an abstract of the dissertation...
TRANSCRIPT
AN ABSTRACT OF THE DISSERTATION OF
Chelsea Wolk for the degree of Doctor of Philosophy in Biochemistry and
Biophysics presented on December 12, 2016.
Title: Initial in vitro and in vivo Characterization of the Membrane Trafficking
Protein Fer1L6.
Abstract approved: ______________________________________________________
Colin P. Johnson
Abstract
A fundamental difference between prokaryotic and eukaryotic cells is the
presence of membrane bound organelles in eukaryotes. The dynamics of
membrane trafficking within the cell are responsible for everything from
intercellular communication and cell homeostasis, to mitosis, cell migration, and
differentiation. These processes require exocytosis and compensatory
endocytosis, often working in concert to create vesicle cycling. While
constitutive exo‐ and endocytosis occurs independently of extracellular
stimulus, , regulated membrane trafficking events are quiescent until triggered
by a messenger, such as calcium. Exocytosis is primarily carried out by SNARE
proteins, while endocytosis is carried out by either clatherin‐related proteins or
clatherin‐independent proteins, such as Eps 15 homology domain proteins
(EHDs). However, none of these proteins are directly calcium sensitive. Thus,
calcium regulated exocytosis requires an additional calcium‐regulated protein.
In neuronal exocytosis the synaptotagmin family confers calcium sensitivity to
the process, and members are typically composed of a membrane anchor and
two C2 domains. Another family of proteins involved in calcium sensitive
exocytosis is the ferlin family. Composed of 5 to 7 C2 domains, these membrane
proteins have been implicated in various membrane trafficking diseases, ranging
from muscular dystrophy to non‐syndromic deafness, and have been implicated
in multiple cancer types.
The goal of this dissertation is to characterize the sixth mammalian ferlin
protein, Fer1L6, which has not been previously studied. Currently, Fer1L6 has no
known disease state links. Nevertheless, characterization of both tissue
specificity and functional roles of the Fer1L6 protein will be highly valuable to
furthering our understanding of the ferlin protein family, and strengthen our
understanding of membrane dynamics inside eukaryotic cells.
To date little is known about the function or expression of Fer1L6, despite
the fact that it is a predicted protein coding gene in a wide range of vertebrate
genomes. Reverse genetic techniques were used to elucidate a possible
functional role of Fer1L6 in the model organism D. rerio (zebrafish). A Fer1L6
morpholino knockdown resulted in abnormal skeletal muscle development, in
which the sarcoplasmic reticulum and t‐tubules do not form properly.
Additionally, the myofibrils and myosepta are disorganized and irregularly
shaped. Heart rate quantitation and microscopy of cardiac muscle shows
underdevelopment of the heart chambers with decreased heart rate. However,
initial studies with a first generation Fer1L6 mutant zebrafish line do not exhibit
any of the same gross phenotypes that were observed with the morpholino
knockdown. Further investigation of the mutant line is required to fully
characterize the effects of the mutation.
The muscle related phenotypes seen in the morpholino studies initiated an
investigation into Fer1L6 in the C2C12 myoblast cell line. Using both q‐PCR and
western blots, no changes in Fer1L6 expression was detected during myoblast
differentiation into myotubes. Immunostaining of undifferentiated myoblasts
showed Fer1L6 localization to the perinuclear region with Fer1L6 puncta also
emanating outwards towards the plasma membrane. Additionally, there were
small levels of accumulation at the plasma membrane. These results are
consistent with previously proposed models in which Fer1L6 is involved in
trans‐Golgi to plasma membrane endocytic recycling events with Rab 11.
The results of this dissertation begin the process of determining a
functional role for Fer1L6, and demonstrate the feasibility for both zebrafish and
C2C12 cells as a model for future studies on the endogenous protein. The results
validate high‐throughput proteomic studies, and lend support to recently
literature with over expression in cell culture. Overall, we find that Fer1L6 is a
widely expressed protein that may be involved in both embryonic development
and maintaining homeostasis of tissues through endosomal recycling pathways.
Initial in vitro and in vivo Characterization of the Membrane Trafficking Protein
Fer1L6
by
Chelsea Wolk
A DISSERTATION
submitted to
Oregon State University
in partial fulfillment of
the requirements for the
degree of
Doctor of Philosophy
Presented December 12, 2016
Commencement June 2017
Doctor of Philosophy dissertation of Chelsea Wolk presented on December 12,
2016
APPROVED:
Major Professor, representing Biochemistry and Biophysics
Head of the Department of Biochemistry and Biophysics
Dean of the Graduate School
I understand that my dissertation will become part of the permanent collection of
Oregon State University libraries. My signature below authorizes release of my
dissertation to any reader upon request.
Chelsea Wolk, Author
ACKNOWLEDGEMENTS
This document is a compilation of five years’ worth of thought, research,
studying, experimentation, struggles, successes, and failures. It is also the
product of dedication and hard work from a multitude of people. I would like to
take this opportunity to thank everyone who played a role in the success of this
project and my graduate career as a whole. First I would like to thank my
graduate mentor Dr. Colin Johnson, this work was only possible because of your
willingness to take a chance on me and on a high risk thesis project. Your
guidance and encouragement was always steadfast. To the other Johnson lab
members, Sara Codding, Dr. Paroma Chatterjee, Dr. Josephine Bonventre, Dr.
Murugesh Narayanappa, Nicole Hames, Dr. Naomi Marty, Trisha Chau, and
Jacob Huegel know that much of this work is thanks to your hard work, ideas,
and input. Additionally, the zebrafish work was supported by Dr. Robert
Tanguay, Carrie Barton, and Jane La Du and their involvement and supervision
has been indispensable. I need to thank everyone who has served on my
graduate committee for their input and guidance. Thank you to Dr. Viviana
Perez, Dr. Barbara Taylor, Dr. Julie Greenwood, Dr. Weihong Qiu, and Dr. David
Hendrix.
Also, this type of graduate work would not be possible without the
support and love from my friends and family. I would like to thank my parents
for believing in me every day of my life, and always pushing me to reach for the
stars and never settle. I am grateful to my fellow graduate students at OSU,
particularly Kelsey Kean and Steve Friedman, for all of their support, friendship,
and coffee outings. Finally, deepest gratitude goes to my biggest champion, best
friend and rock my husband Ben Wolk. Thank you so much for following me
across the country and helping me make my dreams come true.
CONTRIBUTION OF AUTHORS
Chapter 1: Text was written by Chelsea Wolk with editing by Colin Johnson and
Josephine Bonventre.
Chapter 2: Experimental design was developed by Chelsea Wolk and Colin
Johnson. All data was collected and analyzed by Chelsea Wolk with minor
exceptions. Paroma Chatterjee conducted the ISH for 96hpf. Carrie Barton
maintained wildtype 5D adult zebrafish. Sara Codding helped with TEM
imaging. Sean Burrows helped with two‐photon imaging. Sa16199 fish line was
raised and maintained by Chelsea Wolk with assistance from Josephine
Bonventre. All text was written by Chelsea Wolk with editing by Colin Johnson.
Chapter 3: Experimental design was developed by Chelsea Wolk and Colin
Johnson. Cell culture and western blotting was performed by Chelsea Wolk and
Sara Codding. Q‐PCR was performed and analyzed by Chelsea Wolk. All text
was written by Chelsea Wolk with editing by Colin Johnson.
Chapter 4: Text was written by Chelsea Wolk with editing by Colin Johnson.
TABLE OF CONTENTS
Page
Chapter 1 ‐ Literature Review and Introduction ......................................................... 1
1.1 – Introduction .......................................................................................................... 1
1.2 – The Ferlin Family ................................................................................................. 2
1.2.1 – Dysferlin ......................................................................................................... 3
1.2.2 – Otoferlin .......................................................................................................... 4
1.2.3 ‐ Myoferlin ......................................................................................................... 4
1.2.4 ‐ Fer1L4 .............................................................................................................. 7
1.2.5 ‐ Fer1L5 .............................................................................................................. 7
1.2.6 ‐ Fer1L6 .............................................................................................................. 8
1.3 – A closer look at available Fer1L6 data .............................................................. 9
1.4 – Significance ......................................................................................................... 10
1.5 ‐ Figures .................................................................................................................. 12
1.6 – References ........................................................................................................... 15
Chapter 2 ‐ Characterization of Fer1L6 in a Zebrafish Model ................................. 20
2.1 – Introduction ........................................................................................................ 20
2.2 – Methods............................................................................................................... 21
2.3 – Results ................................................................................................................. 24
2.3.1 ‐ Expression of Fer1L6 in zebrafish .............................................................. 24
2.3.2 – Morpholino knock down ............................................................................ 25
2.3.3 – Fer1L6 mutant fish line ............................................................................... 28
2.4 – Discrepancies between morpholino and fish line results ............................ 30
2.5 – Discussion ........................................................................................................... 32
2.6 – Figures and Tables ............................................................................................. 35
2.6 – References ........................................................................................................... 48
TABLE OF CONTENTS (Continued)
Page
Chapter 3 ‐ Subcellular Localization and Expression of Fer1L6 in the C2C12 cell
line .................................................................................................................................... 51
3.1 ‐ Introduction ........................................................................................................ 51
3.2 ‐ Methods ............................................................................................................... 51
3.3 – Results ................................................................................................................. 53
3.3.1 ‐ Validation of antibody................................................................................. 53
3.3.2 ‐ Fer1L6 is expressed in myoblasts and differentiated myotubes ........... 54
3.3.3 ‐ Fer1L6 is expressed in HEK cells ............................................................... 56
3.3.4 ‐ Fer1L6 expression in mouse tissue ............................................................ 56
3.4 ‐ Discussion ............................................................................................................ 57
3.5 – Figures ................................................................................................................. 59
3.6 ‐ References ............................................................................................................ 68
Chapter 4 ‐ General Conclusion and Future Directions ........................................... 69
4.1 – Conclusions from study .................................................................................... 69
4.2 – New Questions Raised and Future Directions .............................................. 70
4.3 – References ........................................................................................................... 72
Bibliography ................................................................................................................... 74
LIST OF FIGURES
Figure Page
Figure 1.1 – Ferlin phylogenetic tree ........................................................................... 12
Figure 1.2 – Ferlin protein structure schematic ......................................................... 13
Figure 2.1 – Fer1L6 structure ........................................................................................ 35
Figure 2.2 – Fer1L6 expression during zebrafish development .............................. 36
Figure 2.3 – ISH of Fer1L6 in zebrafish ....................................................................... 37
Figure 2.4 – Fer1L6 splice blocking morpholinos ...................................................... 38
Figure 2.5 – Morpholino phenotype ............................................................................ 39
Figure 2.6 – Fer1L6 knockdown quantitation ............................................................ 40
Figure 2.7 – Survival and phenotype rates ................................................................. 41
Figure 2.8 – Morpholino knockdown results in abnormal skeletal muscle. ......... 42
Figure 2.9 – Cardiac related phenotype ...................................................................... 43
Figure 2.10 – Genotype rates of Fer1L6 mutant ......................................................... 44
Figure 3.1 – Western blot showing specificity of HPA054117 anti‐Fer1L6
antibody. .......................................................................................................................... 58
Figure 3.2 – WB showing expression of dysferlin and Fer1L6 in differentiated and
non‐differentiated C2C12 cells. .................................................................................... 59
Figure 3.3 – qPCR of myoferlin, dysferlin, and Fer1L6 in C2C12 cells during
differentiation ................................................................................................................. 60
Figure 3.4 – Fer1L6 localization in C2C12 cells.......................................................... 61
Figure 3.5 – Western blot of HEK cell lysate .............................................................. 62
Figure 3.6 – transcription in cardiac tissue ................................................................. 63
Figure 3.7 – western blot of mouse tissue ................................................................... 64
LIST OF TABLES
Table Page
1.1 – Ferlin function and expression ……………………………..………………..14
2.1 – q‐PCR primers for zebrafish………………………………………………….45
2.2 – Fer1L6 sequence of sa16199 mutation……………………………………….47
3.1 – q‐PCR primers for C2C12 cells……………………………………………….65
1
Chapter 1 ‐ Literature Review and Introduction
1.1 – Introduction
Membrane trafficking is an essential factor in maintaining normal function
and health of a eukaryotic cell. Endocytosis is responsible for membrane protein
regulation, cell migration, invagination of extracellular material, membrane
maintenance, and vesicle reformation [1][2]. Similarly, exocytosis is responsible
for organelle maintenance, plasma membrane growth during cell division,
membrane protein organization, neurotransmitter release, extracellular protein
secretion, and membrane repair [3][4]. Together, endocytosis and exocytosis
events work together to create the vesicle cycle, whereby small fluid‐filled lipid
bi‐layer enclosed structures continually fuse with the plasma membrane and
then re‐enter the cell via membrane invagination. These vesicle cycling events
are engaged in functions including synaptic vesicle recycling and membrane
protein regulation [5][6]. The fusion events are mediated by a family of proteins
known as SNAREs (soluble NSF attachment protein receptors) which are
grouped into three classes; syntaxins, SNAPs, and synaptobrevins (or VAMPs).
One of each class is required to from a four helix bundle, which is responsible for
driving membrane fusion[7]. While both constitutive and regulated secretion use
SNARES, regulated secretion is sensitive to changes in intracellular
Ca2+concentration, though SNAREs are not calcium sensors themselves.
Therefore, an additional protein, or proteins, is needed to confer calcium
sensitivity and regulate the fusion event by acting as a Ca2+ switch.
Synaptotagmins are a well studied family of proteins known to act as Ca2+
sensitive regulators in specific SNARE mediated membrane fusion events[8]. C2
2
domains are the beta sandwich structural domains found in many calcium
sensitive membrane binding proteins. However, synaptotagmins are not unique
in their ability to act as Ca2+ sensors in this fashion. Other multi C2 domain
containing proteins have the ability to perform such a role, including the ferlin
protein family[9]. The following review focuses on the current understanding of
phenotypes and functional roles of the six mammalian ferlin genes, and
highlights areas of interest for future studies (Table 1.1).
1.2 – The Ferlin Family
The first ferlin discovered was Fer1 in C. elegans. Fer1 is responsible for
calcium sensitive vesicle fusion during spermatogenesis when organelles fuse
with the plasma membrane of the sperm [10]. Gene duplication has resulted in
four ferlin genes in boney fish (myoferlin, otoferlin, dysferlin, and Fer1L6) [11].
While mammals have six ferlin family member genes (myoferlin, otoferlin,
dysferlin, Fer1L4, Fer1L5, and Fer1L6), but in humans Fer1L4 is a pseudogene
expressed only as a functional RNA (Figure 1.1). The first three of the
mammalian ferlins have been studied extensively, while Fer1L4, Fer1L5, and
Fer1L6 are relatively un‐characterized. Of the three ferlins that have been
studied, all are believed to be Ca2+ sensors involved in vesicle fusion with the
plasma membrane[9].
The ferlins are a family of proteins which share a similar structure of five
to seven C2 domains followed by a C terminal single pass transmembrane
domain[12](Figure 1.2). The C2 domains of otoferlin and dysferlin are known to
bind both Ca2+ and SNAREs, as well as bind lipid bilayers[13][14]. While the
mechanism of action for ferlins is not yet fully understood, it is generally
3
accepted that ferlins assist SNARE bundle formation and membrane fusion by
lowering the activation energy required for fusion [15][16]. Work on
synaptotagmin suggests that localized membrane puckering at the point of C2
domain binding is one method by which C2 domains can decrease this energy
barrier [15].
