an introduction to pcr primer design, the features …pcr primer design is a critical step in all...

Ruslan Kalendar

http://www.helsinki.fi/people/Ruslan.Kalendar/

An introduction to PCR primer design, the features of DNA and PCR WEB tools

e-mail: [email protected]

mailto:[email protected]

PCR primer design is a critical step in all types of PCR methods

The design of polymerase chain reaction (PCR) primers, like the laboratory technique of PCR itself, is ubiquitous and diverse.

The adaptation of PCR for different applications has made it necessary to develop new criteria for PCR primer and probe design to cover uses such as real-time PCR, group-specific or unique PCR, multiplex PCR, polymerase extension PCR, multi-fragments assembly cloning, loop-mediated isothermal amplification and others such as PCR with TaqMan or molecular beacon and next-generation sequencing.

The diversity of PCR applications requires corresponding flexibility in programs for PCR primer design.

PCR primers design factors

1. High priming efficiencyto achieve this, a good primer should be- of a reasonably high Tm,- without dimers, especially on their 3’-ends (to prevent self-extension),- without hairpin stems, especially on their 3’-ends (to prevent self-priming),- lacking repetitive sequences to ensure quick and correct annealing.- all primers/probes in one incubation mixture should not form significant 3’-

dimers between each other.

2. High specificityto achieve this, a good primer should be- long enough to increase specificity,- unique, especially at its 3’-end, to avoid false priming,- moderately stable at its 3’-end (as opposed to highly GC-rich) to ensure that a very short fragment won’t initialize the extension (too low 3’-end stability hurts the priming efficiency).

1. The primary nucleotide sequence of the primer determines linguistic complexity (nucleotide arrangement and composition) and specificity by the uniqueness of the primer 3’ end;

2. Primer melting temperature and the melting temperature of the primer 3’ end (stability at the 3′ end in primer template complexes will improve the polymerization efficiency);

3. Minimise intra- and inter-primer interactions to avoid primer-dimer formation, including the alternative hydrogen binding to Watson-Crick base pairing.

PCR primers design factors

Linguistic complexity (LC) values for sequence length (s) are converted to percentages, in which 100% means maximal ‘vocabulary richness’ of a sequence:

Sequence linguistic complexity, specificity, the uniqueness of the primer

Kalendar R, Lee D, Schulman AH 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics, 98(2): 137-144.

E

x

LC

L

i

i

1

100

(%)

L

iii

i

is

isisE

1 14,4

14,1

1)

3(log4

sL

, where


Primer sequence LC, %

5’-AAAAAAAAAAAAAAAAAAAAA 8

5’-ACACACACACACACACACACA 15

5’-TTTTTTTTTTGGGGGGGGGAG 36

5’-GCTACCAATGAGAAGGTCACGT 98

5’-TGTTCTCCCATAGCACAAGAGGA 98

5’-TGGCTATTCTGAACCAGCGTTGC 100

For example, the sequence 5′-ACACACACACACACAC, 16 nt,

contains two nucleotides (A, C), but expected E = 4 variants; two variants of two-nucleotides (AC, CA), but expected E = (16 − 1) variants; two variants of three-nucleotides (ACA, CAC), and expected E = (16 − 2) variants.

The complexity value is LC = 100 ∗ (2 + 2 + 2) / (4 + 16 − 1 + 16 − 2) = 18.2%

Sequence linguistic complexity, specificity, the uniqueness of the primer

Generally, sequences with higher fraction of GCbase pairs, have a higher Tm than do AT-richsequences.

In a typical melting curve, you measure theincrease in UV absorbance as the temperatureincreases.

)(2)( CGLCTm

Melting temperature (Tm) calculation

The stability of the DNA double helix depends on a fine balance of interactions includinghydrogen bonds between bases.

The simplest equation based on base content is the “Wallace rule” (where L is the lengthof the hybrid duplex in base pairs):

Wallace RB, Shaffer J, Murphy RF, Bonner J, Hirose T, Itakura K (1979) Hybridization of synthetic oligodeoxyribonucleotides to ΦX 174 DNA: the effect of single base pair mismatch. Nucleic Acids Research 6 (11):3543-3558.

