, i.p) or dexamethasone (5 mg/kg)by intra peritoneal route 40 min before the injection ofCFA (20 μl/paw). One day before the experiment,baseline withdrawal threshold was determined for all an-imals. For the evaluation of acute effects of poncirin onpain profile, readings were taken at 2, 4 and 6 h postCFA injection. Mechanical hyperalgesia was measuredby Randall Selitto (Digital Paw Pressure Randall SelittoMeter, IITC Life Science Inc. Wood land Hills, CA),while mechanical allodynia was measured using von Freyhair filament.

Assessment of thermal hyperalgesia induced by CFAHotplate test was carried out in mice model of CFAinduced inflammatory pain as described previously[29]. One day before the experiment, baseline with-drawal threshold was determined for all animals.Readings were taken at 2, 4 and 6 h post CFA injec-tion in order to evaluate the effect of poncirin in theacute phase, while readings were taken for 6 consecu-tive days for the chronic study. The dose of the pon-cirin was skipped at day 5 to assess the toleranceeffect as reported previously [28].

Assessment of cold allodynia in CFA-treated mice-coldacetone testCold acetone test was carried out in mice model ofCFA-induced inflammatory pain as described previously[31, 32]. One day before the experiment, baselinewithdrawal threshold was determined for all animals.Mice were placed in glass cylinders, and the noxiouscold stimulus was applied in form of brief spray of acet-one to the ventral surface of the right hind paw. Thenociceptive response, which included licking or biting,was measured for 25 s as mentioned earlier [28].

Muscle strength and motor activityThe muscle strength of mice was determined by usingweights test and Kondziela’s inverted screen tests, inorder to assess the effect of poncirin on motor activityof mice [33]. In Kondziela’s screen test, each mouse wasplaced in the center of wire mesh screen and the screenwas inverted, which was held 40–50 cm above the pad-ded surface. Time taken by mice to hold the invertedscreen was recorded using a digital stopwatch and scorewas assigned according to the protocol described else-where [33]. Weight test was performed for measuringmuscle strength according to the protocol describedpreviously [33].

Biochemical assaysSerum nitrite determinationGriess reagents was used to determine the serum nitricoxide (NO) as reported previously [34, 35]. The bloodwas centrifuged at 2500 rpm for 10min following collec-tion of the blood directly from the cardiac puncture andNO was determined as described [34, 35].

Extraction of mRNA and q-RT-PCRAt day 6 of the CFA administration the animals wereanesthetized with Xylazine + ketamine (16 mg + 60 mg,i.p) to remove the paw tissue. Following removal of pawtissue, the animals were euthanized in the CO2 chamber[36]. Mice paw were used for the extraction of totalRNA using Trizol Reagent according to manufacturerinstructions (Invitrogen Life Technologies, Carlsbad,CA, USA) as described previously [28]. Briefly, q-RT-PCR analysis for various target genes (TNF-α, IL-1β,IL-6, Nrf2, HO-1, SOD2, VEGF, β-actin) mRNA wasperformed using Applied Biosystems (AB) detectioninstruments and software as described previously [28].The forward and revere primers used are listed in theTable 1.

Renal and liver toxicityBiochemical tests were performed using serum samplesfor assessment of RFTs and LFTs (Renal function testsand liver function tests) at day 6 of the CFA


administration. Serum Aspartate Aminotransferase(AST), Alanine Aminotransferase (ALT) and creatinineconcentration were determined as indicators of liver andkidney functions respectively [37, 38].

Histopathological and X-ray examination of inflamed pawsTo observe the effect of daily treatment of poncirin onmice paw tissue, histopathological and radiological ana-lysis of the paw tissues were performed [21]. At day 6 ofthe CFA administration the animals were anesthetizedwith Xylazine + ketamine (16 mg/kg + 60mg/kg, i.p) andwere euthanized in the CO2 chamber as mentioned [21].After removal, each paw was washed using saline andthen fixed in 10% formalin solution, dehydrated andembedded in paraffin according to the methods de-scribed previously [21]. Paw tissue blocks sections weremade of 4 μm thickness, stained with hematoxylin-eosinand observed by microscopy (40×) as per reportedprotocols [21]. Similarly, the X-ray analysis (Philips 612machine 40 kW for 0.01 s) was performed as to assessthe soft tissue swelling and bone erosion as describedpreviously [21].

Statistical analysisAll results are expressed as mean ± SEM. The differencesbetween the control and normal groups were tested byone-way analysis of variance (ANOVA) followed byStudent’s t-test using SPSS (version 10.0, Chicago, IL). Avalue of p < 0.05 was chosen as the criterion for statis-tical significance. The graphs were plotted using Sigmaplot version 12.0, Chicago, USA.

ResultsPoncirin inhibits abdominal constriction induced byacetic acidIn the first set of experiments, the anti-nociceptive effectof poncirin was assessed in acetic acid-induced visceralpain (Fig. 1), which has been employed widely for theassessment of anti-inflammatory or analgesic propertiesof new compounds [39]. Intraperitoneal administrationof poncirin 40 min prior to the acetic acid

administration considerably (p < 0.05) reduced thenumber of abdominal writhing movements as comparedto vehicle-treated group (Fig. 1).

Poncirin reduces formalin-induced paw licking in bothphasesThe anti-nociceptive effect of poncirin was also con-firmed by using formalin test, which produces a biphasicresponse, each phase represents distinct types of pain[40]. The first phase, named as nociceptive phase, is aresult of direct stimulation of nociceptors and is medi-ated centrally, while the second phase is an inflamma-tory phase, caused by the local release of hyperalgesicand inflammatory mediators [40]. Formalin injectionproduced biphasic paw licking response with the firstphase ranged from 0 to 10 min, while the second phaseranged from 10 to 30min. Administration of poncirin40 min prior to formalin-induction significantly reducedthe paw licking response dose dependently in both earlyphase (Fig. 2a) and late phase (Fig. 2b) respectively, how-ever, the dose of 30 mg/kg showed maximum response(p < 0.05). The positive control treated with piroxicam(5 mg/kg) also showed the significant anti-nociceptiveeffect in both phases.