1.2.1 – Dysferlin
Dysferlin, (Fer1L1), was the first of the mammalian ferlin family members
to be studied. Dysferlin was first identified as the mutated gene in human
patients with limb girdle muscular dystrophy type 2B (LGMD2B) and Myoshi
myopathy, two type of muscular dystrophy that result in a wide range of both
proximal and distal lower limb muscle myopathies[17][18]. Immunofluorescent
studies have determined that dysferlin resides at the skeletal muscle plasma
membrane, although multiple studies have concluded that the protein is
expressed in other tissue types as well [19]. Transcript analysis suggests
ubiquitous expression, although these results have not been confirmed at the
protein level[20]. To date, the bulk of dysferlin research has focused on its
involvement in sarcolemma repair, where it is believe to be the calcium sensor
for vesicle recruitment and subsequent fusion at skeletal muscle wound sites
[21]. Loss of this function leads to skeletal muscle myopathy and the muscular
dystrophy phenotype. In addition to sarcolemma, dysferlin has also been found
within the t‐tubules of skeletal muscle, where it is believed to function in
conjunction with the calcium channel Dihydropyridine receptor (DHPR) to
maintain structural integrity of the t‐tubules and prevent excessive calcium
influx [22].
Very little research has focused on dysferlin’s role in non‐muscle tissue,
although it is expressed in, at the minimum, stomach, lung, kidney, brain, liver,
4
and spleen[19]. In addition to muscular dystrophy, dysferlin‐null mice exhibit
impaired angiogenesis, and dysferlinopothy patients also present with
hyperactive monocyte activity, both of which have been linked to dysferlin’s role
in cell adhesion through a dysferlin‐integrin complex [23][24]. Additional
diseases associated with altered expression and localization of dysferlin are
diamond‐blackfan anemia and severe preeclampsia[25][26]. This highlights the
need for a better understanding of dysferlin’s mechanistic role outside of skeletal
muscle.
1.2.2 – Otoferlin
Gene Fer1L2, which encodes for the protein otoferlin, is found
predominantly in the sensory hair cells of the inner ear [27]. Loss of function
mutations in this gene lead to autosomal recessive non‐syndromic deafness,
where severely impaired sound encoding is the only presenting phenotype [28].
In addition, there are unique mutations which cause temperature sensitive loss of
hearing, in which functional hearing is impaired at elevated body temperatures
as small as 1°C over normal [29]. Hearing is completely restored after normal
body temperature returns.
Mechanistically, otoferlin is thought to act as the calcium sensor for
exocytotic neurotransmitter release [30]. The C2 domains of otoferlin have been
shown to bind membranes in a calcium sensitive manner and this binding is
enhanced in the presence of liposomes containing plasma membrane specific
lipids including PI(4,5)P2 [31]. Although otoferlin is thought to regulate vesicle
fusion, otoferlin’s relationship to SNARE proteins is unclear.
1.2.3 ‐ Myoferlin
Gene Fer1L3, encoding myoferlin, was first characterized at the protein
level in 2000 in relation to dysferlinopathies, because of its expression in skeletal,
5
cardiac, and smooth muscle [32]. Myoferlin mRNA is also found in kidney,
pancreas, lung, and at very high levels in placenta [32]. More recent transcript
analysis shows ubiquitous expression of myoferlin[20]. However, western blot
analysis indicates protein persistence primarily in muscle, heart, and to a lesser
extent lung[32].
Owing to its sequence similarity with dysferlin, myoferlin was originally
studied primarily in skeletal muscle, although its proposed link to
dysferlinopothy was later refuted[33]. It was instead implicated in myoblast cell
fusion during muscle maturation and regeneration[34]. In the C2C12 skeletal
muscle cell line, myoferlin is expressed in both undifferentiated myoblasts, and
differentiated myotubes. Immediately before myogenesis, myoferlin localizes to
the plasma membrane, particularly near the point of fusion where a massing of
vesicles occurs immediately before cell‐cell fusion[34]. Additionally, myoferlin
null mice exhibit decreased total muscle mass, as well as decreased muscle fiber
size [34].
The mechanism of myoferlin’s involvement in myogenesis is thought to
involve vesicle recycling and accumulation at the point of fusion. Large volumes
of membrane are required for myoblast fusion, and clathrin‐dependent and
clathrin‐independent endocytotic pathways have both been implicated in this
large accumulation of membrane and ferlin proteins [35]. Clathrin‐dependent
endoycytotic vesicles containing myoferlin are thought to be initiated by the
endocytic recycling protein EH domain containing protein 2 (EHD2) [36]. EHD2
is a known binding partner of myoferlin, and the loss of either myoferlin or
EHD2 results in decreased myogenesis and vesicle recycling in the mouse
myoblast cell line C2C12 [36]. The similarity in myoferlin‐depleted and EHD‐
depleted phenotypes suggests a direct relationship between these proteins and
6
an exo‐ endocytotic vesicle cycle mechanism. Another vesicle cycling related
protein shown to colocalize with myoferlin in GRAF1 [37]. GRAF1 is involved in
tubular recycling endosomes, an organelle which provides much of the
membrane mass necessary for myogenesis [38].
More recently, myoferlin has been linked to tumor growth and metastasis
[39]. Similar to its role in myogenesis, myoferlin has been shown to play a
similar function in endothelial cell endocytosis[40], which is crucial for receptor
trafficking at the plasma membrane. This vesicle recycling functionality
illustrates a possible mode of action for myoferlin’s involvement in various types
of cancer. Myoferlin’s proposed involvement in receptor trafficking has been
supported by studies done in breast cancer, where myoferlin is found to be
overexpressed [41]. Through depletion of myoferlin in breast cancer cell lines, it
was determined that myoferlin is involved in epidermal growth factor receptor
(EGFR) degradation[41]. Upon activation of EGFR, downstream receptor
tyrosine kinase (RTK) pathways promote proliferation and metastasis. To
control this process, activated EGFR is sequestered to the cytoplasm via clathrin
dependent endocytosis. The majority of these endosomes are then targeted for
lysosomal degradation in an effort to prevent continual activation of the RTK
pathways. However, depletion of myoferlin in breast cancer cell lines results in
limited EGFR degradation, despite the fact that endocytosis is functioning
properly[41]. Interestingly, myoferlin depletion also leads to inhibition of
metastasis and proliferation[42],[41]. Myoferlin involvement in plasma
membrane related processes has been well established, but a better
understanding of its precise mechanism of action and that relationship to disease
state needs further investigation.
7
1.2.4 ‐ Fer1L4
The Fer1L4 gene is unique among the ferlins, because in humans it is only
expressed as a long non‐coding RNA (lncRNA)[11]. The gene has been
determined to have no functional reading frames, and therefore was predicted to
only function as an RNA transcript, although this has not be verified
experimentally. Fer1L4 is expressed primarily in stomach tissue, although low
levels are found in thymus, kidney, and colon. [20]. Originally found in gastric
cancers, the Fer1L4 lncRNA is believed to regulate expression of the tensin
related protein, Phosphotase and tensin homolog (PTEN), through a competing
endogenous RNA pathway with miR‐106a‐5p[43]. In gastric cancers, the Fer1L4
gene is underexpressed, leading to an associated underexpression of PTEN,
while miR‐106a‐5p is overexpressed. This can be reversed with the
overexpression of Fer1L4 [44]. It is believed that this regulation accelerates the
G0/G1 to S phase transition, thus leading to increased cell proliferation [43]. This
mechanism can explain a similar response to Fer1L4 expression profiles in colon
cancer. In colon cancer cell lines, Fer1L4 overexpression decreased cell
proliferation, migration, and invasion [44]. While this leads to excitement about
the possibility of Fer1L4 as a tumor suppressor, these two studies are still very
new and more research is needed.
1.2.5 ‐ Fer1L5
The Fer1L5 gene, is thought to be involved in endosome recycling through
EHD1/2 pathways [45][46]. One of these studies in C2C12 cells suggests
myoferlin, Fer1L5, EHD1/2 and GRAF1 are interconnected, and work together to
regulate membrane and protein recycling events. Myoferlin and Fer1L5 are the
only two mammalian ferlins with an EHD binding NPF motif, suggesting an
8
even closer connection between myoferlin, Fer1L5, and endocytotic pathways
[46],[36]. Additionally, loss of EHD1 causes accumulation of Fer1L5 and
caveolin‐3 to the perinuclear region [45]. One hypothesis for the demonstrated
protein‐protein interactions between these two groups of proteins is that it
provides a mechanism of ensuring that the proteins are continually trafficked
together. This means that ferlins, while previously implicated in endocytosis,
may not be directly involved, but rather localized to the membrane so that later
fusion is possible. The decreased endocytotic activity, therefore, would be due to
a loss of exocytosis, which provides the lipid content necessary for successive
endocytosis. This is supported by the observation that endocytosis is reduced,
and not eliminated completely. While this study is of great value, giving us a
first look at possible functions of Fer1L5, it is analyzed only through the lens of
its possible relationship to myoferlin, and further studies differentiating the two
proteins is warranted.
1.2.6 ‐ Fer1L6
To date, Fer1L6 is the least characterized member of the ferlin family.
This gene, whose translated protein will also be called Fer1L6, lacks an N‐
terminal C2A domain. Excluding sequence analysis and high throughput
studies, there are only a handful of references ever made to Fer1L6 in the
literature. The first, in 2008 Doherty et al. mentioned unpublished data
suggesting Fer1L6 is expressed in C2C12 myoblasts[36]. In 2010. Ledig et al.
showed that a single patient, in a study group of 44 women with premature
ovarian failure, had a deletion in Fer1L6 [47]. This observation may hint to a
function related to that of Ferlin‐1 in C. elegans, were it plays an essential role in
spermatogenesis [10]. Finally, the most recent and most thorough investigation
9
of Fer1L6 was a in HEK cell culture model, where Fer1L6 overexpression
demonstrated it localized primarily to the Golgi, but was also found at low levels
on the plasma membrane[20]. Redpath et al. proposed a functional role of
Fer1L6 in trans‐golgi to plasma membrane recycling, based on its colocalization
with Rab11[20].
1.3 – A closer look at available Fer1L6 data
Further information about Fer1L6 can be ascertained from an analysis of
its homology to the other ferlin family members and its predicted structural
domains. Its closest paralog is otoferlin, sharing a 48% sequence identity in
humans (Figure 1.1). Structurally, the most prevalent fold in ferlins is the C2
domain, which consists of a 7 to 8 stranded beta sandwich. Loops 1 and 3 are of
most importance, because they contain the aspartic residues which coordinate
Ca2+ [48]. In other non‐ferlin C2 domains, these loops are also the ones that insert
into the lipid bilayer, to confer membrane binding capabilities [49]. Fer1L6 is
predicted to contain five C2 domains, which have been labeled C2B, C2C, C2D,
C2E, and C2F due to their similarity to those domains across other ferlins (Figure
1.2) [50]. The first domain, C2A, is missing from the structure prediction,
because the N‐terminal sequence before the predicted C2B is only 82 amino acids
long, much shorter than the classical 130 amino acid length.
According to the University of Zurich’s “protein abundance across
organisms database” (PaxDb), Fer1L6 was found in high levels in blood platelets
[51]. The Human Protein Atlas Project developed a Fer1L6 antibody that
recognizes the linker region between the C2E and C2F domains [52]. Using this
antibody they have identified Fer1L6 in bronchus, stomach, and small intestine
at “high” levels, and a large variety of tissues including lymph node, cardiac
muscle, skeletal muscle, colon, testis, seminal vesicle, placenta, cerebral cortex,
10
and thyroid gland at “medium” levels [52]. This wide range of tissue types
suggests that Fer1L6 may be ubiquitous expressed.
1.4 – Significance
In the last several years, some of the largest projects in the life science are
aimed at using high throughput techniques and large data sets to map all
possible situations or conditions or molecules in a living organism. For example,
the Human Protein Atlas has looked at RNA‐seq and microarray
immunohistochemistry for every protein in the human genome and the SNP
Control Database has genotype frequency data for over 1 million SNPs in the
human genome [52][53]. The human genome project was the first of these high
energy large data set projects to be completed. Yet a map of the whole genome
left us, like most major breakthroughs in science, with more questions than
answers. We now know that there are roughly 20,000 protein coding genes in
the human genome. Additionally, the human protein atlas project can now
classify 92% of those proteins based on sequence similarity and protein families
[52]. However, being able to classify Fer1L6 as a regulator of membrane fusion
based on homology, is not enough. It is impossible to gain a full understanding
of the complexity, physiology, and mechanism of human development and
homeostasis, without gaining a more complete understanding of the role each
member of the proteome.
High throughput methods and automated data analysis have allowed for
major advances in the breadth of knowledge about the human proteome.
However, our understanding is quite shallow, and these automated methods can
lead to errors, as evident in the wide range of RNA seq results for Fer1L6 in
human tissue, based on the Expression Atlas, a meta‐analysis of 6 different high
11
throughput RNA‐seq studies[54]. Therefore, research focused on manually
independently verifying these results is important. The production of research
tools such as antibodies and mutant zebrafish lines created by high throughput
methodologies has made this work easier.
In this dissertation, Fer1L6 was characterized using a multi‐faceted
approach. We investigated Fer1L6 function in vertebrate development and
homeostasis at the organismal, cellular, sub‐cellular, and molecular levels. Using
a variety of methodologies and model systems, we aimed to develop and
validate the most complete characterization of Fer1L6 expression, localization,
physiological role and molecular function to date.
12
1.5 ‐ Figures
Figure 1.1 – Ferlin phylogenetic tree
Phylogenetic tree of human ferlin proteins relative to ancestral C. elegan Fer1
gene. Ensemble transcript IDs used for analysis are indicated under gene name.
The full length pseudogene sequence for Fer1L4 was used, because multiple
shorter transcribed RNAs exist, but utilize a full range of exons from the original
pseudogene. Revised transcript identification may explain divergence of this
phylogenetic tree from the previously published tree by Lek et al. which showed
closer homology between Fer1L6 and Fer1L4 than Fer1L6 and otoferlin[50].
13
Figure 1.2 – Ferlin protein structure schematic
Schematic of mammalian and ancestral Fer1 proteins produced from ferlin genes
based on structure prediction. Green ovals represent lipid and calcium binding
C2 domains labeled C2A through C2G from N‐terminal to C‐terminal. The
unique to ferlins DYSF domain is represented by a blue pentagon. The single
pass C‐terminal transmembrane domain is represented at an orange rectangle.
Fer1 and Fer1L6 do not have C2A domains, and the type 1 mammalian ferlins
dysferlin, myoferlin, and Fer1L5 have a predicted seventh C2 domain C2F.
Fer1L4 is not included, as it is not predicted to produce a functional protein.
14
Gene Function Diseases Known Expression
Dysferlin Calcium sensitive
plasma membrane
vesicle fusion [21]
LGMD2B, Miyoshi
myopathy[17][18]
Skeletal muscle,
cardiac muscle,
Ubiquitous?
[19][20]
Myoferlin Cell‐cell fusion in
myoblast fusion [34]
Cancer [55] Ubiquitous? [20]
Otoferlin Synaptic vesicle
cycling [30]
Autosomal recessive
Non‐syndromic
deafness, [28]
Sensory hair cells
and brain. [27]
Fer1L4 Creates lncRNA
which suppresses
cancer cell growth
[44]
Colon cancer [44] Stomach, colon,
lymph node [20]
Fer1L5 Cell‐cell fusion
(myotube
formation) via
EHD1 and EHD2
interactions [36][46]
unknown Skeletal muscle,
pancreas [20]
Fer1L6 unknown unknown Heart, kidney,
lung, stomach,
colon, myoblasts
[20]
Fer1
(C.elegans)
Fusion of
membranous
organelles with the
spermatid plasma
membrane. [10]
Infertility Sperm, muscle of
adult worms. [10]
Table 1.1 – Ferlin function and expression
Mammalian ferlin gene family members and ancestral Fer1 from C. elegans with
known functions, disease phenotypes, and tissue type with known expression at
either the transcript or protein level. Known expression tissues only includes
small scale q‐pcr or western blot results, and excludes large scale RNA‐seq and
mass spectrometry high throughput studies.