A somewhat more advanced base content model, salt-adjusted Tm calculation:

L

CGKCTm

528)(41log7.111.77)( 10

where L is the length of the hybrid duplex in base pairs.

Nonetheless, this formula do not include bimolecular initiation that is present in oligonucleotides, does not account for sequence dependent effects, and does not account for terminal end effects that are present in oligonucleotide duplexes.

Thus, this equation works well for DNA polymers, where sequence-dependent effects are averaged out, and long duplexes (greater than 40 base pairs) but breaks down for short oligonucleotide duplexes that are typically used for PCR.

von Ahsen N, Wittwer CT, Schutz E (2001) Oligonucleotide melting temperatures under PCR conditions: Nearest-neighbor corrections for Mg2+ , deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 47 (11):1956-1961



DNA duplex stability is determined primarily by hydrogen bonding, but base stackingalso plays an important role.

Base-stacking interactions are hydrophobic and electrostatic in nature, and dependon the aromaticity of the bases and their dipole moments.

Base stacking interactions must also be taken into account such that the actualspecific sequence must be known to accurately predict Tm.


Base-stacking interactions increase with increasing salt concentration, as high saltconcentrations mask the destabilising charge repulsion between the two negativelycharged phosphodiester backbones.

DNA duplex stability therefore increases with increasing salt concentration. Divalentcations such as Mg2+ are more stabilising than Na+ ions, and some metal ions bind tospecific loci on the DNA duplex.


The degree of stabilization afforded by basestacking depends on the DNA sequence.Some combinations of base pairs form more stableinteractions than others.

That stacking interactions involving G/C base pairsare stronger (more negative) than those involvingA/T base pairs.

This is why the melting temperature of DNAdepends on the base composition.

There are ten possible interactions between adjacent base pairs.

The energies of these interactions are shown in the table on the left.

The arrows indicate the direction of the DNA stand from 3′→5′

Primer sequence CG% Empirical Tm Thermodynamic Tm (dS, dH)

5’-CTCTCTCTCTCTCTCTCTCT-3’ 50 56.0 51.1

5’-CACACACACACACACACACA-3’ 50 56.0 56.2


because of stacking, the stability of5′-CT-3′ hybridized to 3′-GA-5′

is low that of

5′-CA-3′ hybridized to 3′-GT-5′

even though the base pairings - C:G and T:A - are the same:

Annealing Temperature (Ta) calculation

The optimal annealing temperature (Ta) is the range of temperatures where efficiency of PCR amplification is maximal without non-specific products.

Gradient of PCR annealing Tm: 45 - 58 C

Tm 40 41 49 45 53 55Taopt 52 54 >58 56 >58 >58Taopt-Tm 12 13 ~10 11 ~10 ~10

CG% 50% 50% 67% 58% 75% 75%

Annealing Temperature (Ta) calculation

The most important values for estimating the Ta is Tm and CG% of the primers and the length of PCR fragment (L).

Primers with high Tm's (> 60 °C) can be used in PCRs with a wide Ta range compared to primers with low Tm's (< 50 °C).

The optimal annealing temperature for PCR is calculated directly as the value for the primer with the lowest Tm:


where dH is enthalpy for helix formation; dS is entropy for helix formation; R is molar gas constant (1.987cal/K mol); c is the nucleic acid molar concentration.

𝑇𝑚 𝐶 =𝑑𝐻

𝑑𝑆 + 𝑅𝑙𝑛𝑐4 + 0.368 𝐿 − 1 ln 𝐾+

− 273.15

To understand complexity of duplex stability calculations it is easier to explain it by

showing how free energy (DG, another measure of DNA helix stability), as the

formula is simpler:

DG = DH – TDS

(T is the temperature in °K).