Poncirin inhibits carrageenan-induced mechanical andthermal hyperalgesiaThe compound poncirin was tested in three differentdoses (5 mg/kg, 15 mg/kg or 30 mg/kg, i.p) in first twoset of experiments and 30 mg/kg dose of poncirin pro-duced significant analgesic responses when comparedwith negative control groups, therefore, poncirin (30mg/kg) was used in subsequent experiments. Next, theanti-nociceptive effect of poncirin (30 mg/kg, i.p) wasassessed in carrageenan-induced acute inflammatorypain model. Poncirin noticeably inhibited (p < 0.05) car-rageenan-induced mechanical (Fig. 3a) and thermal(Fig. 3b) hyperalgesia at given dose after 4 h of carra-geenan injection. In vehicle-treated group marked in-crease in pain sensitivity was observed in mechanical(Fig. 3a) and thermal hyperalgesia (Fig. 3b). Whereas,

Table 1 the sequences of PCR primers

Genes Forward primer Reverse prime

β-actin TGAAGGTCGGTGTGAACGGATTTGGC CATGTAGGCCATGAGGTCCACCAC

TNF-α GTTCTATGGCCCAGACCCTCA GGCACCACTAGTTGGTTGTCTTTG

IL-1β TCC AGG ATG AGG ACA TGA GCAC GAA CGT CAC CCA GCA GGT TA

IL-6 CCA CTT CAC AAG TCG GAG GCT TA CCA GTT TGG TAG CAT CCA TCA TTT C

VEGF TTACTGCTGTACCTCCACC ACAGGACGGCTTGAAGATG

Nrf2 TGG GGA ACC TGT GCT GAG TCA CTG GAG ACC CCT TGG ACA CGA CTC AGT GAC CTC

HO-1 CACGCATATACCCGCTACCT CCAGAGTGTTCATTCGAGA

SOD2 GCGGTCGTGTAAACCTCAT GGTGAGGGTGTCAGAGTGT


the dexamethasone used as positive control also inhib-ited mechanical and thermal hyperalgesia (Fig. 3).

Poncirin inhibits carrageenan-induced mechanicalallodynia and paw edemaThe poncirin treatment significantly inhibited carrageenan-induced mechanical allodynia, while the maximumincrease in pain threshold (p < 0.05) was noticed withescalated dose i.e. 30 mg/kg (Fig. 3c). The positivecontrol (dexamethasone 5 mg/kg, i.p) also exhibited

significant reduction in allodynic responses compared,however, the negative control group showeddecreased in pain threshold and hypersensitivity tothe allodynic stimulus. Similarly, the poncirin admin-istration markedly reversed the carrageenan-inducedpaw swelling compared to the negative control group(treated with carrageenan only) (Fig. 3d). Further-more, the positive control group also significantlyinhibited the carrageenan-induced paw edema in mice(Fig. 3d).

Fig. 2 Inhibition of formalin-induced paw licking and total time spent in paw licking was reduced by poncirin. The total time spent in pawlicking was observed for 0–10 min (a) and 10–30min (b) after formalin injection. Treatment with piroxicam (5 mg/kg, i.p) was used as a control.Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from thenegative control group

Fig. 1 Inhibition of abdominal writhing induced by acetic-acid as described in “Materials and methods”. The total numbers of writhing wereevaluated over the period of 30min. Each column represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001denote the significant differences from the negative control group


Poncirin inhibits CFA-induced mechanical hyperalgesiaand allodyniaNext, the modulatory effect of poncirin was evaluated inmechanical hyperalgesia and allodynia. In order to inves-tigate the effects of poncirin in CFA-induced mechanicalhyperalgesia, animals were treated with poncirin (30 mg/kg, i.p) 40 min prior to CFA injection. Poncirin signifi-cantly increased pain thresholds in both mechanicalhyperalgesia test and allodynia at 2, 4 and 6 h after CFAinjection, showing the promising activity of poncirin inacute case. Dexamethasone also significantly increasedthe pain threshold as compared to negative control(Fig. 4).In order to investigate the chronic anti-inflammatory

and analgesic effects of poncirin on mechanical hyper-algesia and allodynia, animals were treated daily for 6days skipping day 5 after CFA injection. Poncirin (30mg/kg, i.p) daily treatment significantly increased painthresholds throughout treatment period compared withnegative control (Fig. 4c and d) indicating the effective-ness of poncirin in chronic inflammatory pain model.The dose of the poncirin was skipped at day 5 to observethe tolerance effect (whether the anti-inflammatory ef-fect of the poncirin remains persistent while skippingthe dose or it should be administered daily to produce

its effect) as described previously [28]. However, the pon-cirin treatment did not exhibited any tolerance effect andthe mechanical hyperalgesia and allodynia was reestab-lished when the dose was skipped at day 5 (Fig. 4c & d).

Inhibition of thermal hyperalgesia and cold allodynia byponcirin in CFA-induced pain modelIn order to investigate the effects of poncirin in CFA-in-duced thermal hyperalgesia and cold allodynia, animalswere treated with poncirin (30mg/kg, i.p) 40min prior toCFA injection. Poncirin significantly inhibited acutethermal hyperalgesia (Fig. 5a) at 2, 4 and 6 h after CFA in-jection, showing the promising activity of poncirin. Dexa-methasone treated group also significantly increased thepain threshold as compared to negative control. For long-term effects of poncirin on thermal hyperalgesia, animalswere treated daily for 6 days after CFA injection, skippingday 5 for evaluation of tolerance effect (whether the anti-inflammatory effect of the poncirin remains persistentwhile skipping the dose or it should be administered dailyto produce its effect) of the drug on thermal hyperalgesiaas reported previously [28]. Poncirin (30mg/kg, i.p) dailytreatment significantly increased pain thresholds (Fig. 5b)indicating the effectiveness of poncirin in chronic inflam-matory pain model.