15
1.6 – References
[1] T. Yamashita, Ca2+‐dependent regulation of synaptic vesicle endocytosis,
Neurosci. Res. 73 (2012) 1–7. doi:10.1016/j.neures.2012.02.012.
[2] F. Buss, S.D. Arden, M. Lindsay, J.P. Luzio, J. Kendrick‐Jones, Myosin VI
isoform localized to clathrin‐coated vesicles with a role in clathrin‐
mediated endocytosis, EMBO J. 20 (2001) 3676–3684.
doi:10.1093/emboj/20.14.3676.
[3] Y.A. Chen, R.H. Scheller, SNARE‐mediated membrane fusion., Nat. Rev.
Mol. Cell Biol. 2 (2001) 98–106. doi:10.1038/35052017.
[4] Z.P. Pang, T.C. S??dhof, Cell biology of Ca2+‐triggered exocytosis, Curr.
Opin. Cell Biol. 22 (2010) 496–505. doi:10.1016/j.ceb.2010.05.001.
[5] T.C. Südhof, THE SYNAPTIC VESICLE CYCLE, Annu. Rev. Neurosci. 27
(2004) 509–547. doi:10.1146/annurev.neuro.26.041002.131412.
[6] D. Leto, A.R. Saltiel, Regulation of glucose transport by insulin: traffic
control of GLUT4., Nat. Rev. Mol. Cell Biol. 13 (2012) 383–96.
doi:10.1038/nrm3351.
[7] T. Sollner, M.K. Bennett, S.W. Whiteheart, R.H. Scheller, J.E. Rothman, A
Protein Assembly‐Disassembly Pathway In Vitro That May Correspond to
Sequential Steps of Synaptic Vesicle Docking , Activation , and Fusion,
Cell. 75 (1993) 409–418.
[8] E. Hui, J.D. Gaffaney, Z. Wang, C.P. Johnson, C.S. Evans, E.R. Chapman,
Mechanism and function of synaptotagmin‐mediated membrane
apposition., Nat. Struct. Mol. Biol. 18 (2011) 813–821.
doi:10.1038/nsmb.2075.
[9] A. Lek, F.J. Evesson, R.B. Sutton, K.N. North, S.T. Cooper, Ferlins:
Regulators of Vesicle Fusion for Auditory Neurotransmission, Receptor
Trafficking and Membrane Repair, Traffic. 13 (2012) 185–194.
doi:10.1111/j.1600‐0854.2011.01267.x.
[10] N.L. Washington, S. Ward, FER‐1 regulates Ca2+ ‐mediated membrane
fusion during C. elegans spermatogenesis., J. Cell Sci. 119 (2006) 2552–62.
doi:10.1242/jcs.02980.
[11] P. Flicek, I. Ahmed, M.R. Amode, D. Barrell, K. Beal, S. Brent, et al.,
Ensembl 2013, Nucleic Acids Res. 41 (2013). doi:10.1093/nar/gks1236.
[12] J.L. Jimenez, R. Bashir, In silico functional and structural characterisation of
ferlin proteins by mapping disease‐causing mutations and evolutionary
information onto three‐dimensional models of their C2 domains, J. Neurol.
Sci. 260 (2007) 114–123. doi:10.1016/j.jns.2007.04.016.
16
[13] C.P. Johnson, E.R. Chapman, Otoferlin is a calcium sensor that directly
regulates SNARE‐mediated membrane fusion, J. Cell Biol. 191 (2010) 187–
197. doi:10.1083/jcb.201002089.
[14] N. Abdullah, M. Padmanarayana, N.J. Marty, C.P. Johnson, Quantitation of
the calcium and membrane binding properties of the C2 domains of
dysferlin, Biophys. J. 106 (2014) 382–389. doi:10.1016/j.bpj.2013.11.4492.
[15] E. Hui, C.P. Johnson, J. Yao, F.M. Dunning, E.R. Chapman, Synaptotagmin‐
Mediated Bending of the Target Membrane Is a Critical Step in Ca2+‐
Regulated Fusion, Cell. 138 (2009) 709–721. doi:10.1016/j.cell.2009.05.049.
[16] S.J. Codding, N. Marty, N. Abdullah, C.P. Johnson, Dysferlin Binds
SNAREs and Stimulates Membrane Fusion in a Calcium Sensitive Manner,
J. Biol. Chem. (2016) jbc.M116.727016. doi:10.1074/jbc.M116.727016.
[17] R. Bashir, S. Britton, T. Strachan, S. Keers, E. Vafiadaki, M. Lako, et al., A
gene related to Caenorhabditis elegans spermatogenesis factor fer‐1 is
mutated in limb‐girdle muscular dystrophy type 2B., Nat. Genet. 20 (1998)
37–42. doi:10.1038/1689.
[18] J. Liu, M. Aoki, I. Illa, C. Wu, M. Fardeau, C. Angelini, et al., Dysferlin, a
novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb
girdle muscular dystrophy., Nat. Genet. 20 (1998) 31–36. doi:10.1038/1682.
[19] L. V Anderson, K. Davison, J.A. Moss, C. Young, M.J. Cullen, J. Walsh, et
al., Dysferlin is a plasma membrane protein and is expressed early in
human development, Hum. Mol. Genet. 8 (1999) 855–861.
doi:10.1093/hmg/8.5.855.
[20] G.M.I. Redpath, R.A. Sophocleous, L. Turnbull, C.B. Whitchurch, S.T.
Cooper, Ferlins Show Tissue‐Specific Expression and Segregate as Plasma
Membrane/Late Endosomal or Trans‐Golgi/Recycling Ferlins, Traffic. 17
(2016) 245–266. doi:10.1111/tra.12370.
[21] P.L.M.& K.P.C. Dimple Bansal, Katsuya Miyake, Steven S. Vogel, Se´verine
Groh, Chien‐Chang Chen, Roger Williamson, Defective membrane repair
in dysferlin‐deficient muscular dystrophy, Nature. 423 (2003) 1–5.
doi:10.1038/nature01604.1.
[22] J.P. Kerr, C.W. Ward, R.J. Bloch, Dysferlin at transverse tubules regulates
Ca2+ homeostasis in skeletal muscle, Front. Physiol. 5 MAR (2014) 1–5.
doi:10.3389/fphys.2014.00089.
[23] A. de Morree, B. Flix, I. Bagaric, J. Wang, M. van den Boogaard, L. Grand
Moursel, et al., Dysferlin regulates cell adhesion in human monocytes, J.
Biol. Chem. 288 (2013) 14147–14157. doi:10.1074/jbc.M112.448589.
[24] A. Sharma, C. Yu, C. Leung, A. Trane, M. Lau, S. Utokaparch, et al., A new
role for the muscle repair protein dysferlin in endothelial cell adhesion and
17
angiogenesis, Arterioscler. Thromb. Vasc. Biol. 30 (2010) 2196–2204.
doi:10.1161/ATVBAHA.110.208108.
[25] E.N. Pesciotta, S. Sriswasdi, H.Y. Tang, D.W. Speicher, P.J. Mason, M.
Bessler, Dysferlin and other non‐red cell proteins accumulate in the red cell
membrane of Diamond‐Blackfan anemia patients, PLoS One. 9 (2014)
e85504. doi:10.1371/journal.pone.0085504.
[26] C.T. Lang, K.B. Markham, N.J. Behrendt, A.A. Suarez, P. Samuels, D.D.
Vandre, et al., Placental dysferlin expression is reduced in severe
preeclampsia., Placenta. 30 (2009) 711–718.
doi:10.1016/j.placenta.2009.05.008.
[27] R. Varga, M.R. Avenarius, P.M. Kelley, B.J. Keats, C.I. Berlin, L.J. Hood, et
al., OTOF mutations revealed by genetic analysis of hearing loss families
including a potential temperature sensitive auditory neuropathy allele., J.
Med. Genet. 43 (2006) 576–581. doi:10.1136/jmg.2005.038612.
[28] R. Varga, P.M. Kelley, B.J. Keats, a Starr, S.M. Leal, E. Cohn, et al., Non‐
syndromic recessive auditory neuropathy is the result of mutations in the
otoferlin (OTOF) gene., J. Med. Genet. 40 (2003) 45–50.
doi:10.1136/jmg.40.1.45.
[29] S. Marlin, D. Feldmann, Y. Nguyen, I. Rouillon, N. Loundon, L. Jonard, et
al., Temperature‐sensitive auditory neuropathy associated with an
otoferlin mutation: Deafening fever!, Biochem. Biophys. Res. Commun. 394
(2010) 737–742. doi:10.1016/j.bbrc.2010.03.062.
[30] I. Roux, S. Safieddine, R. Nouvian, M. Grati, M.C. Simmler, A. Bahloul, et
al., Otoferlin, Defective in a Human Deafness Form, Is Essential for
Exocytosis at the Auditory Ribbon Synapse, Cell. 127 (2006) 277–289.
doi:10.1016/j.cell.2006.08.040.
[31] M. Padmanarayana, N. Hams, L.C. Speight, E.J. Petersson, R.A. Mehl, C.P.
Johnson, Characterization of the lipid binding properties of otoferlin
reveals specific interactions between PI(4,5)P2 and the C2C and C2F
Domains, Biochemistry. 53 (2014) 5023–5033. doi:10.1021/bi5004469.
[32] D.B. Davis, A.J. Delmonte, C.T. Ly, E.M. McNally, Myoferlin, a candidate
gene and potential modifier of muscular dystrophy., Hum. Mol. Genet. 9
(2000) 217–226. doi:ddd030 [pii].
[33] M. Inoue, Y. Wakayama, H. Kojima, S. Shibuya, T. Jimi, H. Oniki, et al.,
Expression of myoferlin in skeletal muscles of patients with
dysferlinopathy, Tohoku J. Exp. Med. 209 (2006) 109–116.
doi:JST.JSTAGE/tjem/209.109 [pii].
[34] K.R. Doherty, A. Cave, D.B. Davis, A.J. Delmonte, A. Posey, J.U. Earley, et
al., Normal myoblast fusion requires myoferlin., Development. 132 (2005)
18
5565–75. doi:10.1242/dev.02155.
[35] K. Rochlin, S. Yu, S. Roy, M.K. Baylies, Myoblast fusion: When it takes
more to make one, Dev. Biol. 341 (2010) 66–83.
doi:10.1016/j.ydbio.2009.10.024.
[36] K.R. Doherty, A.R. Demonbreun, G.Q. Wallace, A. Cave, A.D. Posey, K.
Heretis, et al., The endocytic recycling protein EHD2 interacts with
myoferlin to regulate myoblast fusion, J. Biol. Chem. 283 (2008) 20252–
20260. doi:10.1074/jbc.M802306200.
[37] K.C. Lenhart, A.L. Becherer, J. Li, X. Xiao, E.M. McNally, C.P. Mack, et al.,
GRAF1 promotes ferlin‐dependent myoblast fusion, Dev. Biol. 393 (2014)
298–311. doi:10.1016/j.ydbio.2014.06.025.
[38] B. Cai, S. Xie, S. Caplan, N. Naslavsky, GRAF1 forms a complex with
MICAL‐L1 and EHD1 to cooperate in tubular recycling endosome
vesiculation., Front. Cell Dev. Biol. 2 (2014) 22. doi:10.3389/fcell.2014.00022.
[39] D. Song, G. Ko, J. Lee, J. Lee, G. Lee, H. Kim, et al., Myoferlin expression in
non‐small cell lung cancer: Prognostic role and correlation with VEGFR‐2
expression, Oncol. Lett. (2015) 998–1006. doi:10.3892/ol.2015.3988.
[40] P.N. Bernatchez, A. Sharma, P. Kodaman, W.C. Sessa, Myoferlin is critical
for endocytosis in endothelial cells., Am. J. Physiol. Cell Physiol. 297 (2009)
C484–C492. doi:10.1152/ajpcell.00498.2008.
[41] A. Turtoi, A. Blomme, A. Bellahce??e, C. Gilles, V. Hennequier??e, P.
Peixoto, et al., Myoferlin is a key regulator of EGFR activity in breast
cancer, Cancer Res. 73 (2013) 5438–5448. doi:10.1158/0008‐5472.CAN‐13‐
1142.
[42] C. Leung, C. Yu, M.I. Lin, C. Tognon, P. Bernatchez, Expression of
myoferlin in human and murine carcinoma tumors: Role in membrane
repair, cell proliferation, and tumorigenesis, Am. J. Pathol. 182 (2013) 1900–
1909. doi:10.1016/j.ajpath.2013.01.041.
[43] T. Xia, S. Chen, Z. Jiang, Y. Shao, X. Jiang, P. Li, et al., Long noncoding
RNA FER1L4 suppresses cancer cell growth by acting as a competing
endogenous RNA and regulating PTEN expression., Sci. Rep. 5 (2015)
13445. doi:10.1038/srep13445.
[44] B. Yue, B. Sun, C. Liu, S. Zhao, D. Zhang, F. Yu, et al., Long non‐coding
RNA Fer‐1‐like protein 4 suppresses oncogenesis and exhibits prognostic
value by associating with miR‐106a‐5p in colon cancer, Cancer Sci. 106
(2015) 1323–1332. doi:10.1111/cas.12759.
[45] A.D. Posey, K.E. Swanson, M.G. Alvarez, S. Krishnan, J.U. Earley, H. Band,
et al., EHD1 mediates vesicle trafficking required for normal muscle
growth and transverse tubule development, Dev. Biol. 387 (2014) 179–190.
19
doi:10.1016/j.ydbio.2014.01.004.
[46] A.D. Posey, P. Pytel, K. Gardikiotes, A.R. Demonbreun, M. Rainey, M.
George, et al., Endocytic recycling proteins EHD1 and EHD2 interact with
Fer‐1‐like‐5 (Fer1L5) and mediate myoblast fusion, J. Biol. Chem. 286 (2011)
7379–7388. doi:10.1074/jbc.M110.157222.
[47] S. Ledig, A. Röpke, P. Wieacker, Copy number variants in premature
ovarian failure and ovarian dysgenesis, Sex. Dev. 4 (2010) 225–232.
doi:10.1159/000314958.
[48] S. Helfmann, P. Neumann, K. Tittmann, T. Moser, R. Ficner, E. Reisinger,
The crystal structure of the C 2A domain of otoferlin reveals an
unconventional top loop region, J. Mol. Biol. 406 (2011) 479–490.
doi:10.1016/j.jmb.2010.12.031.
[49] N.J. Marty, C.L. Holman, N. Abdullah, C.P. Johnson, The C2 domains of
otoferlin, dysferlin, and myoferlin alter the packing of lipid bilayers,
Biochemistry. 52 (2013) 5585–5592. doi:10.1021/bi400432f.
[50] A. Lek, M. Lek, K.N. North, S.T. Cooper, Phylogenetic analysis of ferlin
genes reveals ancient eukaryotic origins, BMC Evol. Biol. 10 (2010) 231.
doi:10.1186/1471‐2148‐10‐231.
[51] M. Wang, M. Weiss, M. Simonovic, G. Haertinger, S.P. Schrimpf, M.O.
Hengartner, et al., PaxDb, a Database of Protein Abundance Averages
Across All Three Domains of Life, Mol. Cell. Proteomics. 11 (2012) 492–500.
doi:10.1074/mcp.O111.014704.
[52] M. Uhlén, L. Fagerberg, B.M. Hallström, C. Lindskog, P. Oksvold, A.
Mardinoglu, et al., Tissue‐based map of the human proteome, Science (80‐.
). 347 (2015) 1260419–1260419. doi:10.1126/science.1260419.