Here’s the example of DG calculation of a 4-mer TCGA, hybridizing to a longer strand

like this:

Now, the DG can be calculated like this surprisingly long formula:

DG (TC) + DG (CG) + DG (GA) + initiation DG for T + initiation DG for A + DG of 3’-

dangling end AC + DG of 5’-dangling end GT


Primer sequence CG% Empirical Tm Thermodynamic Tm (dS, dH)

TGTGTGTGTGTGTGTGTGTGTG 50 58.4 58.4

TTTTTTTTTTTGGGGGGGGGGG 50 58.4 60.1

25

30

35

40

45

50

0 50 100 150 200 250 300 350

TmComparison of different Tm calculations (18 nt)

Nearest Neighbour Thermodynamic Parameters (J.J.SantaLucia,1998)

0.41CG% + 75.1 + 11.7lg[K+] - 528/L

B-form and the B–A transition

The B-form is the most frequently observed conformation of DNA.

The base pairs in the B-form are perpendicular to the double-helix axis.

As (A + T) content increases, the negative band becomes deeper and conformational variability increases.

Poly[d(A)]·poly[d(T)] and poly[d(G)]·poly[d(C)] adopt unusual B-forms.

A-form B-form

A-form and the B–A transition

A-form is a constitutive conformation of RNA or RNA/DNA hybrid.

DNA adopts the A-form in aqueous ethanol and other solutions.

Some molecules of DNA (e.g. poly[d(A)]·poly[d(T)]) do not adopt the A-form conformation at all.

Others [e.g. (G-C) rich DNA fragments] exhibit A-form features even in aqueous solution.

A-form B-form

The Z-form and the B–Z transition

The base pairs in the Z-DNA (left-handed) double helix have an opposite orientation with respect to the backbone than the B- and the A-forms.

As with the B-form, there are several variants of the Z-form.

In contrast to the B–A transition, the B–Z transition is slow.

This is connected with the base pair flip that is required during the transition, which is a kinetically difficult process.

B-form Z-form

Hydrogen bonding in Watson–Crick and Hoogsteen base pairs

(A) Watson–Crick A·T and G·C base pairs.

(B) Hoogsteen base pair formation between adenine and thymine, guanine and cytosine.

Hydrogen bonding in Hoogsteen base pairs

http://jenalib.fli-leibniz.de/ImgLibDoc/nana/IMAGE_NANA.html

http://jenalib.fli-leibniz.de/ImgLibDoc/nana/IMAGE_NANA.html

Hydrogen bonding in Watson–Crick and Hoogsteen base pairs

Quadruplex structures

Four guanines can hydrogen bond in a square arrangement to form a G-quartet, with a Hoogsteen G–G pairing pattern.

It also allows formation of secondary structures of G-rich single stranded DNA and RNA called G-quadruplexes (G4-DNA and G4-RNA) at least in vitro. It needs four triplets of G, separated by short spacers. This permits assembly of planar quartets which are composed of stacked associations of Hoogsteen bonded guanines.

Hoogsteen base-pairing

Circular dichroic (CD) spectroscopy spectra of quadruplexes

CD spectra of guanine quadruplexes

(A) Time-dependent formation of a parallel-stranded quadruplex of d(G4) stabilized by 16 mM K+.

(B) Na+-induced formation of an anti-parallel bimolecular quadruplex of d(G4T4G4). The triangles in the sketches indicate guanines and point in the 5′–3′ direction. The G-tetradis shown in the middle.

Kypr J, Kejnovska I, Renciuk D, Vorlickova M (2009) Circular dichroism and conformational polymorphism of DNA. Nucleic Acids Research 37 (6):1713-1725.

Cytosine quadruplexes

DNA strands rich in cytosine also generate quadruplexes.

These consist of two parallel homoduplexes connected through hemi-protonatedC·C+ pairs.

The triangles in the sketch indicate cytosines and point in the 5′–3′ direction. The C+·C pair is shown in the insert.

The two duplexes are mutually intercalated in an anti-parallel orientation. Therefore, these structures are called intercalated or i-tetraplexes.

Formation of cytosine quadruplexes is promoted by slightly acid pH, which is needed for C·C+ pair hemiprotonation.

Similar to guanine quadruplexes, intermolecular cytosine quadruplexes are formed with slow kinetics.

(C) CD spectra reflecting the acid-induced transition of a DNA fragment d(TCCCCACCTTCCCCACCCTCCCCACCCTCCCCA).