Fig. 3 Anti-hyperalgesic activities of poncirin in acute inflammatory pain model induced by carrageenan (a) inhibition of mechanical hyperalgesia,(b) inhibition of thermal hyperalgesia, (c) inhibition of mechanical allodynia and (d) reduction in paw thickness. Each column represents themean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group


Similarly, poncirin significantly inhibited acute coldallodynia (Fig. 5c) at 4 and 6 h after CFA injection. Forlong-term effects of poncirin on cold allodynia, animalswere treated daily for 6 days after CFA injection. Pon-cirin (30 mg/kg, i.p) daily treatment significantly in-creased pain thresholds on day 4 and 6 compared withnegative control, indicating the effectiveness of poncirinin chronic inflammatory pain model (Fig. 5c).

Poncirin inhibited CFA-induced paw edemaPoncirin inhibited paw edema induced by CFA in bothacute and chronic inflammation models. Administrationof poncirin significantly reduced the paw thickness at 2,4 and 6 h after CFA-induced acute edema (Fig. 6a). Forthe evaluation of long-term effects of poncirin in CFA-induced paw edema, poncirin (30 mg/kg) treatment for6 days showed significant inhibition of paw edemacompared to CFA treated group (Fig. 6b). Similarly, thepositive control (dexamethasone 5 mg/kg) also signifi-cantly attenuated the acute paw edema 2, 4 and 6 h afterCFA administration, while the daily administration ofdexamethasone (5 mg/kg) for 6 days also markedlyattenuated the CFA-induced paw edema compared tothe negative control (Fig. 6b).

Poncirin doesn’t have any effect on the motor activityof micePoncirin chronic administration does not effected themotor function of the mice, which was evaluated byWeights test and Kondziela’s screen tests utilized as ascreening tool in preliminary drug research for evalu-ation of motor function (Fig. 7a and b) [33, 41]. Motorfunction was altered in the CFA-treated group whileboth poncirin and dexamethasone did not alter themuscle strength both after acute and long-term adminis-tration of drugs.

Body weight assessmentEach group of mice were weighted before the diseaseinduction with CFA. Similarly, the weight of mice werealso recorded at day 6 of the CFA administration at theend of the experiment as shown (Additional file 1).

Poncirin reduced the production of NO in plasma afterCFA inductionThe inhibitory effect of poncirin on NO productionin plasma was analyzed on day 6 of the CFA adminis-tration using Griess reagent method as describedpreviously [28]. The CFA administration markedly

Fig. 4 Anti-hyperalgesic activities of poncirin in chronic inflammatory pain model induced by CFA (a) inhibition of acute mechanical hyperalgesia,(b) inhibition of acute mechanical allodynia, (c) inhibition of chronic mechanical hyperalgesia and (d) inhibition of chronic mechanical allodynia.Each data point represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences fromthe negative control group


increased the production of NO in mice plasma atday 6 of the administration. The poncirin (30 mg/kg)treatment significantly attenuated the NO (almost80%) production compared to the negative control(only CFA treated group) (Fig. 8). Similarly, the dexa-methasone-treated group also showed obviousdecrease in NO production (approximately 83%decrease was noted in NO production) (Fig. 8).

Poncirin inhibits CFA-induced pro-inflammatory cytokinesproductionTo examine the effect of poncirin (30 mg/kg) on theproduction of pro-inflammatory cytokines in CFA-treated paw, qRT- PCR was performed. qRT-PCR resultsshowed increased expressions of TNF-α, IL-1β, IL-6 andVEGF mRNA in CFA-induced mice paw tissue (Fig. 9a,b, c and d). Whereas, poncirin treatment strikingly

Fig. 5 Anti-nociceptive activities of poncirin in thermal hyperalgesia and cold allodynia induced by CFA (a) inhibition of acute thermal hyperalgesia,(b) inhibition of chronic thermal hyperalgesia and (c) inhibition of cold allodynia. Each data point represents the mean ± SEM of 6–7 mice per group.*p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group

Fig. 6 Anti-inflammatory activities of poncirin in paw induced by CFA (a) inhibition of acute paw edema and (b) inhibition of chronic pawedema. Each data point represents the mean ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significantdifferences from the negative control group


inhibited the mRNA expression levels of pro-algesic andinflammatory cytokines such as TNF-α, IL-1β, IL-6 andVEGF (Fig. 9).

Poncirin increased the expression levels of Nrf2, HO-1,and SOD2 in CFA-induced inflammatory pain modelqRT-PCR was also used to investigate the effect ofponcirin treatment on expression levels of the phase IIantioxidant enzymes (HO-1 and SOD2). Nrf2 activatesantioxidant response element (ARE) that in turns isresponsible for the expression of phase II antioxidantenzymes [42]. The mRNA expression levels of SOD2(approximately 79% increase was noticed) and HO-1(more than 5 times) was increased in poncirin treatedgroup as compared to CFA treated group (Fig. 10b and c).

Poncirin treatment up-regulated Nrf2 (100% increase)expression level considerably (Fig. 10a).

Poncirin doesn’t cause hepatic or renal damageMice were treated daily with poncirin (30mg/kg, i.p) ordexamethasone (5mg/kg, i.p) or vehicle for 6 days after in-duction of inflammatory pain. The treatment with poncirinand dexamethasone did not alter the hepatic and renalfunctions (Table 2), thus signifies that poncirin administra-tion did not produce any toxicity against these vital organs.