[53] M.C. Wu, P. Kraft, M.P. Epstein, D.M. Taylor, S.J. Chanock, D.J. Hunter, et
al., Powerful SNP‐Set Analysis for Case‐Control Genome‐wide Association
Studies, Am. J. Hum. Genet. 86 (2010) 929–942.
doi:10.1016/j.ajhg.2010.05.002.
[54] R. Petryszak, M. Keays, Y.A. Tang, N.A. Fonseca, E. Barrera, T. Burdett, et
al., Expression Atlas update‐an integrated database of gene and protein
expression in humans, animals and plants. TL ‐ 44, Nucleic Acids Res. 44
VN‐r (2016) 52. doi:10.1093/nar/gkv1045.
[55] L.I. Volakis, R. Li, W.E. Ackerman IV, C. Mihai, M. Bechel, T.L.
Summerfield, et al., Loss of myoferlin redirects breast cancer cell motility
towards collective migration, PLoS One. 9 (2014).
doi:10.1371/journal.pone.0086110.
20
Chapter 2 ‐ Characterization of Fer1L6 in a Zebrafish
Model
Contributing Authors: Chelsea Holman, Josephine Bonventre, Sara Codding,
Paroma Chatterjee, Robert Tanguay, Colin Johnson
2.1 – Introduction
Fer1L6 is a predicted protein coding gene found in a wide range of
vertebrate genomes, with unknown physiological function. This gene belongs to
the ferlin gene family, which code for ~200KDa membrane bound proteins
believed to be involved in calcium sensitive membrane trafficking events[1]. Of
the six mammalian ferlin genes, four have been extensively studied, and are
linked to a variety of human diseases, including muscular dystrophy for
dysferlin, non‐syndromic deafness for otoferlin, cancer metastasis for myoferlin,
and cancer cell growth and proliferation for Fer1L4[2–5]. The link between
ferlins and human disease motivates studies to improve our understanding of
ferlin protein function, and the characterization of unstudied ferlins, including
Fer1L6 gene.
One of the most effective ways of determining the physiological function
of an uncharacterized gene is through reverse genetics. That is, looking for
phenotypic consequences upon removal or downregulation of the gene.
Techniques, including production of mutant or null in vivo models, siRNA, or
morpholinos, are typically utilized to reduce the expression of a targeted
gene[6][7]. Danio rerio, the zebrafish, has become an ideal vertebrate model for
reverse genetics. The genetic diversity, ovuliparity breeding, transparent
anatomy during early developmental stages, relatively short maturation time,
21
and maintenance cost all make zebrafish the ideal model for an exploratory
reverse genetic analysis of Fer1L6.
Four ferlin paralogues have been identified in the zebrafish genome.
They are dysferlin, otoferlin, myoferlin, and the uncharacterized Fer1L6 gene[8].
No homolog to the mammalian Fer1L4 and Fer1L5 genes can be found.
However, there are two minimally divergent copies of both the otoferlin and
myoferlin genes, due to a whole genome duplication event which occurred in a
common ancestor of zebrafish and pufferfish[9]. Only one predicted Fer1L6
gene exists in zebrafish, which simplifies the use of zebrafish as a model for this
study. Bioinformatics analysis shows significant amino acid sequence similarity
between Fer1L6 in zebrafish, humans, and mice (Figure 2.1). While the full
length protein shares only 59% identity between humans and zebrafish, the
functional C2 domains are significantly more similar, with between 68 and 87%
identity. This suggests that Fer1L6 functions in a similar manner in both
zebrafish and mammals, further supporting the choice of a zebrafish model.
Therefore, this study uses two reverse genetic techniques, morpholino
microinjection and a mutant Fer1L6 zebrafish line to gain identify the
physiological role of Fer1L6 in the zebrafish model with the aim of elucidating
function across vertebrates.
2.2 – Methods
Husbandry
All gene expression and morpholino work was performed with wild type
tropical 5D zebrafish (D. rerio). The Fer1L6 fish line was crossed and compared
against a wild type AB strain. All protocols and husbandry were performed at
the Sinnhuber Aquatic Research Laboratory, at Oregon State University in
22
accordance with Institutional Animal Care and Use Committee protocols.
General fish strain maintenance and breeding were performed as previously
described [10]. Adult fish were maintained in a 14:10 light:dark schedule on a
recirculating water system at 28°C.
q‐PCR
RNAzol (Molecular Research Center, OH) was used to extract total RNA
from tissue or whole zebrafish embryos according to manufactures’ protocol.
cDNA was synthesized using iScript DNA synthesis kit (Bio‐Rad, CA) or high‐
capacity cDNA reverse transcriptase kit (ThermoFisher, MA) according to
manufactures’ protocol. All q‐PCR was performed using Power Sybr‐green PCR
master mix (Applied Biosystems, CA) on a 7500 fast Real‐Time PCR System
(Applied Biosystems, CA). At least one set of primers (Sigma‐Aldrich, MO) were
designed for each gene of interest (Table 1).
whole‐mount ISH
In situ hybridization (ISH) was performed on 5D wt zebrafish embryos
using a DIG (digoxigenin) labeled RNA probe which hybridized to a unique
region of the Fer1L6 zebrafish mRNA (NW_001879462.3) as previously described
[11][12]. The probe was detected with anti‐DIG alkaline phosphatase conjugated
antibody and developed using either fast red or BCIP stain as previously
described [11].
Microinjections
All microinjections were performed as previously described at the
Sinnhuber Aquatic Research Laboratory, at Oregon State University [12]. All
23
microinjections were performed at a single cell stage using glass pulled needles.
Injected solutions were mixed with 3% phenol red dye in order to visualize
injected volume. Approximately 3pL of solution was injected. Fer1L6 splice
blocking morpholinos, p53 control morpholino, and standard control
morpholino (GeneTools, OR) were resuspended in RNAse‐free ultrapure water.
Electron microscopy
Zebrafish were fixed in 2.5% glutaraldehyde. Osmium staining was
performed as previously described using 1% osmium tetroxide and 0.8%
potassium ferricyanide (cite). Resin imbedding were performed using EMbed‐
812 (Electron Microscopy Sciences, PA) according to manufacturer protocol.
Ultramicrotomy sectioning was performed at 50nm using a diamond blade
microtome, and placed on copper PELCO formvar coated grids (TedPella, CA).
Imaging was performed on a FEI Titan 80‐20 TEM microscope at Oregon State
University.
Phalloidin Fluorescent microscopy
Zebrafish larvae were fixed in 4% paraformaldehyde for 12 hours at 4°C,
and then washed 3x in PBS. Tissue was permeobolized using 2% Triton X‐100 in
PBS for 90min, followed by 3x washes in PBS. Larvae were then incubated in
1:2,000 Phalloidin in PBS for 1hr at room temperature, followed by 3x washes in
PBST. They were then mounted on coverslips using a 1% agarose solution.
Imaging was performed on a custom made two‐photon dye‐specific offset
microscope with a 20x objective as previously described [13].
Fer1L6 null fishline development
24
Zebrafish 24hpf embryos from the sa16199 zebrafish line were obtained
from Zebrafish International Resource Center (ZIRC, OR). They were produced
through in vitro fertilization of wild type AB eggs with sa16199 cryopreserved
sperm. Larvae were raised to 120hpf in embryo media in large plastic dishes. At
120hpf, there were placed onto the water system described in husbandry. Adults
were anesthetized, and section of caudal fin was amputated for genotyping
purposes at 3 months of age using custom Vic‐Fam genotyping taq‐man q‐PCR
assay (Applied Biosystems, CA) according to manufacturer’s protocol. All
subsequent spawning was performed by placing males and females in a
spawning basket in the evening with a small amount of mesh to create a shallow
environment eggs were collected 2 hours into the follow day’s light cycle.
Adults are given at least two weeks between spawnings.
2.3 – Results
2.3.1 ‐ Expression of Fer1L6 in zebrafish
Before reverse genetic approaches could be utilized as an approach to
Fer1L6 characterization, we first sought to verify Fer1L6 expression in zebrafish.
Two important aspects of expression needed to be explored: timing of expression
and tissue specification. In order to use morpholinos, it was vital to establish
that there was expression within the first four days of development, as
morpholino efficacy decreases dramatically due to a dilution effect through cell
division during development. Using whole embryo RNA extraction, we found
Fer1L6 expression starting at 24hrs post fertilization and continuing through the
first five days (120 hpf) of development using reverse transcription q‐PCR
(Figure 2.1). The expression levels are steady for the first two days (48 hpf),
followed by a slight increase to a new steady state for days three through five.
25
Due to the lack of a functional Fer1L6 antibody for zebrafish, whole
mount in situ hybridization was used to establish localization of the observed
expression through the first five days of development. At 24 hpf, there is
relatively even distribution of Fer1L6 throughout the embryo (Figure 2.2). At 48
and 72 hours post fertilization, a distinct increase in expression in the head and
brain area is observed. By 96 hours post fertilization the larvae have Fer1L6
expression localized to the brain, gut, and gonad area with some staining still
visible at the tips of the elongating fins. This is more easily distinguishable
under the florescent development agent fast red (Figure 2.2). The change in
expression localization suggests ubiquitous or at least multi tissue type
expression with may be associated with differentiation of various tissues
throughout the first five days of development.
2.3.2 – Morpholino knock down
Having characterized the expression profile of Fer1L6 in zebrafish, we
next sought to knockdown Fer1L6 expression by injecting morpholinos at the
single cell stage. These splice blocking morpholinos prevent excession of an
intron during mRNA processessing, resulting in early chain termination (Figure
2.3). Two different morpholinos localizing to different intron exon junctions
were used to knockdown Fer1L6.
The level of transcript knockdown (KD) was quantified using q‐PCR. This
showed a maximum 80% reduction in Fer1L6 transcription (Figure 2.5).
Increasing the morpholino concentration any further resulted in increased
lethality, but not decreased expression (Figure 2.6). Therefore, 2.25 pmols was
used for all following experiments. Both morpholinos showed identical curved
tail phenotypes, similar to that observed in previous dysferlin morpholino
26
studies (Figure 2.4)[14]. The lowest concentration of morpholino presented with
a slight hunch back, but as morpholino concentration increased, the curve in the
tail region became more pronounced and began curving to the side, similar to the
positioning of the embryo in the corion.
Many morpholinos have been shown to have off target effects, many of
which result in p53 pathway activation and subsequent apoptosis related
phenotypes. The knockdown of both p53 and the gene of interest removed any
of these p53 linked phenotypes, making it easier to differentiate between on
target and p53 linked off target phenotypes. To confirm that our phenotype was
not related to the common p53 pathway mutations, the Fer1L6 morpholino was
coinjected with standardized p53 morpholino. The simultaneous knockdown of
Fer1L6 and p53 showed no change in phenotype under brightfield, suggesting
that this observed phenotype is not linked to p53 apoptotic effects [15]. The
presence of similar phenotypes for two different Fer1L6 morpholinos and the p53
control combined to produce enough confidence in the phenotype to move
forward with more thorough phenotypic characterization.
Due to the similarity in phenotype between the Fer1L6 and dysferlin
morphants, and the suggestion by Doherty et al. that Fer1L6 is found in C2C12
cells, the anatomy of the tail skeletal muscle was further scrutinized[16][14].
Using phalloidin staining and two‐photon microscopy, a distinct disorganization
is seen in the developed skeletal muscles at 96hpf in KD compared to WT (Figure
2.8). The KD muscle shows disorganization of the myofibrils within each
segment of skeletal muscle tissue. Further, while the control tissue has highly
regular parallel myofibril bundles, the knock down myofibrils appear less
distinct and are not parallel with each other (Figure 2.8). Additionally, the
myoseptum is irregular, tissue equivalent to the linea alba in mammals. The
27
horizontal myoseptum is practically nonexistent, and the vertical myosepta are
present but malformed.
Osmium stained transmission electron microscopy (TEM) was used to
investigate possible causes of this skeletal muscle phenotype (Figure 2.8).
Analysis of TEM images revealed an increase in vesicle accumulation and miss‐
trafficking of membrane at the sarcoplasmic reticulum in KD larvae. This is
similar to dysferlin null skeletal muscle which shows accumulation of unfused
vesicles at the sarcolemma during wounding [17]. In addition to sarcoplasmic
reticulum disruption, the t‐tubules are not overtly visible. Based on the median
plane microtome sections, the t‐tubule appears as a dark dot at the intersection of
the Z line and sarcoplasmic reticulum. This formation is missing from many
places in the knock down sections.
Both morpholinos shows the presence of a cardiac effusion, where fluid
builds up in the sac around the heart, or generalized pericardial edema, where
there is less specific fluid buildup in the organ cavity near the heart (Figure 2.9).
This created an impetus to better characterize heart development. While the final
structure of the zebrafish heart contains two chambers compared to the
mammalian four, the development processes are highly similar. The heart is the
first functional organ to develop in zebrafish [18]. This process starts when cell
progenitors for endocardial, atrial, and ventricular cells are specified. These
progenitors then migrate to the anterior lateral plate mesoderm (ALPM), where
they differentiate and then fuse to form a cone shaped structure. Next, the
myocardium envelops the endocardium to form the heart tube. The heart tube
then forms a hook like structure, placing the ventricle on the anterior‐right and
the atrium on the posterior‐left [19]. Over the next few days, the myocardium
cells lengthen and change shape, to produce a ballooning effect on the chambers.
28
This process is believed to be controlled both by sarcomere function and blood
flow through the heart [20]. Finally, as the chambers continue to grow, internal
structures such as the valves and atrioventricular canal develop [19].
We sought to characterize this developmental process in the Fer1L6
morphants. First, we measured heart rate, and saw a significant decrease in
heart rate for the knock down larvae at 96hpf, even when including larvae which
showed trunk and tail phenotypes, but no edema (Figure 2.9). Second, using a
myosin heavy chain antibody (MF20) the hearts were imaged at 96hpf using
confocal microscopy (Figure 2.9). Analysis of the images revealed that while the
knock down larvae participates in myotube formation, the heart has not
ballooned. Taken together these results indicated that Fer1L6 appears to
contribute to both skeletal and cardiac muscle (striated muscle).
2.3.3 – Fer1L6 mutant fish line
Recent studies have indicated that morpholino off target effects are much
more prevalent than previously thought [21]. Additionally, there has recently
been an greatly increased availability of mutant zebrafish lines, due to large scale
ENU‐mutation and TILLING projects [22]. Therefore, when an uncharacterized
Fer1L6 mutant zebrafish line became available, we chose to supplement and
confirm the Fer1L6 morpholino data with a mutant zebrafish line. This line
allows for the study of Fer1L6 removal during all stages of development, and is
vital to studying the possibility of Fer1L6 involvement in fertility. The Fer1L6
mutant line used for this study is sa16199 from the Stemple lab at the Wellcome
Trust Sanger Institute (Cambridge, UK). Sa16199 carries a nonsense C to T
mutation which results in a stop codon after 140 amino acids (Table 2.2). This
position correlates to the linker region between C2B and C2C.
29
The G0 male fish was produced by the Stemple lab through high
throughput chemical mutagenesis using 1‐ethyl‐1‐nitrosourea (ENU) against a
Tubingen Long Fin (TL) zebrafish background strain[23][22]. Treated males
were crossed with wild type females, and their progeny were sequenced for
desired mutations. Once mutations were identified, sperm was cryopreserved
for future studies. Zebrafish International Resource Center (ZIRC, Eugene, OR),
maintains cryo‐stocks from the ENU treatment that have been outcrossed to an
AB zebrafish background through in vitro fertilization.