DNA fragments rich in guanine and adenine

DNA fragments rich in guanine and adenine exhibit cooperatively melting conformers that differ from classical structures.

The first conformer is an anti-parallel homoduplex containing G·Apairs.

The second conformer of the alternating GA sequence is a parallel homoduplex with G·G and A·A pairs, similar to that of parallel guanine quadruplexes but with smaller positive amplitudes.

This indicates that the guanine–guanine stacking does not change significantly and that the duplex formation is mediated by inter-strand adenine–adenine interactions.

Ethanol and even dimethylsulphoxide (DMSO), both DNA denaturing agents, stabilize the single-stranded ordered d(GA)n structure as does acid pH.

Primer-dimer detection criteria

• 3’-end and internal primer-dimer detection;

• Tm prediction for prime- dimers with mismatches for standard and degenerate oligonucleotide bases (B, D, H, K, M, N, R, S, V, W, Y) and for modifications (inosine, uridine or LNA) using nearest neighbour thermodynamic parameters;

• For non Watson-Crick base pairs, like Hoogsteen base-pairing: base triads in a DNA triple helix structure and G-quadruplexes.

Primer dimer detection criteria

Primer-dimers involving one or two sequences may occur in a PCR reaction.

It is very important for PCR efficiency that the production of stable and inhibitory dimers is avoided, especially avoiding complementarity in the 3′-ends of primers from whence the polymerase will extend.

Stable primer dimer formation is very effective at inhibiting PCR since the dimers formed are amplified efficiently and compete with the intended target.

(A–C) Interactions between primers;

(D) Hairpin structures;

(E) Undesirable binding of primers to template sequence.

Primer dimer detection criteria

Internal single mismatches

Base pairing stability in order of decreasing stability:

G-C > A-T > G·G > G·T ≥ G·A > T·T ≥ A·A > T·C ≥ A·C ≥ C·C

Guanine is the most universal base, since it forms the strongest base pair and the strongest mismatches.

On the other hand, cytosine is the most discriminating base, since it forms the strongest pair and the three weakest mismatches.

Illustration of hybridization profiles of primers with two different design strategies.

In the left panel, the Tm ’s are matched at 68.6°C, but at the annealing temperature of 58°C, primer B(squares) binds 87% and primer A (diamonds) binds 97%.

This would lead to unequal hybridization and polymerase extension, thus reducing the efficiency of PCR. In the right panel, the dG at 58°C of the two primers is matched by redesigning primer B.

The result is that both primers are now 97% bound, and thus optimal PCR efficiency would be observed. Notice that the Tm ’s of the two primers are not equal in the right panel.

Designing Forward and Reverse primers to have matching Tm’s is the best strategy to optimize PCR

Primer quality (virtual PCR efficiency) determination

An abstract parameter called Primer Quality (PQ) that can help to estimate the efficiency of primers for PCR.

PQ is calculated by the consecutive summation of the points according to the following parameters:

total sequence and purine–pyrimidine sequence complexity, the melting temperatures of the whole primer and of the terminal 3′ and 5′;

self-complementarity, which gives rise to possible dimer and hairpin structures, reduces the final value.

Almost all quality “excellent” primers can be use at the annealing temperature from 68°C to 72°C without losing PCR efficiency and show stable efficient amplification in a range of PCR annealing temperature.

Higher quality primers are not only better for PCR efficiency but are also more immune to changing PCR conditions.

Primer quality (virtual PCR efficiency) determination

Primer design selection criteria

Criteria Range Ideal

Length (nt) >11 >20

Tm range (C)a 45 – 75 60 – 68

Tma 12 bases at 3’-end 34 – 48 41 – 47

GC (%) 30 – 70 50

3’-end composition (5’-nnn-3’) nnn ssa, sws, wss

Sequence linguistic complexity (LC, %) b 50 – 100 >95

Sequence Quality (PQ, %) 50 – 100 >95

a Nearest neighbour thermodynamic parameters. b Sequence linguistic complexity measurement was performed using the alphabet-capacity l-gram method.