Poncirin inhibited infiltration of inflammatory cells andsoft tissue swelling after CFA inductionHistopathological analysis of tibiotarsal joints of righthind paw showed a significant infiltration of immune

Fig. 7 (a) Effect of poncirin treatment on muscle strength and motor coordination of animals was measured by using inverted tray method at 0 h, 6 hand day 6 as described in materials and method section. (b) Effect of poncirin treatment on muscle coordination of animals was measured by usingweight test at 0 h, 6 h, and day 6. Each column represents the means ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote thesignificant differences from the negative control group


cells and synovial hyperplasia in CFA treated group,while poncirin treated group showed a reduction of im-mune cells infiltration and synovial hyperplasia (Fig. 11b).The radiographic examination of the soft tissue showedmarked reduction in soft tissue swelling of the right hindpaw in those animals who were treated with the pon-cirin, however, the animals challenged with CFA onlyshowed noticeable soft tissue swelling and bony erosion(Fig. 11a).

DiscussionInflammatory pain is a common chief complaint associ-ated with many disease conditions including irritablebowel syndrome, rheumatoid arthritis and osteoarthritis[2]. The inflammation mediated pain trigger the induc-tion of pro-inflammatory cytokines and activates severalsignaling pathways such as NF-κB, MAPKs etc. Cur-rently, several therapeutic approaches are employed totreat the inflammatory pain such as NSAIDs and opioids[43]. The chronic use of NSAIDs such as aspirin cancause the GIT ulceration, while the prolonged use ofopioids is related with the development of tolerance, de-pendence and respiratory depression [44–47]. All thesechallenges necessitate the development and discoverynew molecules, which are safe, effective and associated

with less side effects profile. Since decades, medicinalplants have been used for therapeutic purposes, as theyare effective and safe and offer a good source of newchemical entity [44–47]. Poncirin is flavanone derivativeobtained from dried immature fruits of Poncirus trifoliata,which was used to treat inflammation and asthma in an-cient times [44–47]. Recent studies on poncirin have alsoconfirmed its anticancer and anti-inflammatory activity[14]. In the current study, it was demonstrated that sys-temic administration of poncirin in various inflammatorypain models successfully alleviated pain associated with in-flammation. The anti-hyperalgesic effects of poncirin ininflammatory pain can be attributed to suppression ofpro-inflammatory cytokines including TNF-α, IL-1β andIL-6, enhancing the expression of antioxidant genes andenzymes (Nrf2, HO-1 and SOD2) respectively. Therefore,the present study highlights the analgesic potential ofponcirin together with its safety since the systemic admin-istration of poncirin did not present any renal, hepatic ormotor side effects.Acetic acid-induced abdominal writhing is a simple

method for novel drugs screening in visceral pain [20].Acetic acid administration causes the activation ofperitoneal macrophages and mast cells which leads tolocal release cytokines such as TNF-α and IL-1β and

Fig. 8 Effect of treatment with poncirin on nitrite (NO) production determination in blood plasma. Each column represents the means ± SEM of6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group


Fig. 10 (a) Effect of treatment with poncirin on protein expression of Nrf2, (b) HO-1 and (c) SOD2 in mice paw tissue. Each column representsthe means ± SEM of 6–7 mice per group. *p < 0.05, **p < 0.01 and ***p < 0.001 denote the significant differences from the negative control group

Fig. 9 (a) Effect of treatment with poncirin on mRNA expression levels of TNF-α, (b) IL-6, (c) IL-1β and (d) VEGF in mice paw tissue. The micewere treated with poncirin (30 mg/kg, i.p), dexamethasone (5 mg/kg, i.p) or vehicle control as described in “Materials and methods”. Each columnrepresents the mean ± SEM of 6–7 mice per group. *p < 0.05, ** p < 0.01 and ***p < 0.001 denote the significant differences from the negativecontrol group


other mediators like eicosanoids and sympathomimeticamines [38]. Since poncirin administration inhibitedacetic acid-induced writhing markedly, it is likely thatthe anti-nociceptive activity of poncirin might be con-tributed due to its inhibitory activity cytokines produc-tion. Similarly, the anti-nociceptive activity of poncirinwas also observed in formalin-induced tonic pain model.The injection of formalin causes an intense and immedi-ate increase in impulses transmission from C afferentfibers and produce a diverse quantifiable behavior aspaw licking by the animal that indicates the intensity ofpain [48]. This test can also be used to determine the ef-fect of new compounds on central and peripheral noci-ceptive pathways as formalin injection causes biphasicreaction consisting of early neurogenic phase and late in-flammatory phase [49]. The early neurogenic phase offormalin injection last from 0 to 10 min and is caused bythe release of neurotransmitters such bradykinin andserotonin as well as molecules released from residentscells causing the activation of transient receptor poten-tial ankyrin 1 (TRPA1) on the surface of nociceptive

fibers [50]. The late inflammatory phase of formalin testlasts from 10 to 30min and occurs because of release ofinflammatory cytokines including TNF-α, IL-1β, IL-6and prostaglandins after administration of inflammatorystimuli like formalin [51]. Poncirin inhibited both pawlicking and total time spent in paw licking in bothphases of formalin injection. Interestingly, poncirin ad-ministration reduced the total spent in paw licking inthe first phase as compared the positive control, showingits effect on the central pain pathways. The analgesicpotential of poncirin was also demonstrated in carra-geenan- and CFA-induced acute and chronic inflamma-tory pain models. Carrageenan and CFA are algogenicsubstances and cause the local release of mediators, suchas prostanoids and cytokines, involved in the inflamma-tory signs such as vasodilation, edema, and hyperalgesia[52, 53]. Importantly, the systemic administration ofponcirin reduced both hyperalgesia and allodynia in bothcarrageenan and CFA model with comparable results todexamethasone, which is a standard anti-inflammatorydrug, showing the anti-nociceptive potential of poncirin.Carrageenan- and CFA-induced inflammatory pain arewell-accepted models of acute and chronic pain respect-ively. The peripheral injection of algogenic substanceslike carrageenan and CFA causes the release of numer-ous nociceptive and inflammatory mediators, resultingin the alteration of synaptic activity by increasing theprimary sensory fibers discharge and causing central