Zebrafish embryos produced through in vitro fertilization of heterozygous
sa16199 sperm and wild type AB females were ordered from ZIRC, and
maintained until fish were at spawning age (~4 months). Fin clip DNA extraction
followed by genotyping for the C to T mutation show 4 of the 7 remaining adults
were heterozygous. They displayed no discernable phenotype at any stage of
development. It is not possible to track how many times the line had been
crossed during maintenance at ZIRC, we chose to call these original fish from
ZIRC J1 to distinguish them from the F generation series originating from the
Stemple lab. The three heterozygous females and one male J1s, were spawned to
produce the J2 generation, which again presented with no obvious phenotype at
any stage of development. J2s were genotyped, and produced 33.7%
homozygous wild type, 57.9% heterozygous, and 8.4% homozygous mutant
(Figure 2.10). This is statistically different from expected Mendelian inheritance
distributions of 25% homozygous wild type, 50% heterozygous, and 25%
homozygous mutant. Errors in founder genotype could results in skewed ratios,
however a second round of genotyping confirmed the original identification. All
8 of our surviving homozygous mutant adults were male.
30
In an effort to increase our population of homozygous mutants, and
obtain female homozygous mutants, heterozygous J2 females were crossed with
the homozygous mutant J2 males to create J3 progeny. This generation, now at
two months of age, does not display any discernable abnormal phenotype.
Additionally, a subset of J3 embryos were sacrificed at 48hpf for genotyping, and
were 59% heterozygous and 41% wild type mutant, not statistically different
from Mendelian inheritance rates (Figure 2.10). Spawning of homozygous
mutant J3s is necessary to determine if this is a truly null line.
2.4 – Discrepancies between morpholino and fish line results
With the increased availability of mutant zebrafish line production
through CRISPR cas‐9 technology and increased use of TILLING, it has recently
become apparent that morpholino knock down phenotypes and mutant knock
out zebrafish line phenotypes often do not correlate. In fact within the last two
years, that has been a call by the greater zebrafish community to eliminate use of
morpholinos in favor of mutant fish lines[24]. The primary issues is the
prevalence of non‐specific off target effects. While some of these can be
identified through techniques such as p53 suppression or use of multiple
morpholinos as done in this work, this does not eliminate all possible issues. As
new technologies become available, it is important for the research community to
adjust their methodologies to reflect the most accurate information and
techniques of the time. With this in mind, the production of the mutant zebrafish
line served as a valid and possibly necessary control for the phenotype
characterization carried out with the morpholino knock down embryos.
Discouragingly, the first generation of knock outs showed no curved trunk and
tail phenotype. This creates a situation in which further characterization of both
31
the knock down and knock out is necessary, in order to rule out any artifact
results.
In addition to the p53 control experiment, a common method of
verification is a rescue experiment, in which the gene of interest in co‐injected
with the morpholino and a recombinant version of the gene either via
synthesized mRNA or a zebrafish promoter containing plasmid. Due to the
200KDa size of the Fer1L6 gene, synthesis of mRNA was too difficult. Therefore,
a construct containing the back half of the human Fer1L6 protein, form the C2D
domain through the C‐terminal transmembrane domain was produced in a
plasmid containing a muscle specific promoter. It was predicted that a truncated
version of the human protein would rescue, as the same truncated form of mouse
otoferlin is sufficient for rescue experiments of otoferlin morpholino double
knock down in zebrafish [12]. However, this construct proved to be toxic at even
extremely low concentrations. It is possible that the human homolog of Fer1L6 is
not functional in zebrafish, or that expression levels using this non‐indigenous
promoter created expression profiles which were detrimental to development of
the embryo. Therefore, it was not possible at this stage to carry out a rescue
control of our Fer1L6 morphants.
One of the most comprehensive studies of this poor correlation between
morphant and mutant phenotypes was from Kok et al. in 2015[21]. The group
produced mutant zebrafish lines for 24 genes previously identified as necessary
for development based on morpholino techniques, and also performed a
comprehensive analysis of phenotypic data available on the ZFIN and Sange
ZMP databases[21][23]. The results showed even lower than expected
correlation between morphant and mutant phenotypes. Of the 24 genes the
group produced mutants for, only three displayed phenotypes similar to the
32
previously published morphant. Through the literature analysis, only 24 genes
has well characterized morphant and mutant embryos, and only five of these
showed similar phenotypes between the two methods. Taking the two datasets
together, the group also investigated if including specific controls improved the
correlation. Addition of titration, p53, or multiple MOs, and rescue did not
improved correlation rates. In fact, nearly 80% of the mutants analyzed
displayed no phenotype at all[21]. Some studies have suggested that this
missing phenotype can be caused by residual maternal mRNA which is passed to
the developing embryo[25]. However, after adjusting the data set to analyze
only embryos produced through crossing of homozygous mutants, the
correlation improvement was negligible[21]. These findings confirm that MOs
are not the ideal technology that the zebrafish community hoped they would be,
and that mutant zebrafish lines will need to be used as the gold standard moving
forward.
2.5 – Discussion
Fer1L6 is expressed at the mRNA level in a wide range of tissues as early
as 24hpf. ISH results showing wide ranging expression in many different tissues
is consistent with human proteomic results from the human protein atlas project
[26]. The
expression of Fer1L6 early in development suggests that Fer1L6 may be
important in development, similar to the role of myoferlin [27]. Based on EM
imaging it is possible that Fer1L6 is necessary for proper formation or
maintenance of sarcoplasmic reticulum. T‐tubule is also missing or
underdeveloped. As major calcium related organelles, this hypothesis would
correlate with Fer1L6’s proposed role in calcium sensitive membrane trafficking.
33
Fer1L6 mutant zebrafish line did not always have predicted Mendelian
inheritance or 50/50 sex ratios. A possible explanation for the discrepancy in
genotype‐ratios may be the presence of additional lethal mutations, as ENU
mutagenesis could lead to multiple mutations. If alternate lethal mutations are
present on the same chromosome, the eight surviving homozygous mutants may
have survived as a result of favorable homologous recombination. The parental
F1 fish were developed using ENU based mutagenesis, so high prevalence
undesired mutations is expected for the first few generations. The genetic
bottleneck of our founder generation, 3 females and 1 male, may also have
contributed to poor ratios.
In terms of the sex ratios, natural strains of zebrafish, such as WIK and
EKW, have been shown to have sex linked genes on a region of chromosome 4,
which can be used to determine sex [28][29]. However, even for these strains,
genetic females do not always develop into females. The AB and TU strains, from
which the Fer1L6 mutant line was developed, do not have any known sex linked
region in their genomes [28]. Sex differentiation of these lines is not fully
understood, and has been shown to be based on a combination of genetics,
environmental stimuli, and chemical exposure. With all strains, development of
males is due to oocyte death between 19 to 27 days post fertilization, a process
that can be triggered by either genetic coding or environmental stress, and can
result in a disproportionate sex ratio[30]. Notably, our J2 heterozygous
population was also disproportionately male, indicating that there could be some
common factor driving the population toward males. However, the water
conditions and temperature are not to blame, as other tanks on the same system
were not male dominated.
34
Any discrepancies from undesired mutations or population bottleneck
will be removed as the line moves through the generations. The J4 generation
will be produced from large numbers of ‐/‐ males and female, and therefore will
have more genetic diversity and no maternal mRNA. At this point, it will be
important to determine if there is any residual Fer1L6 mRNA. If none is
detected, this will be the first Fer1L6 null in vivo model ever produced.
35
2.6 – Figures and Tables
Figure 2.1 Fer1L6 structure
Schematic of predicted structure for Human Fer1L6, based on sequence
alignment to other ferlins. C2 domains are represented by ovals, and the single
pass transmembrane domain by a rectangle. The percent identity to the human
Fer1L6 amino acid sequence is shown for each C2 domain in the mouse and
zebrafish sequences. Overall there is 88% and 59% identity with the mouse and
zebrafish respectively. Percent identity was determined using clustalW [31].
36
Figure 2.2 – Fer1L6 expression during zebrafish development
Expression of Fer1L6 in whole embryo zebrafish through the first 5 days of
development. For each day, a ratio of Fer1L6 to beta‐actin ratio was determined.
The ratios were subsequently normalized to 24hpf, which was set to 1 and
relative expression levels (RQ) were analyzed for each following day. Based on
t‐test, 72hpf through 120hpf five are statistically higher than day one. Error bars
represent standard deviation with n=3. (***p < 0.001, ****p < 0.0001).
37
Figure 2.3 – ISH of Fer1L6 in zebrafish
In situ hybridization of wild type zebrafish embryos at 24 to 96hpf. At the early
time point of 24hpf, there is expression at low levels throughout the embryo
relative to negative control (upper right panel). At 48 and 72hpf, expression
becomes more pronounced in the head region. At 96hpf, there is a large amount
of expression in the head and body cavity where organ systems are developing,
with additional pronounced expression at the tip of the elongating fins. This is
more easily seen using fast red fluorescent developer (shown in bottom panel at
96hpf).
38
Figure 2.4 – Fer1L6 splice blocking morpholinos.
The two morpholinos to Fer1L6 are designed to prevent splicing between an
intron‐exon junction, and thus retain that intron creating an early stop codon,
either through a stop codon present in the intron or by causing a frame shift in
the downstream exon. Morpholino 1 targeted intron 14 with a sequence of
CTCCCTCTTCCTGACAAACATAAAA and morpholino 2 targeted intron 2 with
a sequence of AGCCTCTATCGTGTAACGATTAAAC. Both products resulted in
mRNA molecules that if translated would be missing the majority of function C2
domains and the transmembrane domain necessary for localization. Gene is
written 5’ to 3’. Rectangles represent exons and lines represent introns.
39
Figure 2.5 – Morpholino phenotype
Representative brightfield images of morpholino injected embryos at 48 hours
post fertilization compared to uninjected and control morpholino. Both
morpholino 1 (MO1) and morpholino 2 (MO2) show increasing severity of
phenotype with increasing amount of microinjected morpholino. Phenotype
includes curved trunk and tail, pericardial effusion, localized edema, and smaller
eyes at very high concentrations. P53 co‐injected morphants show the same
phenotype as MO1 and MO2 injected.
40
Figure 2.6 – Fer1L6 knockdown quantitation
Quantitation of Fer1L6 morpholino knockdown at 48hpf under increasing
amounts of Fer1L6 morpholino knockdown. Fer1L6 was normalized to beta
actin for each concentration. Samples were then normalized to, the random
sequence morpholino control (denoted as 0 pmol on graph). Maximum
knockdown occurred at 2.25 (80%), with higher concentrations not increasing the
knockdown. Error bars represent standard deviation with an n=5.
41
Figure 2.7 – Survival and phenotype rates
Phenotype and survival rates for MO1 titration compared to a control
morpholino. N=92‐109 because unfertilized eggs and embryos that died within
four hours of injection were removed from count. 2.25pmol was sufficient to
have nearly all surviving embryos display a phenotype.
Survival and Phenotype Ratios
Injected amount of morpholino (pmol)
contro
l0.
75 1.5
2.25 3.
00
20
40
60
80
100
deathphenotypeno phenotype
42
Figure 2.8 ‐ Morpholino knockdown results in abnormal skeletal muscle.
A.) 96hpf larvae stained with Phalloidin indicates disordered myofibrils and
segmentation. In addition, the myoseptum (chevron‐shaped tendon structure) is
Scale bar is 35.8um. B.) Transmission electron microscopy of osmium staining
skeletal muscle sections. A and I band patterning is severely disrupted by
accumulation of disordered sarcoplasmic reticulum. Additionally, well defined
43
t‐tubule structures are missing in the knockdown sections, as indicated by red
arrow. Scale bar is 0.5um.
Figure 2.9 ‐ Cardiac related phenotype
A.) Brightfield image of sever pericardial effusion in Fer1L6 knock down larvae
at 96hpf. B.) heart rate comparison of control vs. knock down 96hpf larvae
shows statistically decreased heartrate (***p<0.001, n=23) Error bars represent
standard deviation. C.) Immunostaining of sarcomere myosin in 96hpf zebrafish
zebrafish hearts. Knock down animals show delayed development of distinct
atrium and ventricle compartmentalization.
44
Figure 2.10 – Genotype rates of Fer1L6 mutant
Genotyping analysis of generation J1, J2, and J3 zebrafish created from the
sa16199 line[23]. J1 is founder fish produced from in vitro fertilization of ‐/+
sperm and +/+ eggs. J3 was produced from ‐/+ females spawned with ‐/‐ males.
Exterior circle depicts observed proportions, and interior circle depicts expected
proportions based on Mendelian inheritance. F3 distribution was divergent with
expected 25/50/25 results based on Mendelian inheritance (P<0.001). F2 and F4
had no statistically significant divergence based on binomial tests, (P>0.1).
45
Target
Gene
Forward sequence Reverse sequence
Fer1L6 CACATTGCCCTCATGTTTG AGCCTCTTTTTGTCCAGCAA
Dysferlin AGAGACCTGCTGGCTATGGA AGGGCTCCTCTCAGTCACA
A
Myoferli
n
ATTGAAGGCTGGCTTGAGAA CATGCCTGCTCACAGTAGG
A
B‐actin AAGCAGGAGTACGATGAGT
C
TGGAGTCCTCAGATGCATTG
Table 2.1
Primers used for q‐PCR quantitation.
46
A.