The secondary (non-specific) binding test

The specificity of the oligonucleotides is one of the most important factors for good PCR;

optimal primers should hybridize only to the target sequence, particularly when complex genomic DNA is used as the template.

Amplification problems can arise due to primers annealing to repetitious sequences (retrotransposons, DNA transposons, or tandem repeats).

Virtual (in silico) PCR

In silico PCR refers to computational tools used to calculate theoretical polymerase chain reaction (PCR) results using a given set of primers (probes) to amplify DNA sequences from a sequenced genome or transcriptome.

Primer optimization has two goals: efficiency and selectivity.

Efficiency involves taking into account such factors as GC-content, efficiency of binding, complementarity, secondary structure, and annealing and melting point (Tm).

Primer selectivity requires that the primer pairs not fortuitously bind to random sites other than the target of interest, nor should the primer pairs bind to conserved regions of a gene family.

If the selectivity is poor, a set of primers will amplify multiple products besides the target of interest.

Virtual (in silico) PCR

The parameters set to allow different degrees of mismatches at the 3′ end of the primers.

The programme can also handle degenerate primers or probes including those with 5′ or 3′ tail sequences.

Probable PCR products can be found for linear and circular templates using standard or inverse PCR as well as for multiplex PCR.

This in silico tool is useful for quickly analysing primers or probes against target sequences, for determining primer location, orientation, efficiency of binding, and calculating their Tm's.

In silico Primer(s) search for:

1 5'-gcttgtcctcaagcgaaaassa

Position: 251->272 22bp 89% Tm = 56.9°C

5-gcttgtcctcaagcgaaaassa->

||||||||||||||||:::::|

tcgcttgtcctcaagcgarrrnnaagtg

Position: 285->306 22bp 86% Tm = 56.9°C

5-gcttgtcctcaagcgaaaassa->

||||||||||||||||::::::

tcgcttgtcctcaagcgawrwnnratcc

2 5'-cgcagcgttctcataaggtcr

Position: 1074<-1094 21bp 95% Tm = 57.9°C

<-rctggaatactcttgcgacgc-5

|:|||||||||||||||||||

cgssaccttatgagaacgctgcgac



PCR product size: 844bp Ta=66°C



PCR product size: 810bp Ta=66°C

Comparison of primer design and oligonucleotide analysis tools

+ Feature supported, and- Feature not supported

Features Primer-BLAST (Primer3) IDT SciTools: PrimerQuest,

OligoAnalyzer 3.1

PerlPrimer BiSearch Web server PrimerDigital Web Tools

Primer or probe design, length (nt) 15-30 16-35 12-30 10-35 12-500

Limit for sequence length (nt) 50,000 no limit no limit 5,000 no limit

Relative calculation speed quick slow slow very slow very quick

Multiple templates (sequences or primers) and multiple targets inside each sequence

- - - - +

Individual options for each sequence + + + + + Degenerate nucleotides in all operations (Tm calculation, searches and probe, primer design, etc.)

- + - + +

LNA and other nucleotide modifications - + - - + High-throughput runs enabled - - - - + Calculation of optimal annealing temperature

- - - - +

Primer's 3'-end cross and self-dimers - + + + + G-quadruplex detection - - - - + BLAST search + - + + -internal sequence test - - - - + external (specific library) test + - + + + Multiplex with pair primers and/or single primers

- - - - +

in silico for multiple sequences and primers - - - + +

Universal and unique - - - - + Inverted and circular sequences - - - - + Bisulphite modification assays and in silico - - + + +

Polymerase Extension multi-fragment assembly cloning

- - - - +

Oligonucleotide assembly for LCR - - - - +

Comparison Linguistics Complexity with some on-line software

PCR primers design software, in silico PCR, and oligonucleotide assembly and analysis WEB tools

http://primerdigital.com/tools/

Analyze Features:

- general information

-oligonucleotide (Tm, dG, dS and dH), melting temperature calculation for standard and degenerate oligonucleotides including LNA and other modifications;

- evaluation of PCR efficiency;

- linguistic complexity;

- dimer and G/C-quadruplex detection; - dilution and resuspension calculator.