Fig. 11 Clinical appearance of right hind paws. (a) Radiographic evidence of right hind paw from (1) Vehicle control, (2) negative control group,(3) positive control group and (4) poncirin treated group. Tissue swelling can be observed in the tibiotarsal region of CFA treated mice ascompared to poncirin treated mice. (b) Histopathological analysis of tibiotarsal joint from (1) vehicle control, (2) negative control group, (3)positive control treated group and (4) poncirin treated group. Paw tissues were sectioned at 4 μm thickness, stained by hematoxylin-eosin andobserved with the microscope (40×). Note marked immune cell infiltration, synovial hyperplasia, in the vehicle-treated group as compared toponcirin treated group

Table 2 Effect of poncirin on liver and kidney function

Sample Creatinine (mg/dL) GPT/ALT (UI/L) GOT/AST (UI/L)

Normal 0.4 ± 0.28 94 ± 1.41 141 ± 2.82

Dex 5 mg/kg 0.4 ± 0.22 94 ± 1.56 142 ± 1.25

Poncirin 30 mg/kg 0.4 ± 0.14 95 ± 2.12 144 ± 2.12


pain sensitization by modifying neuroimmune cells [54].In present study, systemic administration of flavanoneglycoside poncirin remarkably inhibited the mechanical,thermal hyperalgesia and mechanical and cold allodyniainduced by carrageenan and CFA in both acute andchronic inflammation models in mice. Poncirin in-creased the pain threshold after 2 h of treatment andits effects persisted until 6 h in the acute model anduntil day 5 in the chronic model. The paw edema in-duced by carrageenan and CFA was also significantlyreduced by poncirin. Because TNF-α, IL-1β and IL-6,play a key role in inflammatory hyperalgesia, it maybe suggested that the anti-nociceptive effects ofponcirin are due to its ability to inhibit the release ofinflammatory cytokines [44].NO is a well-established mediator of inflammation and

its production is related to the degree of inflammation[55]. The expression of NO is under the influence ofiNOS gene, however, its production is also regulated bythe TNF-α, thus maintain the hyperalgesic state after theinflammation and pain. The poncirin treatment signifi-cantly reduced the levels of NO compared to the CFA-induced group.Inflammation is closely related to sensation of pain [5].

Following the local injection of CFA there is a release ofvarious inflammatory mediators including TNF-α, IL-1βand IL-6. NO also contributes to the hyperalgesic stateby indirectly sensitizing the nociceptors through the pro-duction of prostanoids such as PGE2. In addition, thesecytokines increase the synaptic transmission by directlyactivating nociceptors [4]. In the present study, poncirinalso significantly reduced the expression of TNF-α, IL-1β and IL-6 in CFA induced inflammatory pain, suggest-ing that suppression of these pro-inflammatory cytokinescontributes to the anti-nociceptive activity of poncirin.Vascular endothelial growth factor (VEGF) induces vas-cular leakage by enhancing vascular permeability, thusplaying an important role in inflammation [56]. Theexpression of inflammatory cytokines is, also induced byVEGF indicating the role of VEGF in the production ofthese hyperalgesic cytokines [56]. The poncirin treat-ment significantly reduced the mRNA expression levelof the VEGF compared to the negative control group,thus, indicating the potent anti-inflammatory role of theponcirin.Nrf2 is transcription factor responsible for the induc-

tion antioxidant enzymes including glutathione peroxid-ase (GPx), Glutathione S transferase (GST) and HO-1[42]. Nrf2 have multiple protective actions includingantioxidant activity by induction of antioxidant enzymes,anti-inflammatory role in many diseases as well as pro-tective action in wound healing [57, 58]. The protectiveanti-inflammatory role of Nrf2 is attributed to inhibitionof expression of pro-inflammatory cytokines, iNOS and

COX-2 in early events of inflammation. HO-1 is one ofthe major anti-inflammatory and cytoprotective en-zymes, expression of which is controlled by Nrf2 [59].The HO-1 expression is induced by many inflammatorystimuli and increased inflammatory state was observedin mice deficient with HO-1 emphasizing on the import-ant role of HO-1 in inflammation resolution and hencedecreasing hyperalgesic state [60]. In the current study,systemic administration of poncirin has shown to signifi-cantly increased the expression of Nrf2 and induction ofHO-1, highlighting its importance in reducing theinflammatory pain through Nrf2 mediated pathway.Poncirin treatment also up-regulated the expression ofSOD2 (superoxide dismutase 2) following CFA-inducedinflammatory pain in mice. SOD2 is antioxidant enzymebelonging to SOD family and plays important role inbody defense as antioxidant enzyme by modulating theproduction of inflammatory cytokines [61]. SOD2 highlevels in the body inhibit the phospholipase-2 (PLA2)overexpression and consequently inhibits the downstreamPGE2 production via NF-κB-dependent pathways [62],thus, reduces the pain by reducing the inflammation.To assess the toxic effect of poncirin on liver and

kidney, liver and kidney functions test were performedusing blood plasma. The poncirin treatment exhibits notoxic effect on the liver and kidney. Similarly, to observeany possible toxic effect on the animals, muscle strengthand coordination was assessed. The poncirin treatmentwas not associated with any toxic effect on the musclestrength and coordination.

ConclusionPoncirin significantly reduced abdominal writhing inacetic acid-induced visceral pain and also showedremarkable results in both phases of formalin test. Inaddition, poncirin administration also significantlyproduced anti-allodynic and anti-hyperalgesic effects incarrageenan- and CFA-induced models. Importantly,chronic treatment with poncirin in CFA model did notproduce any side effects. Poncirin also reduced the NOcontent and pro-inflammatory cytokines expression in-cluding TNF-α, IL-1β and IL-6 in paw tissue. ThemRNA expression of VEGF was also inhibited byponcirin, which correlates to reduction in paw edemaand increased pain thresholds in CFA induced inflam-matory pain models. Poncirin also significantly increasedthe antioxidant enzymes (HO-1 and SOD2) and tran-scription factor (Nrf2), suggesting that protective role ofponcirin as well as multiple targets by which poncirinmodulates pain. Collectively, our data demonstrate theanalgesic potential of poncirin in acute and chronicinflammatory pain conditions that still need an effectiveand safe therapeutic option.