>Fer1L6_Zebrafish(ENSDART00000056105.6) ATGGACCAAGATAAAGACAGCTCTGCACCCCATGGTAGCAAGAAGTTTGGAATAAAAGTAAAGAAGAAACATCGGAAAGGACACAAGGGTGTTGTAATCTCAAACAAAGGTGCTCTAGACACGATAGAGGCTGAGGCTGAAACTAATCCTGAAGATCCAGACGTGATAGATGTACCACAGCCCGAGTTTGCAGGACAGTCCACCTCGGCCCACACTTCTTTCAGACAGATTGCCAATACTAAGAGATGTAAAGCTGTATCCAAGATCTTGGAAGGTGAAAGCAAACCACAAAATTTCCAGATTTCCATCAATATAACAGAGATCAGGCAGCTGGTTGGGGACAATATAGACCCTAGTGTTGTGATTGAAATTGGAGATGATAAAAAGCAGACATCGGTGAAAGAAGGAACCAACGCTCCCTTTTACAATGAGTATTTTGTGTTTGACATATATTGCAATCAAGACATCTTTTTTGACAAAGTCATTAAACTATCAGTCATGCACTCAAAGATTATGAAGAGCTACTGTGTGGGAACGTTCAAGATTGATGTTGGGACAGTTTACTCTCAACCTGGGCATCAGTTCATCAATAAGTGGGCCACACTAACAGACCCTGCCGACATCCGTGTTGGGGTGAAAGGTTACCTGAAGTGTGATATCAGTGTGTCTGGAAAGGGAGATGTTGCACCACCATCTCAGAAATTCAGTGATGCCGAGGAA[C/T]AAATTGATAAGCACCTCCTGCTTCCTGAAGGCTTAAACCCGGAGCGGCCGTGGGCTCGGTTTTATGTGATCGTGTACCGAGCAGAAGGTCTTCCCAGAATAAACTCCAGTATTATGGCCAATGTGACCAAAGCTTTTGTTGGAGACACAACAGCCCTCATTGATCCTTATGTTGAGGTGTCATTCTTTGGTCAAGTTGGAAGGACTTCAACCCAAAAGAGCTCAGCAGATCCAGTGTGGAATGAGCAGGTGGTGTTTAAGGAGATGTTTCCTCCACTGTGTCAGAGACTAAAGATTCGGGTTCTGGATGAAGGAAGCATGAATGATGTGGCCATTGGGACTCATTACATTGACCTGCACACCATATCAAATGACACTGATGGAGACAATGGTTTCTTGCCCACATTTGGGCCAGCCTGGATCAACCTCTATGGTTCTCTTCGAAATTCCACACTGGTGGATGACAGCCAGGAACTGAAC GAAGGTGTTGGTGAAGGGGTGTCCTACAGAGGCAGACTCTACATAGAGCTGAGTGTAGAAATCCTGTCTGGAGGAGCTGCTGAATCCAAATCTCTGCTCTCAAAGTTCAGTCCAAAAGATGCCAAGGGTGGGAAAACTGGTACAGGAGCAGGAGGTGAAGAGGAGAAGTCCAAGATGATAGGACCTGAAGTGATCCCAGTGGAGCCCCCGCAGAAGATGAGAGATGAAGACATGGAGACTTTCCTGCTCTTTGGTTGTGTATTTGAGGCATCCATGATCGACAGAAAAATTGGCGATAGACCAGTCACCCTAGAGTTTACGATTGGTAACTTTGGGAACTTAATTGATGGTGCTGCACCACCTCCATCAAAGAAGAAGCTTGAGGATGTGTCAGTGACTGCTCCTCTACTGGACACTACAGCCACAATGCCCTGCAAATCCACTACAACACCAGAAAGGCCTATTTTTGGAGATGCACAGAGGCATTATATGCATTTGCCCATCGCTGCACAGAAGCCCTGTGTGTATGTTTACAGTAGCTGGGAGGATCGAGCGTACCGACTTCATCACGCCAACATGCTAGACACAATTGCCCTCATGTTTGAAGAGGGAGTCGCTAAGGTCACAGAGCTGGATAAAATGTTATCTCCGGAAGCATGGAGTCTCATGCACCACGTTCTTCGGGAATTCAGACGAGATGCCAAGGAGTTTATTGCTTTTGCTGAAAAAAAGGTGAAGGGAAGCAATTTAACCTTGCTGGACAAAAAGAGGCTAACTATGTGCAAACAGGAGCTGGAGAGTATGACTGAAATGGCAGGAGGACTTCTTGAGCCAAAGAGGAGATCTTTGACTGTGAAAGAAATGCTGCTGGAAGCTCAAAAAATTAAAAAGAAGCTGCGATTTCTGGTGGAGGAGCCTCAACACACTTTACCAGATGTGTTTGTGTGTCTGGTCAGTAATAACAAGCGTGTGGCGTATGCCAGAATCCCTGCTCGGGACCTGCTCTTCTCAGAGAGCCCAGAGCAAAGAGGCAGAGACTGTGGGAAGATCAAGACACTGTTCCTCAAGCCTCCAGTGAAGCGTGCACCGGGATGGACTGTCCAGGCTAAACTTGATGTGTTCTTGTGGCTGGGAACTTGCGCAGAGTCATCCCGCATGTTGGACAATCTCCCGTCGGGCTTTGAACTTGTGTCCACCTCTTTTGAGGATAGGACTGGCGCTCCTCCTGAATATTTACTCTACACAGAGCAGCACATGTTCGAGCTGAGGGCTCATATGTACCAGGCTCGTGGACTCATCGCAGCAGACAACACTGGCCTCTCAGACCCGTTTGCCTGGGTGTCTTTTCTGTCTCATAGCCAATGCACTGGTATCATAAAGCAAACATTGACTCCCACGTGGAATCAGGTGATCAAGATGACTAACATGTCTCTATATGGAGGGCTTTACGACATAGCCCAGGAGCCACCGCTGATTGTGATTGAAGTGTATGATGATGATGCAGTGGGTAGCGAGTACCTGGGCTCGACGGTGGCTGTTCCTGTTGTCAAACTATCAGAAGAGCAATACTCTCCTCCTCAGCTGCAGTACAGCCCTCTGTTCTGTGGCAGCCTGTCTGGAGGAGACATACTGGGGGCCTTTGAGCTCATTCAGTCAGGAGAGCACTCACTCCCTGTTTTAGATGAGCCAGATGGAGTTGTTATCCCAGTGCCCTCATACATTCGACCGGTGCTCTGCAAGTACAGGATTGAGGTTTTGTTCTGGGGCCTCAGAGAACTGAAAAAGGTTCAGCTCTTATCTGTCGATCGTCCTCAAGTATTTATCAAGTGCGCAGGATCGGGTGTCAACTCCTCTGTCATACAAAGCTACAAGAAAAACCCGAACTTTACAATAATTGTGGACGCCTTTGATGTGGAGTTGCCTGAAGATGAACATCTCCTCCCTCCCCTCACTCTCACCGTGGTGGACTGGAGGGCCTTTGGGAGAAGCACGCTTGTAGGTAGTCATGTGATCAACAACCTGGCCTTATTCAAACACAATCCTGTACCGGTCCAGCAGCCCCCGCCAGAGCCCAAAAACATAGCAGTGGCTCAGCTCTCTCTGCAGCAGAGTGTTATTCCACCTCCAGATGAAGAGATCGCCATTGAAATAGAGCATGAGGAGATCATTGCCCCCAAAAGCCAAGAGCCTGAATTCCAGGACACAAAGCAAAGGGTGTCAAAAAAGAGCAAACGAAGATCTACAAAAAGGAAGAAACGCACCACGGCTGATGAGTCTGCAGATAATGTCATCGATTGGTGGTCGAAGTACTATGCATCGATGGAGAAAATCAAACAGGCAAAGCAAAAAGAAGACAATCCTTTTCCACTGCTCTTTGAAAATACATCAGGTATGAGGGATAGGAAAAAAGAGGTGAACTACAAGAGTGTGATTGAACAGCCCAGGCTTGCAACATTACAGGTGTACGACAAAGAGCTGGAGGCTGAATTTGGGCCATTTGATGACTGGGTAAAAACCTTTGAACTCTTTCGAGGAAAGGCCAATGAAGAGGACGGCTCTGCATATGAGAGATTTGTTGGG AAGTTCAAGGGCAGGTTCTGTCTTTACAAGCTGCCAGAAGCAGACGGTGAGGCGGAAGAAGGCTATGTGGATTCAGGGCAGTTTAAAATCAATCAGGGAATTCCTCCAAACACTGCTGTGAATGTCCTTATCCGTTCTCTTATGCATTTTAAGGCCTTCAACCTGCACCCTGCAGACCCAGATGGCAAAGCAGACCCTTACATAGTGCTGAAACTTGGGAAAACTGAGATCAAAGACAGAGACAATTACATCCCAAAGCAGCTCAACCCAGTGTTTGGAAGATCTTTTGAATTTCAAGCCACTTTTCCCAAAGAATCCCTACTAACAATCCTAATCTATGACTATGACCTGGTTGGTGGTGATGATTTGATTGGAGAAACACAGATCGATTTGGAGAACCGGTTTTACAGCAGACATCGAGCAACCTGCAGCCTTCCTACTGAATATGCCATTGAGGGTTATAATGCATGGAGGGACTGCATGAAGCCAGTAGACCTGCTGATTAAACTGTGTAAAGAAAACAGACTGGACAACCCTCAGTTTTCTCCAGGCCGTATTACCATCGGAAACAAAGTCTTTATGGGGAAAACGGTATTTCCAGATGAAGATCAAATGGTGGAGTCGTATGAACACTTGGCTCTCAAGGTGCTTCACAGGTGGTCTGAGATGCCCAACGGAGGCTGTAAACTTGTCCCAGAGCATATTGAAACT
47
CGCGCACTTTACCTCAAGGACAAACCAGGAATAGACCAGGGCCATTTGCAGATGTGGGTGGACATTTTTCCACTGGACATGCCTCACCCTGGCCCACCTGTGGACATTTCCCCTCGCAAACCTAAAGGGTATGAACTGAGAATCATTATCTGGAACACTGAAGATGTGATACTGGAGGACACCAACTTCATTACAGGACAGCAGTCAAGCGACATTTATGTTAAAGGGTGGTTAAAGGGTCTTGAAGATGACGGCCAGGAAACTGATGTCCATTACAATTCTTTGACTGGAGAGGGCAACTTCAACTGGCGCTTTGTGTTCCCCTTCAGCTACCTACCAGCTGAGAAAGTGGTAGTGGTACAAAAGCGAGAAAGCATCTACTCTCTGGACAAAACTGAACAGAAGATGCCTGCAGTTCTTGTTATGCAGGTGTGGGACTTTGAGCGGCTTTCCTCCGATGACTTTCTGGGCTCAGTGGAGTTGGATCTGCATGGGTTTCCTCGTGGAGCTAAATCAGCTAAAGCTTGTAAGATGGAAATGCTGACAGAACTCACAGAGAACATCTCTATCTTCCAGCAGAAACGCTCCAAAGGCTGGTGGCCCTTCATCAAAGCTGGAGAACTAACAGGAAAGGTAGAAGCTGAGTTTCACCTGGTCACTGCTGAGGAGGCTGAGAAAAACCCAGTGGGCCGCGCACGCAAAGAGCCAGAGCCTCTGGAGAAACCAAACCGTCCAGACACATCCTTCTCCTGGTTTATGAATCCTTTCAAGTGCTTCTTTCACCTGATCTGGGGAAACTACAAGAAATACATCATAGCTGGACTGGTGCTGTTGATTTTGACCTTGTTCCTGGTTCTGCTCTTTTACACCCTTCCAGGGGCGCTCAGTACTAAGATAGTCAATGGGTAA B. >Fer1L6_protein MDQDKDSSAPHGSKKFGIKVKKKHRKGHKGVVISNKGALDTIEAEAETNPEDPDVIDVPQPEFAGQSTSAHTSFRQIANTKRCKAVSKILEGESKPQNFQISINITEIRQLVGDNIDPSVVIEIGDDKKQTSVKEGTNAPFYNEYFVFDIYCNQDIFFDKVIKLSVMHSKIMKSYCVGTFKIDVGTVYSQPGHQFINKWATLTDPADIRVGVKGYLKCDISVSGKGDVAPPSQKFSDAEEQIDKHLLLPEGLNPERPWARFYVIVYRAEGLPRINSSIMANVTKAFVGDTTALIDPYVEVSFFGQVGRTSTQKSSADPVWNEQVVFKEMFPPLCQRLKIRVLDEGSMNDVAIGTHYIDLHTISNDTDGDNGFLPTFGPAWINLYGSLRNSTLVDDSQELNEGVGEGVSYRGRLYIELSVEILSGGAAESKSLLSKFSPKDAKGGKTGTGAGGEEEKSKMIGPEVIPVEPPQKMRDEDMETFLLFGCVFEASMIDRKIGDRPVTLEFTIGNFGNLIDGAAPPPSKKKLEDVSVTAPLLDTTATMPCKSTTTPERPIFGDAQRHYMHLPIAAQKPCVYVYSSWEDRAYRLHHANMLDTIALMFEEGVAKVTELDKMLSPEAWSLMHHVLREFRRDAKEFIAFAEKKVKGSNLTLLDKKRLTMCKQELESMTEMAGGLLEPKRRSLTVKEMLLEAQKIKKKLRFLVEEPQHTLPDVFVCLVSNNKRVAYARIPARDLLFSESPEQRGRDCGKIKTLFLKPPVKRAPGWTVQAKLDVFLWLGTCAESSRMLDNLPSGFELVSTSFEDRTGAPPEYLLYTEQHMFELRAHMYQARGLIAADNTGLSDPFAWVSFLSHSQCTGIIKQTLTPTWNQVIKMTNMSLYGGLYDIAQEPPLIVIEVYDDDAVGSEYLGSTVAVPVVKLSEEQYSPPQLQYSPLFCGSLSGGDILGAFELIQSGEHSLPVLDEPDGVVIPVPSYIRPVLCKYRIEVLFWGLRELKKVQLLSVDRPQVFIKCAGSGVNSSVIQSYKKNPNFTIIVDAFDVELPEDEHLLPPLTLTVVDWRAFGRSTLVGSHVINNLALFKHNPVPVQQPPPEPKNIAVAQLSLQQSVIPPPDEEIAIEIEHEEIIAPKSQEPEFQDTKQRVSKKSKRRSTKRKKRTTADESADNVIDWWSKYYASMEKIKQAKQKEDNPFPLLFENTSGMRDRKKEVNYKSVIEQPRLATLQVYDKELEAEFGPFDDWVKTFELFRGKANEEDGSAYERFVGKFKGRFCLYKLPEADGEAEEGYVDSGQFKINQGIPPNTAVNVLIRSLMHFKAFNLHPADPDGKADPYIVLKLGKTEIKDRDNYIPKQLNPVFGRSFEFQATFPKESLLTILIYDYDLVGGDDLIGETQIDLENRFYSRHRATCSLPTEYAIEGYNAWRDCMKPVDLLIKLCKENRLDNPQFSPGRITIGNKVFMGKTVFPDEDQMVESYEHLALKVLHRWSEMPNGGCKLVPEHIETRALYLKDKPGIDQGHLQMWVDIFPLDMPHPGPPVDISPRKPKGYELRIIIWNTEDVILEDTNFITGQQSSDIYVKGWLKGLEDDGQETDVHYNSLTGEGNFNWRFVFPFSYLPAEKVVVVQKRESIYSLDKTEQKMPAVLVMQVWDFERLSSDDFLGSVELDLHGFPRGAKSAKACKMEMLTELTENISIFQQKRSKGWWPFIKAGELTGKVEAEFHLVTAEEAEKNPVGRARKEPEPLEKPNRPDTSFSWFMNPFKCFFHLIWGNYKKYIIAGLVLLILTLFLVLLFYTLPGALSTKIVNG-
Table 2.2 – Fer1L6 sequence of sa16199 mutation
A.) zebrafish Fer1L6 cDNA sequence. C to T mutation location is highlighted in
blue. B.) Translated amino acid sequence for zebrafish Fer1L6. Location of stop
codon insertion is highlighted in blue.
48
2.6 – References
[1] A. Lek, F.J. Evesson, R.B. Sutton, K.N. North, S.T. Cooper, Ferlins:
Regulators of Vesicle Fusion for Auditory Neurotransmission, Receptor
Trafficking and Membrane Repair, Traffic. 13 (2012) 185–194.
doi:10.1111/j.1600‐0854.2011.01267.x.
[2] L. V Anderson, K. Davison, J.A. Moss, C. Young, M.J. Cullen, J. Walsh, et
al., Dysferlin is a plasma membrane protein and is expressed early in
human development, Hum. Mol. Genet. 8 (1999) 855–861.
doi:10.1093/hmg/8.5.855.
[3] R. Varga, P.M. Kelley, B.J. Keats, a Starr, S.M. Leal, E. Cohn, et al., Non‐
syndromic recessive auditory neuropathy is the result of mutations in the
otoferlin (OTOF) gene., J. Med. Genet. 40 (2003) 45–50.
doi:10.1136/jmg.40.1.45.
[4] M.C. Eisenberg, Y. Kim, R. Li, W.E. Ackerman, D.A. Kniss, A. Friedman,
Mechanistic modeling of the effects of myoferlin on tumor cell invasion,
Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 20078–20083.
doi:10.1073/pnas.1116327108.
[5] T. Xia, S. Chen, Z. Jiang, Y. Shao, X. Jiang, P. Li, et al., Long noncoding
RNA FER1L4 suppresses cancer cell growth by acting as a competing
endogenous RNA and regulating PTEN expression., Sci. Rep. 5 (2015)
13445. doi:10.1038/srep13445.
[6] C.B. Moens, T.M. Donn, E.R. Wolf‐Saxon, T.P. Ma, Reverse genetics in
zebrafish by TILLING, Briefings Funct. Genomics Proteomics. 7 (2008) 454–
459. doi:10.1093/bfgp/eln046.
[7] B.R. Bill, A.M. Petzold, K.J. Clark, L. a Schimmenti, S.C. Ekker, A primer
for morpholino use in zebrafish., Zebrafish. 6 (2009) 69–77.
doi:10.1089/zeb.2008.0555.