PCR primers design software, in silico PCR, and oligonucleotide assembly and analysis WEB tools


Analyze Features:

PCR tool provides comprehensive and professional facilities for designing primers for most PCR applications and their combinations: standard, multiplex, long distance, inverse, real-time, group-specific (universal primers for phylogenetically related DNA sequences) and unique (specific primers for each from phylogenetically related DNA sequences), bisulphite modification assays, polymerase extension PCR multi-fragments assembly cloning (OE-PCR); and microarray design;

in silico (virtual) PCR or primers and probes search or in silicoPCR against whole genome(s) or a list of chromosome -prediction of probable PCR products and search of potential mismatching location of the specified primers or probes;comprehensive primer test, the melting temperature calculation for standard and degenerate oligonucleotides including LNA and other modifications, primer PCR efficiency, primer's linguistic complexity, and dilution and resuspension calculator;

analyzes different features of multiple primers simultaneously, the melting temperature, GC content, sequence linguistic complexity, primer PCR efficiency and molecular weight, the extiction coefficient, the optical density (OD)….

FastPCR is an integrated tool for PCR primers or probe design, in silico PCR, oligonucleotide assembly and analyses, alignment and repeat searching

FastPCR software

http://primerdigital.com/fastpcr.html

online Java Tools



Kalendar R, Lee D, Schulman AH 2009. FastPCR Software for PCR Primer and Probe Design and Repeat Search. Genes, Genomes and Genomics, 3 (1): 1-14.

http://primerdigital.com/fastpcr.html


Web sites related to PCR primer designer

NCBI/Primer-BLAST (Primer3):http://www.ncbi.nlm.nih.gov/tools/primer-blast/

PrimerDigital online tools:http://primerdigital.com/tools/

Oligomer online PCR tools:http://www.oligomer.fi/site/?lan=3&page_id=33

IDT online SciTools:http://idtdna.com/scitools/scitools.aspx

MWG /Operon tools:http://www.eurofinsgenomics.eu/

http://www.ncbi.nlm.nih.gov/tools/primer-blast/


http://www.oligomer.fi/site/?lan=3&page_id=33

http://eu.idtdna.com/scitools/scitools.aspx

http://www.eurofinsgenomics.eu/



OligoAnalyzer 3.1

PrimerDigital Web Tools

FastPCR softwarePrimer or probe design, length (nt) 15-30 16-35 12-500

Limit for sequence length (nt) 50,000 no limit no limit

Relative calculation speed quick slow very quick

Enable high-throughput runs, multiple templates (sequences or primers) and multiple targets inside each sequence

no no yes

Individual options for each sequence yes yes yes

Degenerate nucleotides in all operations (Tm calculation, searches and probe, primer design, etc.) LNA and other nucleotide modifications

no yes yes

Calculation of optimal annealing temperature no no yes

Primer PCR efficiency and linguistic complexity determination: the average value for the linguistics complexity of primers

no,LC=79.6±9.4% (6000 primers)

no,LC=84.4±8.1% (407 primers)

yes,LC=91.1±3.6% (6000 primers)



OligoAnalyzer 3.1


FastPCR software

Primer dimers, self-dimer and for alternative to Watson-Crick base pairing, like wobble base pairs or G/C-quadruplexes detection

Primer's 3'-end cross and self-dimers yes yes yes

Primer's internal cross and self-dimers partly partial yes

No Watson-Crick base pairing detection no no yes

Alternative amplification

BLAST search yes no no

internal sequence test yes no yes

external (specific library) test yes no yes



OligoAnalyzer 3.1


FastPCR software

PCR applications

Multiplex PCR no no yes

in silico PCR for multiple sequences and primers, and searching multiple targets simultaneously within a certain range

no no yes

Universal and unique PCR;Inverted PCR and circular sequence

no no yes

Bisulphite modification PCR assays and in silicoPCR

no no yes

Polymerase Extension PCR multi-fragments assembly cloning;

Oligonucleotides assembly for LCR and PCR

no no yes

an introduction to pcr primer design, the features …pcr primer design is a critical step in all...

Documents