Additional file

Additional file 1: Figure S1. Body weight assessment. The weight ofanimals at day 1 and day 7. (DOCX 59 kb)

AbbreviationsCFA: Complete Freund’s adjuvant; COX-2: Cyclooxygenase-2; CREB: cAMPresponse element-binding protein; Dex: Dexamethasone; HO-1: Hemeoxygenase; i.p.: intraperitoneal; i.pl: intraplantar; IκB: Inhibitory kappa B;MAPKs: Mitogen activated protein kinase; NF-κB: Nuclear factor kappa B;NO: Nitric oxide; Nrf2: Nuclear factor (erythroid-derived 2)-like 2;SOD2: Superoxide dismutase

AcknowledgementsNot applicable.

Authors’ contributionsRA, AUK, HR, SK1, ZU dispensed and performed all the experiments includingbehavioral assays and biochemical analysis. RA, SK1, OS and BS analyzed theresults. RA and SK1 drafted the manuscript. OS also provided variouschemicals and reagents. SK2 and YSK supervised and funded the project.All authors read and approved the final manuscript.

FundingThe Higher Education Commission (HEC) of Pakistan (under the SRGPfunding No. 357SRGP/HEC/2014) supported the study only financially andwas not involved in the designing of the project. The authors are grateful tothe National Research Foundation of Korea (NRF), Seoul National University,grant funded by the Korean Government (MSIP) (No. 2009–0083533). TheProff: Yeong Shik Kim (National Research Foundation of Korea (NRF), SeoulNational University) was actively involved in the designing of the experimentand analysis of the results.

Availability of data and materialsThe data used in the current study can be accessed by requesting thecorresponding author.

Ethics approval and consent to participateAll procedures were complied with “Animal care guidelines of QAU”Islamabad. The study was also approved by Bioethical Committee (ApprovalNo: BEC-FBS-QAU 2017–2) of QAU University, Islamabad. All the experimentswere designed to cause minimum harm to animals.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Author details1Department of Pharmacy, Faculty of Biological Sciences, Quaid-i-AzamUniversity, Islamabad, Pakistan. 2Department of Pharmacy, Abdul Wali KhanUniversity, Mardan, Pakistan. 3College of Pharmacy, Seoul National University,Seoul 151-742, South Korea.

Received: 29 May 2018 Accepted: 30 August 2019

References1. Milligan ED, Watkins LR. Pathological and protective roles of glia in chronic

pain. Nat Rev Neurosci. 2009;10:23.2. Scholz J, Woolf CJ. Can we conquer pain? Nat Neurosci. 2002;5:1062–7.3. Julius D, Basbaum AI. Molecular mechanisms of nociception. Nature.

2001;413:203–10.4. Sandkühler J. Models and mechanisms of hyperalgesia and allodynia.

Physiol Rev. 2009;89:707–58.5. Basbaum AI, Bautista DM, Scherrer G, Julius D. Cellular and molecular

mechanisms of pain. Cell. 2009;139:267–84.6. Ji R-R, Gereau RW, Malcangio M, Strichartz GR. MAP kinase and pain. Brain

Res Rev. 2009;60:135–48.

7. Matsumori A, Nunokawa Y, Sasayama S. Pimobendan inhibits the activationof transcription factor NF-κB: a mechanism which explains its inhibition ofcytokine production and inducible nitric oxide synthase. Life Sci.2000;67:2513–9.

8. Ahmad N, Subhan F, Islam NU, Shahid M, Rahman FU, Fawad K. A novelPregabalin functionalized Salicylaldehyde derivative afforded prospectivepain, inflammation, and pyrexia alleviating propensities. Arch Pharm.2017;350.

9. Brower V. New paths to pain relief. Nat Biotechnol. 2000;18:387.10. Pivatto M, Crotti AE, Lopes NP, Castro-Gamboa I, Rezende AD, Viegas C Jr,

MCM Y, Furlan M, Bolzani VS. Electrospray ionization mass spectrometryscreening of piperidine alkaloids from Senna spectabilis (Fabaceae) extracts:fast identification of new constituents and co-metabolites. J Braz Chem Soc.2005;16:1431–8.

11. Calixto JB, Cabrini DA, Ferreira J, Campos MM. Kinins in pain andinflammation. Pain. 2000;87:1–5.

12. Manthey JA, Guthrie N, Grohmann K. Biological properties of citrusflavonoids pertaining to cancer and inflammation. Curr Med Chem. 2001;8:135–53.

13. Lee JH, Lee SH, Kim YS, Jeong CS. Protective effects of neohesperidin andponcirin isolated from the fruits of Poncirus trifoliata on potential gastricdisease. Phytother Res. 2009;23:1748–53.

14. Zhu X, Luo F, Zheng Y, Zhang J, Huang J, Sun C, Li X, Chen K.Characterization, purification of poncirin from edible citrus ougan(Citrus reticulate cv. suavissima) and its growth inhibitory effect on humangastric cancer cells SGC-7901. Int J Mol Sci. 2013;14:8684–97.

15. Yoon H-Y, Won Y-Y, Chung Y-S. Poncirin prevents bone loss inglucocorticoid-induced osteoporosis in vivo and in vitro. J Bone MinerMetab. 2012;30:509–16.

16. Runtsch MC, Nelson MC, Lee S-H, Voth W, Alexander M, Hu R, Wallace J,Petersen C, Panic V, Villanueva CJ. Anti-inflammatory microRNA-146aprotects mice from diet-induced metabolic disease. PLoS Genet.2019;15:e1007970.

17. Charan J, Biswas T. How to calculate sample size for different study designsin medical research? Indian J Psychol Med. 2013;35:121.