[8] P. Flicek, I. Ahmed, M.R. Amode, D. Barrell, K. Beal, S. Brent, et al.,
Ensembl 2013, Nucleic Acids Res. 41 (2013). doi:10.1093/nar/gks1236.
[9] J.S. Taylor, I. Braasch, T. Frickey, A. Meyer, Y. Van De Peer, Genome
Duplication , a Trait Shared by 22 , 000 Species of Ray‐Finned Fish,
Genome Res. (2003) 382–390. doi:10.1101/gr.640303.1.
[10] C.L. Barton, E.W. Johnson, R.L. Tanguay, Facility Design and Health
Management Program at the Sinnhuber Aquatic Research Laboratory,
Zebrafish. 0 (2016) zeb.2015.1232. doi:10.1089/zeb.2015.1232.
[11] C. Thisse, B. Thisse, High‐resolution in situ hybridization to whole‐mount
49
zebrafish embryos, Nat. Protoc. 3 (2008) 59–69.
[12] P. Chatterjee, M. Padmanarayana, N. Abdullah, C.L. Holman, J. LaDu, R.L.
Tanguay, et al., Otoferlin deficiency in zebrafish results in defects in
balance and hearing: rescue of the balance and hearing phenotype with
full‐length and truncated forms of mouse otoferlin., Mol. Cell. Biol. 35
(2015) 1043–54. doi:10.1128/MCB.01439‐14.
[13] C.K. Almlie, A. Hsiao, S.M. Burrows, Dye‐Specific Wavelength Offsets to
Resolve Spectrally Overlapping and Co‐Localized Two‐Photon Induced
Fluorescence, Anal. Chem. 88 (2016) 1462–1467.
doi:10.1021/acs.analchem.5b04476.
[14] G. Kawahara, P.R. Serafini, J.A. Myers, M.S. Alexander, L.M. Kunkel,
Characterization of zebrafish dysferlin by morpholino knockdown,
Biochem. Biophys. Res. Commun. 413 (2011) 358–363.
doi:10.1016/j.bbrc.2011.08.105.
[15] M.E. Robu, J.D. Larson, A. Nasevicius, S. Beiraghi, C. Brenner, S.A. Farber,
et al., P53 Activation By Knockdown Technologies, PLoS Genet. 3 (2007)
787–801. doi:10.1371/journal.pgen.0030078.
[16] K.R. Doherty, A.R. Demonbreun, G.Q. Wallace, A. Cave, A.D. Posey, K.
Heretis, et al., The endocytic recycling protein EHD2 interacts with
myoferlin to regulate myoblast fusion, J. Biol. Chem. 283 (2008) 20252–
20260. doi:10.1074/jbc.M802306200.
[17] P.L.M.& K.P.C. Dimple Bansal, Katsuya Miyake, Steven S. Vogel, Se´verine
Groh, Chien‐Chang Chen, Roger Williamson, Defective membrane repair
in dysferlin‐deficient muscular dystrophy, Nature. 423 (2003) 1–5.
doi:10.1038/nature01604.1.
[18] J. Bakkers, Zebrafish as a model to study cardiac development and human
cardiac disease, Cardiovasc Res. 91 (2011) 279–288. doi:10.1093/cvr/cvr098.
[19] D. Staudt, D. Stainier, Uncovering the Molecular and Cellular Mechanisms
of Heart Development Using the Zebrafish, Annu. Rev. Genet. 46 (2011)
120913144909001. doi:10.1146/annurev‐genet‐110711‐155646.
[20] H.J. Auman, H. Coleman, H.E. Riley, F. Olale, H.J. Tsai, D. Yelon,
Functional modulation of cardiac form through regionally confined cell
shape changes, PLoS Biol. 5 (2007) 0604–0615.
doi:10.1371/journal.pbio.0050053.
[21] F.O. Kok, M. Shin, C.W. Ni, A. Gupta, A.S. Grosse, A. vanImpel, et al.,
Reverse genetic screening reveals poor correlation between morpholino‐
induced and mutant phenotypes in zebrafish, Dev. Cell. 32 (2015) 97–108.
doi:10.1016/j.devcel.2014.11.018.
[22] R.N.W. Kettleborough, E. de Bruijn, F. van Eeden, E. Cuppen, D.L.
50
Stemple, High‐throughput target‐selected gene inactivation in zebrafish,
Methods Cell Biol. 104 (2011) 121–127. doi:10.1016/B978‐0‐12‐374814‐
0.00006‐9.
[23] R.N. Kettleborough, E.M. Busch‐Nentwich, S.A. Harvey, C.M. Dooley, E.
de Bruijn, F. van Eeden, et al., A systematic genome‐wide analysis of
zebrafish protein‐coding gene function, Nature. 496 (2013) 494–497.
doi:10.1038/nature11992.
[24] S. Schulte‐Merker, D.Y.R. Stainier, Out with the old, in with the new:
reassessing morpholino knockdowns in light of genome editing
technology, Development. 141 (2014) 3103–3104. doi:10.1242/dev.112003.
[25] E.W. Abrams, M.C. Mullins, Early zebrafish development: It’s in the
maternal genes, Curr. Opin. Genet. Dev. 19 (2009) 396–403.
doi:10.1016/j.gde.2009.06.002.
[26] R. Petryszak, M. Keays, Y.A. Tang, N.A. Fonseca, E. Barrera, T. Burdett, et
al., Expression Atlas update‐an integrated database of gene and protein
expression in humans, animals and plants. TL ‐ 44, Nucleic Acids Res. 44
VN‐r (2016) 52. doi:10.1093/nar/gkv1045.
[27] K.R. Doherty, A. Cave, D.B. Davis, A.J. Delmonte, A. Posey, J.U. Earley, et
al., Normal myoblast fusion requires myoferlin., Development. 132 (2005)
5565–75. doi:10.1242/dev.02155.
[28] C.A. Wilson, S.K. High, B.M. McCluskey, A. Amores, Y.L. Yan, T.A. Titus,
et al., Wild sex in zebrafish: Loss of the natural sex determinant in
domesticated strains, 2014. doi:10.1534/genetics.114.169284.
[29] J.L. Anderson, A. Marí, I. Braasch, A. Amores, P. Hohenlohe, P. Batzel, et
al., Multiple sex‐associated regions and a putative sex chromosome in
zebrafish revealed by RAD mapping and population genomics, PLoS One.
7 (2012). doi:10.1371/journal.pone.0040701.
[30] X.G. Wang, R. Bartfai, I. Sleptsova‐Freidrich, L. Orban, The timing and
extent of “juvenile ovary” phase are highly variable during zebrafish testis
differentiation, J. Fish Biol. 70 (2007) 33–44. doi:10.1111/j.1095‐
8649.2007.01363.x.
[31] M. Larkin, G. Blackshields, N. Brown, R. Chenna, P. McGettigan, H.
McWilliam, et al., ClustalW and ClustalX version 2, Bioinformatics. 23
(2007) 2947–2948. doi:doi:10.1093/bioinformatics/btm404.
51
Chapter 3 ‐ Subcellular Localization and Expression of
Fer1L6 in the C2C12 cell line
3.1 ‐ Introduction
In order to gain an understanding of Fer1L6 function at the molecular
level it is crucial to study Fer1L6 in in vitro systems, where subcellular
localization, protein‐protein interactions, and biophysical mechanisms can we
directly studied. To date the references to Fer1L6 in cell culture are in C2C12 and
HEK cells. Doherty et al. 2008, mentions unpublished data in which they found
Fer1L6 expression in mouse myoblast C2C12 cells[1]. Redpath et al. showed
subcellular localization of transfected Fer1L6 in C2C12 cells, fibroblast Cos‐7
cells, and HEK cells, but does not look at endogenous Fer1L6[2]. Previous work
showed in situ hybridization results in zebrafish identified expression of Fer1L6
in skeletal muscle, as well as many other tissue types. Morpholino Fer1L6 knock
down in zebrafish shows a distinct phenotype of disorganization in skeletal
muscle and under development of the heart. The primary issue with exclusively
studying Fer1L6 in zebrafish, is that there is no commercially available antibody
which recognizes the zebrafish homolog. However, an anti‐Fer1L6 antibody
exists for the human epitope, which will cross react with mouse Fer1L6 [3]. All
of these preliminary findings and circumstances lead to the decision to
investigate Fer1L6 function in the mouse leg skeletal myoblast C2C12 line.
3.2 ‐ Methods
Immunostaining and confocal microscopy
C2C12 cells were cultured in DMEM with 10%FBS (Thermo Fischer, CA)
on class coverslips. Coverslips were fixed in 4% paraformaldehyde in PBS for 30
52
minutes and then washed in PBS. Cells were permeabilized in 0.2% Triton X‐100
for 20 minutes and then washed in PBS. Cells were blocked in 2.5% BSA in PBST
for 1 hr followed by addition of primary Fer1L6 antibody (abcam, UK) at 1:500
and incubated overnight at 4°C. Cells were washed in PBS and then secondary
antibody was added at 1:1,000 + DAPI at 1:2,000 and incubated for 1hr at room
temperature. After washing, coverslips were mounted in fluoromount (Sigma
Aldrich, MO) for imaging. Images were collected on a Zeiss LSM 78 NLO
confocal microscope using a 64x oil objective. Post imaging processing was done
using Zen black.
WB
Western blot was carried out as previously described [4]. Samples were
run on 8% gel, blotted onto PVDF membrane, and blocked with 2% milk in PBST.
Proteins were ditected with primary antibodies at 1:500 and secondary
antibodies at 1:1,000. Hamlet anti‐dysferlin, anti‐Fer1L6, and anti‐actin were
purchased from Abcam.
q‐PCR
RNAeasy kit (Quiagen, Germany) was used to extract total RNA from
cells according to manufactures’ protocol. cDNA was synthesized using iScript
DNA synthesis kit (Bio‐Rad, CA) according to manufactures’ protocol. All q‐
PCR was performed using Power Sybr‐green PCR master mix (Applied
Biosystems, CA) on a 7500 fast Real‐Time PCR System (Applied Biosystems, CA).
At least one set of primers (Sigma‐Aldrich, MO) were designed for each gene of
interest (Table 3.1).
53
3.3 – Results
3.3.1 ‐ Validation of antibody
The study of Fer1L6 was critically improved with the availability of an
anti‐human Fer1L6 antibody produced as part of the human protein atlas project
[3]. This project aims to produce antibodies for immunostaining of human tissue
in an effort to produce a full proteomic analysis of protein localization within all
tissue types. The results from their immunostaining analysis shows high levels
of expression in stomach and small intestine with the majority of other tissue
showing either moderate or low expression levels. However, the specificity of
the antibody had not been independently verified. The epitope for production of
this polyclonal antibody is found in the endogenous linker region between the
C2 domains C2E and C2F [5]. In order to verify the specificity of the antibody,
we expressed a recombinant Fer1L6 C2E‐C2F construct with a maltose binding
protein (MBP) tag on the N‐terminus in BL21 cells. The total lysate from
expression of this construct was used in a western blot with the Fer1L6 antibody.
The resulting blot shows a single band at the expected 96 KDa molecular weight
in induced but not unindicted lysate, verifying no cross reactivity with any other
E. coli proteins (Figure 3.1). Sequence alignment shows 79% identity between the
linkers of C2E and C2F between human and mouse [6], thus the polyclonal
Fer1L6 antibody is expected to work across species. While we cannot confirm
any cross reactivity in other species, these results support specificity of the
antibody in E. coli lysate. The is of particular importance moving forward, as
splice variants and post translational truncation products have not been
independently verified for Fer1L6 in any species. The only information we have
about splice variants relies on high throughput RNA‐seq analysis which can
artificially show shortened variant due to RNA degradation, library prep, and
54
low coverage at 5’ and 3’ ends. Thus it is important to have both RNA and
protein data to confirm any non‐predicted molecular weight products.
3.3.2 ‐ Fer1L6 is expressed in myoblasts and differentiated myotubes
Doherty et al. 2008, report they found Fer1L6 expression in mouse
myoblast C2C12 cells, although they included no data to support the claim. To
determine whether Fer1L6 is expressed in C2C12 cells, we tested
undifferentiated C2C12 myoblasts and differentiated C2C12 myotubes for
Fer1L6.
C2C12 cells can be induced to differentiate from myoblasts to myotubes
through starvation conditions by reducing the FBS in the cell culture media from
10% to 2%. Indeed we observed that reduction in FBS resulted in nearly full
differentiation of all cells after 10 days under low FBS conditions (Figure 3.2).
Western blot analysis showed virtually no dysferlin in the undifferentiated
myoblast lysate, and clear expression in differentiated myotubes, as previously
observed [7]. This confirms sufficient differentiation for comparison, as dysferlin
is a marker for differentiation. The Fer1L6 western blot showed multiple
different molecular weight bands. Interestingly, the primary band is found at
about 130KDa, significantly lower than the 1862amino acid (209KDa) predicted
for the only Fer1L6 mouse protein coding transcript (Figure 3.2). There are
fainter bands at 36KDa, 80KDa, and 260KDa for the undifferentiated lysate, and
34, 36, 50, and 80KDa for the differentiated lysate. No predicted protein coding
transcripts exist for these molecular weights. The expression level between
differentiated and undifferentiated seems unchanged at the protein level based
on band intensity. Additionally, the presence of the epitope towards the C‐
terminal of the protein, suggests that if post translational modifications are
happening, they are most likely being removed from the N‐terminal, leaving the
55
localizing transmembrane domain intact. Proteolysis of the Fer1L6 during lysis
prep is unlikely, because a wide spectrum mammalian protease inhibitor cocktail
was added to the lysis buffer. Further investigation into the reason for the
unexpected molecular weight needs to be further investigated.
To confirm that there is no expression differences between myoblast and
myotubes, q‐PCR was performed on cDNA from total lysate samples throughout
the 10 days of differentiation (Figure 3.3). Myoferlin results show some
statistically significant changes compared to day 0, but this increase does not
follow a specific trend. Dysferlin expression is drastically increased within the
first two days of differentiation, and slight increases are present through the next
8 days. This is consistent with previously published results showing minimal to
no dysferlin in mononucleated myoblasts, but measurable expression by day two
of differentiation [7]. Fer1L6 expression however, shows no time points with
statistically different expression levels when compared to day 0. These results
are consistent with the western blot data (Figure 3.2), indicating no changes in
Fer1L6 at either the mRNA or protein level through myoblast differentiation.
To investigate subcellular localization of Fer1L6, immunostaining and
fluorescent confocal microscopy were performed on undifferentiated C2C12
cells. Previous work from Redpath et al. in 2015 showed recombinant
overexpressed Fer1L6 localized primarily to the trans‐Golgi of HEK and C2C12
cells, and could be found at lower levels on recycling endosomes and the plasma
membrane. Our immunostaining of undifferentiated C2C12 cells shows
dispersed localization both perinuclear and cytosolic with some accumulation on
the plasma membrane (Figure 3.4). The cytosolic signal shows both punctate and
striated patterning, with the striations radiating out from the nuclear region
towards the plasma membrane. This may be Fer1L6 being trafficked on vesicles
56
bound for fusion at the plasma membrane, consistent with localization of other
ferlin proteins [2].
3.3.3 ‐ Fer1L6 is expressed in HEK cells
The Redpath et al. recombinant overexpression studies used HEK cells for
the majority of their studies, because they had detected RNA expression in an
adult human kidney cDNA library. However, the presence of endogenous
Fer1L6 in HEK cells at the protein level has not been established. To verify
Fer1L6 in HEK cells, we performed a WB on HEK cell lysate. Analysis of the
whole lysate revealed a Fer1L6 positive band at the same 130KDa molecular
weight as was detected in the C2C12 cell lysate (Figure 3.5). However there are
also faint bands at 250KDa and 36KDa. The 250KDa band was not observed in
the C2C12 lysate. The dysferlin blot shows a faint band around 250KDa as
expected.