18. Charan J, Kantharia N. How to calculate sample size in animal studies?J Pharmacol Pharmacother. 2013;4:303.

19. Arifin WN, Zahiruddin WM. Sample size calculation in animal studies usingresource equation approach. Malaysian J Med Sci: MJMS. 2017;24:101.

20. Verri WA, Cunha TM, Magro DA, Domingues AC, Vieira SM, Souza GR, LiewFY, Ferreira SH, Cunha FQ. Role of IL-18 in overt pain-like behaviour in mice.Eur J Pharmacol. 2008;588:207–12.

21. Khan A, Ullah MZ, Afridi R, Rasheed H, Khalid S, Ullah H, Ali H, AlSharari SD,Kim YS, Khan S. Antinociceptive properties of 25-methoxy hispidol a, atriterpinoid isolated from Poncirus trifoliata (Rutaceae) through inhibition ofNF-κB signalling in mice. Phytother Res. 2019;33:327–41.

22. Gong N, Huang Q, Chen Y, Xu M, Ma S, Wang Y-X. Pain assessment usingthe rat and mouse formalin tests. Bio-protocol. 2014;4:e1288.

23. Erami E, Azhdari-Zarmehri H, Imoto K, Furue H. Characterization ofnociceptive behaviors induced by formalin in the glabrous and hairy skin ofrats. Basic Clin Neurosci. 2017;8:37.

24. Radhakrishnan R, Moore SA, Sluka KA. Unilateral carrageenan injection intomuscle or joint induces chronic bilateral hyperalgesia in rats. Pain.2003;104:567–77.

25. Khan S, Shehzad O, Jin H-G, Woo E-R, Kang SS, Baek SW, Kim J, Kim YS. Anti-inflammatory mechanism of 15, 16-epoxy-3α-hydroxylabda-8, 13 (16), 14-trien-7-one via inhibition of LPS-induced multicellular signaling pathways.J Nat Prod. 2012;75:67–71.

26. Oliveira MG, Marques RB, Santana MF, Santos AB, Brito FA, Barreto EO, SousaDP, Almeida FR, Badauê-Passos D, Antoniolli ÂR. α-Terpineol reducesmechanical hypernociception and inflammatory response. Basic ClinPharmacol Toxicol. 2012;111:120–5.

27. Cho H, Yang YD, Lee J, Lee B, Kim T, Jang Y, Back SK, Na HS, HarfeBD, Wang F. The calcium-activated chloride channel anoctamin1 acts as a heat sensor in nociceptive neurons. Nat Neurosci.2012;15:1015–21.

28. Khan S, Shehzad O, Chun J, Kim YS. Mechanism underlying anti-hyperalgesic and anti-allodynic properties of anomalin in both acuteand chronic inflammatory pain models in mice through inhibition ofNF-κB, MAPKs and CREB signaling cascades. Eur J Pharmacol.2013;718:448–58.


https://doi.org/10.1186/s40360-019-0335-5

29. Zeeshan S, Naveed M, Khan A, Atiq A, Arif M, Ahmed MN, Kim YS, Khan S.N-Pyrazoloyl and N-thiopheneacetyl hydrazone of isatin exhibited potentanti-inflammatory and anti-nociceptive properties through suppression ofNF-κB, MAPK and oxidative stress signaling in animal models ofinflammation. Inflamm Res. 2019;68:613–32.

30. Khan S, Shehzad O, Chun J, Choi RJ, Park S, Islam MN, Choi JS, Kim YS. Anti-hyperalgesic and anti-allodynic activities of capillarisin via suppression ofinflammatory signaling in animal model. J Ethnopharmacol. 2014;152:478–86.

31. DSM d C, Meotti FC, Andrade EL, Leal PC, Motta EM, Calixto JB. Theinvolvement of the transient receptor potential A1 (TRPA1) in themaintenance of mechanical and cold hyperalgesia in persistentinflammation. PAIN®. 2010;148:431–7.

32. Dhaka A, Murray AN, Mathur J, Earley TJ, Petrus MJ, Patapoutian A. TRPM8 isrequired for cold sensation in mice. Neuron. 2007;54:371–8.

33. Deacon RM. Measuring the strength of mice. JoVE: Journal of visualizedexperiments; 2013.

34. Khan S, Shin EM, Choi RJ, Jung YH, Kim J, Tosun A, Kim YS. Suppression ofLPS-induced inflammatory and NF-κB responses by anomalin in RAW 264.7macrophages. J Cell Biochem. 2011;112:2179–88.

35. Khan A, Khan S, Ali H, Shah KU, Ali H, Shehzad O, Onder A, Kim YS.Anomalin attenuates LPS-induced acute lungs injury through inhibition ofAP-1 signaling. Int Immunopharmacol. 2019;73:451–60.

36. Parasuraman S, Raveendran R, Kesavan R. Blood sample collection in smalllaboratory animals. J Pharmacol Pharmacother. 2010;1:87.

37. Fracasso M, Leone R, Cuzzolin L, Del Soldato P, Velo G, Benoni G.Indomethacin induced hepatic alterations in mono-oxygenase system andfaecal Clostridium perfringens enterotoxin in the rat. Inflamm Res.1990;31:313–6.

38. Ribeiro RA, Vale ML, Thomazzi SM, Paschoalato AB, Poole S, Ferreira SH,Cunha FQ. Involvement of resident macrophages and mast cells in thewrithing nociceptive response induced by zymosan and acetic acid in mice.Eur J Pharmacol. 2000;387:111–8.

39. Collier H, Dinneen L, JOHNSON CA, Schneider C. The abdominalconstriction response and its suppression by analgesic drugs in the mouse.Br J Pharmacol. 1968;32:295–310.

40. Hunskaar S, Hole K. The formalin test in mice: dissociation betweeninflammatory and non-inflammatory pain. Pain. 1987;30:103–14.

41. Golli NE, Dallagi Y, Rahali D, Rejeb I, Fazaa SE. Neurobehavioral assessmentfollowing e-cigarette refill liquid exposure in adult rats. Toxicol MechMethods. 2016;26:425–32.

42. Alam J, Killeen E, Gong P, Naquin R, Hu B, Stewart D, Ingelfinger JR, NathKA. Heme activates the heme oxygenase-1 gene in renal epithelial cells bystabilizing Nrf2. Am J Physiol-Renal Physiol. 2003;284:F743–52.

43. Ribeiro-Rama AC, Figueiredo IV, Veiga FJ, Castel-Branco MM, Cabrita AMS,Caramona MM. Hepatic and renal toxicities of indomethacin acid, salt formand complexed forms with hydroxypropyl-β-cyclodextrin on Wistar ratsafter oral administration. Fundam Clin Pharmacol. 2011;25:599–607.

44. Kim J-B, Han A-R, Park E-Y, Kim J-Y, Cho W, Lee J, Seo E-K, Lee K-T. Inhibition ofLPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF-κB inactivation in RAW 264.7 macrophage cells. Biol Pharm Bull. 2007;30:2345–51.

45. Kang S-M, Kim K-N, Lee S-H, Ahn G, Cha S-H, Kim A-D, Yang X-D, Kang M-C,Jeon Y-J. Anti-inflammatory activity of polysaccharide purified from AMG-assistant extract of Ecklonia cava in LPS-stimulated RAW 264.7macrophages. Carbohydr Polym. 2011;85:80–5.

46. Roh GS, Seo S-W, Yeo S, Lee JM, Choi J-W, Kim E, Shin Y, Cho C, Bae H, JungS-K. Efficacy of a traditional Korean medicine, Chung-sang-Bo-ha-tang, in amurine model of chronic asthma. Int Immunopharmacol. 2005;5:427–36.

47. Seyedrezazadeh E, Sabri A, Barzegari A, Kolahian S, Shahbazfar A-A, AnsarinK, Vafa M, Sakhinia E. Dietary flavanones and citrus fruits influence cytokinesand thyroid transcription factor-1 in an HDM-induced chronic asthmamurine model. J Funct Foods. 2016;26:709–18.

48. Heapy C. Afferent C-fibre and A-delta activity in models of inflammation.Br J Pharmacol. 1987;90:164.

49. Malmberg AB, Yaksh TL. Antinociceptive actions of spinal nonsteroidal anti-inflammatory agents on the formalin test in the rat. J Pharmacol Exp Ther.1992;263:136–46.

50. McNamara CR, Mandel-Brehm J, Bautista DM, Siemens J, Deranian KL, ZhaoM, Hayward NJ, Chong JA, Julius D, Moran MM. TRPA1 mediates formalin-induced pain. Proc Natl Acad Sci. 2007;104:13525–30.

51. Magro D, Hohmann M, Mizokami S, Cunha T, Alves-Filho J, Casagrande R,Ferreira S, Liew F, Cunha F, Verri W Jr. An interleukin-33/ST2 signaling

deficiency reduces overt pain-like behaviors in mice. Braz J Med Biol Res.2013;46:601–6.

52. Fehrenbacher JC, Vasko MR, Duarte DB. Models of Inflammation:Carrageenan-or Complete Freund's Adjuvant (CFA)–Induced Edema andHypersensitivity in the Rat. Current Protocols Pharmacol. 2012:5.4. 1–5.4. 4.

53. Woolf C, Allchorne A, Safieh-Garabedian B, Poole S. Cytokines, nerve growthfactor and inflammatory hyperalgesia: the contribution of tumour necrosisfactor α. Br J Pharmacol. 1997;121:417–24.

54. Li M, Shi J, CHEN D, Ai B, Chen J. Effects of complete Freund's adjuvant onimmunohistochemical distribution of IL-1β and IL-1R I in neurons and gliacells of dorsal root ganglion. Acta Pharmacol Sin. 2005;26:192–8.

55. Voscopoulos C, Lema M. When does acute pain become chronic?Br J Anaesth. 2010;105:i69–85.

56. Autiero M, Luttun A, Tjwa M, Carmeliet P. Placental growth factor and itsreceptor, vascular endothelial growth factor receptor-1: novel targets forstimulation of ischemic tissue revascularization and inhibition of angiogenicand inflammatory disorders. J Thromb Haemost. 2003;1:1356–70.

57. Kim J, Cha Y-N, Surh Y-J. A protective role of nuclear factor-erythroid2-related factor-2 (Nrf2) in inflammatory disorders. Mutation Res/FundamMole Mechanisms Mutagenesis. 2010;690:12–23.

58. Nguyen T, Nioi P, Pickett CB. The Nrf2-antioxidant response elementsignaling pathway and its activation by oxidative stress. J Biol Chem.2009;284:13291–5.

59. Alam J, Stewart D, Touchard C, Boinapally S, Choi AM, Cook JL. Nrf2, aCap’n’Collar transcription factor, regulates induction of the hemeoxygenase-1 gene. J Biol Chem. 1999;274:26071–8.

60. Kapturczak MH, Wasserfall C, Brusko T, Campbell-Thompson M, Ellis TM,Atkinson MA, Agarwal A. Heme oxygenase-1 modulates early inflammatoryresponses: evidence from the heme oxygenase-1-deficient mouse.Am J Pathol. 2004;165:1045–53.

61. White CW, Avraham KB, Shanley PF, Groner Y. Transgenic mice withexpression of elevated levels of copper-zinc superoxide dismutase in thelungs are resistant to pulmonary oxygen toxicity. J Clin Investig.1991;87:2162.

62. Fakhrzadeh L, Laskin JD, Gardner CR, Laskin DL. Superoxide dismutase–overexpressing mice are resistant to ozone-induced tissue injury andincreases in nitric oxide and tumor necrosis factor-α. Am J Respir Cell MolBiol. 2004;30:280–7.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.


anti-hyperalgesic properties of a flavanone derivative ...€¦ · ruqayya afridi1, ashraf ullah...

Documents