3.3.4 ‐ Fer1L6 expression in mouse tissue
To date the human protein atlas project is the only study which looked at
Fer1L6 expression in multiple tissue types at the protein level. In an effort to
confirm and solidify those high throughput results, we performed western blot
analysis on whole tissue lysate from necropsied mouse organs. Fer1L6 was
detected at 130KDa in liver, stomach wall, testes, skeletal muscle, heart, kidney,
spleen, forebrain, and hindbrain but not in intestine (Figure 3.7). The liver band
is the most intense, but this could be due to differences in amount of lysate
loaded, since the total amount of protein lysate loaded for each tissue could not
be normalized, due to a combination of inefficient extraction and inaccuracy in
quantitation. The insolubility of Fer1L6 requires use of 2% triton X‐100 detergent
to keep the protein in the soluble fraction. This raises the amount of lipid that is
not remove from the sample during certification, causing quantitation methods,
57
including Bradford assays to be highly inaccurate. Therefore, we chose to load as
much total protein lysate as possible, looking for a presence or non‐presence of
Fer1L6. These results should therefore not be in any way quantitative.
The human protein atlas shows high expression in stomach and small
intestine, moderate expression in brain, testes, skeletal muscle, heart muscle,
kidney, and low expression in liver and spleen. All but one of these were
detected in the mouse western blot, with intestine being the exception. Western
blot detection showed no Fer1L6 in the intestine sample, which according to the
atlas should be high expression. This could be due to our methodologies of
western blot vs. immunohistochemistry, or because no a sufficient amount of
protein was loaded onto the western blot. Alternatively, the human protein atlas
may have the error, and we know many errors exist because of the high
throughput nature of the project. For example, the myoferlin protein analysis
reports no detectable myoferlin in skeletal muscle, although myoferlin
expression and function in skeletal muscle has been well established by multiple
groups.
3.4 ‐ Discussion
Western blot analysis and q‐PCR analysis show that Fer1L6 is expressed
in both C2C12 and HEK cells. In terms of differentiation, Fer1L6 shows no
appreciable change in expression similar to the expression profile of myoferlin.
The expression of Fer1L6 in early undifferentiated myoblasts suggests that it has
a role either related to differentiation like myoferlin, or independent of
myogenesis but necessary for both myoblasts and myotubes. The presence of
58
Fer1L6 in HEK cells indicates that Fer1L6 functions outside of muscle tissue,
similar to myoferlin and dysferlin.
The C2C12 subcellular localization is not visually consistent with the
Redpath et al. data, but is consistent with their proposed mechanism of Fer1L6
being involved in recycling pathways between the plasma membrane and trans‐
Golgi [2]. The disagreements between our C2C12 localization results and the
Redpath et al. results are most likely due to the difference between endogenous
and overexpression results. Redpath et al. used a plasmid containing a CMV
promoter for expression of Fer1L6, which produces excessive amounts of
protein. With this level of overexpression, the cell cannot transport the protein
efficiently, and excess protein accumulates in the protein sorting organelle. The
endogenous Fer1L6 is more evenly distributed. This in vitro analysis of Fer1L6
corroborates the hypothesis that Fer1L6 functions in a wide range of cell types
and is responsible for membrane trafficking events between the perinuclear
region and the plasma membrane.
59
3.5 – Figures
Figure 3.1
Western blot showing specificity of HPA054117 anti‐Fer1L6 antibody. E. coli
containing MBP‐C2EF plasmid was lysed and total lysate of uninduced and
induced samples were blotted using the Fer1L6 antibody. There is no
nonspecific signal in either sample, and only the predicted 96KDa band of MBP‐
Fer6C2EF is visible in the induced E.coli. .
60
Figure 3.2
WB showing expression of dysferlin and Fer1L6 in differentiated and non‐
differentiated C2C12 cells. Protein levels of dysferlin are increased in
differentiated myotubes (day 0 vs. day10, middle panel), while Fer1L6 is
unchanged *day 0 vs. day 10, left panel). Fer1L6 is also seen at a lower molecular
weight than thee 209KDa predicted size, while dysferlin is close to the predicted
240KDa size. Actin was run as a loading control.
61
Figure 3.3
qPCR of myoferlin, dysferlin, and Fer1L6 in C2C12 cells from 0 to 10 days under
low FBS conditions. All samples were n=6 with two biological replicates and
three technical replicates of each. A 2 way ANOVA test was used to compare
each ΔΔCt value to the 0 day time point. Myoferlin expression was statistically
increased at 2, 6, and 10 days of differentiation. As expected dysferlin expression
is rapidly increased within the first two days and then gradually increased as
days progress. No statistically different expression is seen in Fer1L6 compared to
day zero. **p<0.01, ***p<0.001.
62
Figure 3.4 ‐ Fer1L6 localization in C2C12 cells
Immunostaining of Fer1L6 in undifferentiated C2C12 cells. Red is anti‐Fer1L6
and blue is DAPI nuclear staining. Fer1L6 staining appears punctated and has
striated structures radiating away from the perinuclear region towards the
plasma membrane. Small accumulation of Fer1L6 is visible on the plasma
membrane, particularly in filapodia structures.
64
Figure 3.5
Western blot of HEK‐293 cell lysate shows expression of Fer1L6 at about 120KDa,
with minor bands at 40KDa and 250KDa. The predicted size of Fer1L6 is
209KDa. Dysferlin is also visible at the predicted molecular weight of 240KDa.
Actin was also run as a positive control.
65
Figure 3.6 – transcription in cardiac tissue
Reverse transcription PCR of mouse cardiac tissue shows expression of both
dysferlin and Fer1L6 with an actin positive control. Size of all bands are correct
based on primer design. Representative image based on two biological replicates.
66
Figure 3.7
Western blot of various mouse tissue types, shows presence of Fer1L6 in a wide
range of tissues. Fer1L6 expression around 130KDa is detectable in liver,
stomach wall, testes, skeletal muscle, heart, kidney, spleen, forebrain, and
hindbrain. Not detected in intestine.
67
Target
Gene
Forward primer Reverse primer
Fer1L6 CCAGAGAAGCCTCTGGTGA
C
TGGGAAACCTTGACCAGTTC
Dysferlin CCAGCTCTCCAACGTACTGC GCCAAACTGGCGATTATCAA
Myoferli
n
CCAGAAGACACCAGCTCAG
G
ATGTCCTCGGCTCGGTAGAT
Actin AAATCGTGCGTGACATCAA
A
AAGGAAGGCTGGAAAAGAG
C
Table 3.1 – q‐PCR primers for C2C12 expression analysis
68
3.6 ‐ References
[1] K.R. Doherty, A.R. Demonbreun, G.Q. Wallace, A. Cave, A.D. Posey, K.
Heretis, et al., The endocytic recycling protein EHD2 interacts with
myoferlin to regulate myoblast fusion, J. Biol. Chem. 283 (2008) 20252–
20260. doi:10.1074/jbc.M802306200.
[2] G.M.I. Redpath, R.A. Sophocleous, L. Turnbull, C.B. Whitchurch, S.T.
Cooper, Ferlins Show Tissue‐Specific Expression and Segregate as Plasma
Membrane/Late Endosomal or Trans‐Golgi/Recycling Ferlins, Traffic. 17
(2016) 245–266. doi:10.1111/tra.12370.
[3] R. Petryszak, M. Keays, Y.A. Tang, N.A. Fonseca, E. Barrera, T. Burdett, et
al., Expression Atlas update‐an integrated database of gene and protein
expression in humans, animals and plants. TL ‐ 44, Nucleic Acids Res. 44
VN‐r (2016) 52. doi:10.1093/nar/gkv1045.
[4] S.J. Codding, N. Marty, N. Abdullah, C.P. Johnson, Dysferlin Binds
SNAREs and Stimulates Membrane Fusion in a Calcium Sensitive Manner,
J. Biol. Chem. (2016) jbc.M116.727016. doi:10.1074/jbc.M116.727016.
[5] R.D. Finn, A. Bateman, J. Clements, P. Coggill, R.Y. Eberhardt, S.R. Eddy,
et al., Pfam: The protein families database, Nucleic Acids Res. 42 (2014).
doi:10.1093/nar/gkt1223.
[6] M. Larkin, G. Blackshields, N. Brown, R. Chenna, P. McGettigan, H.
McWilliam, et al., ClustalW and ClustalX version 2, Bioinformatics. 23
(2007) 2947–2948. doi:doi:10.1093/bioinformatics/btm404.
[7] K.R. Doherty, A. Cave, D.B. Davis, A.J. Delmonte, A. Posey, J.U. Earley, et
al., Normal myoblast fusion requires myoferlin., Development. 132 (2005)
5565–75. doi:10.1242/dev.02155.
69
Chapter 4 ‐ General Conclusion and Future Directions
Contributing Authors: Chelsea Holman, Colin Johnson
4.1 – Conclusions from study
Fer1L6 is a poorly characterized member of the ferlin gene family. To date
four of the six mammalian ferlins have been associated with human disease, thus
producing great interest in understanding the physiological role of all ferlins,
including Fer1L6 [1]. Using a heterologous system, one study looked at the
subcellular localization of recombinant Fer1L6 and found the majority of the
protein accumulated at the trans‐Golgi [2]. All other known information about
Fer1L6 comes from high throughput expression profiles using RNA‐seq or
microarray immunohistochemistry [3]. These results show Fer1L6 is widely
expressed, although the often conflicting results of these studies makes it difficult
to determine which specific tissues Fer1L6 is definitively expressed in.
Our results from ISH in zebrafish embryos and western blot of various
mouse tissue show widely distributed expression, with the only tissue not testing
positive for Fer1L6 being mouse intestine. These results for the most part
corroborates the findings in large scale transcript and proteomic studies, with the
exception of the missing intestine [3]. The presence of both mRNA and protein
in such a wide range of tissues definitively illustrates that Fer1L6 is a functional
protein coding gene in vertebrates and not a pseudogene. The wide distribution
of Fer1L6 matches reports for other ferlins, including myoferlin, which is thought
to be ubiquitously expressed [4]. Thus, we conclude that the expression profile of
Fer1L6 is not unlike other ferlins.
70
Fer1L6 morpholino studies in zebrafish show abnormalities in both
skeletal and cardiac muscle. Closer examination of the skeletal muscle indicates
misslocalization of sarcoplasmic reticulum membrane and under‐developed T‐
tubules. The impaired heart rate and underdevelopment of the atrium and
ventricle structures further support the conclusion that depletion of Fer1L6
results in developmental differences in striated muscle. This phenotype differs
from the reported phenotype associated with loss of dysferlin and myoferlin
expression, and suggest that Fer1L6 may have a no redundant function [5][6].
Immunostaining of Fer1L6 in the mouse myoblast C2C12 cell line shows
Fer1L6 localized to the perinuclear region with punctate striations leading
outwards towards the plasma membrane, with small amounts of Fer1L6 signal at
the plasma membrane. This patterning is consistent with previously described
rab11 associated trans‐Golgi‐to‐plasma membrane vesicle recycling [2]. Analysis
of western blot and q‐PCR analysis shows no changes in C2C12 expression
through differentiation. Based upon these results, it is attractive to envision
Fer1L6 as a membrane trafficking protein involved in post‐Golgi trafficking
event(s) that is not sensitive to the myoblast‐to‐myotube transition.
With this information, including previously published results, and large
scale proteomics work, we propose a functional role for Fer1L6 in development
of muscle and other tissues through plasma membrane and membrane bound
proteins via calcium regulated movement of vesicles from the trans‐Golgi to the
plasma membrane and back again.
4.2 – New Questions Raised and Future Directions
The sa16199 zebrafish line does not yet have ‐/‐ males crossing with ‐/‐
females, until the J3s reach reproductive maturity. Once ‐/‐ J4s can be produced
71
from ‐/‐ parents, three major experiments will be run. First, The J4 embryos will
also need to be analyzed for the presence of Fer1L6 mRNA. A mutation in the
gene will not necessarily result in null expression of the gene. The sa16199
mutation could results in production of a fully functional C2B domain, although
preliminary studies of otoferlin recovery assays using otoferlin genes with no
transmembrane domain are not able to recover the otoferlin phenotype. In order
to classify this mutant line as a Fer1L6 null line, we must demonstrate that even
transcription is turned off completely.
If sa16199 is confirmed as a null Fer1L6 zebrafish line, J4 embryos can be
used to look for phenotypic differences. The lack of an obvious phenotype in the
first ‐/‐ sa16199 mutant zebrafish raises questions about the validity of the muscle
phenotype. However, the J3 generation is not sufficient to definitively say there
is no phenotype. Some developmental phenotypes do not appear until no
maternal mRNA is available at fertilization. Because all of the J2 ‐/‐ were males,
the J3 will all have maternal Fer1L6 mRNA from their +/‐ mothers. This is why it
is crucial to carry out experiments looking for phenotypic differences in the J4
embryos and adults. If there are still no obvious phenotypes once the J4 embryos
are available, then re‐running the EM imaging of skeletal muscle will be crucial
to determining if there are subcellular structural differences that do not result in
full trunk curving.
Finally, RNA‐seq analysis of the ‐/‐ vs +/+ embryos may give valuable
information about pathways that are being effected by the removal of Fer1L6
protein. It is possible that transcriptional differences between a mutant fish line
and a morpholino knock down effect regulation of other genes differently. It
may be possible that changes in other gene expression are able to compensate for
72
mutant Fer1L6, but these changes do not occur when there is only an 80% knock
down.
More thorough characterization of Fer1L6 localization and interacting
partners in C2C12 and other cell lines will be important moving forward.
Identification of the cytoskeletal and motor proteins responsible for the striation
patterns seen in the C2C12 immunostaining could give insight into what
membrane cycling pathway Fer1L6 is participating in. This could be done
through immunofluorescence colocalization, or though the inhibition of specific
motors followed by visualization of changes in Fer1L6 distribution.
Overall, this work establishes the foundation for future studies by
validating zebrafish and the C2C12 and HEK cell lines as model systems for the
study of Fer1L6. This work also highlights the need for a better understanding of
Fer1L6’s function, and the degree of functional redundancy with dysferlin and
myoferlin in tissues. Dysferlin’s association with muscular dystrophy has
created a tunnel vision effect in the research community, in which ferlins
expressed in muscle are studied nearly exclusively in terms of mechanisms
unique to muscle, although myoferlin and dysferlin are expressed widely
throughout different tissue types. RNA‐seq analysis may open up new areas or
cell types of interest.
4.3 – References
[1] A. Lek, F.J. Evesson, R.B. Sutton, K.N. North, S.T. Cooper, Ferlins:
Regulators of Vesicle Fusion for Auditory Neurotransmission, Receptor
Trafficking and Membrane Repair, Traffic. 13 (2012) 185–194.
doi:10.1111/j.1600‐0854.2011.01267.x.
[2] G.M.I. Redpath, R.A. Sophocleous, L. Turnbull, C.B. Whitchurch, S.T.
Cooper, Ferlins Show Tissue‐Specific Expression and Segregate as Plasma
Membrane/Late Endosomal or Trans‐Golgi/Recycling Ferlins, Traffic. 17
73
(2016) 245–266. doi:10.1111/tra.12370.
[3] R. Petryszak, M. Keays, Y.A. Tang, N.A. Fonseca, E. Barrera, T. Burdett, et
al., Expression Atlas update‐an integrated database of gene and protein
expression in humans, animals and plants. TL ‐ 44, Nucleic Acids Res. 44
VN‐r (2016) 52. doi:10.1093/nar/gkv1045.
[4] W.S. Wang, X.H. Liu, L.X. Liu, W.H. Lou, D.Y. Jin, P.Y. Yang, et al.,
ITRAQ‐based quantitative proteomics reveals myoferlin as a novel
prognostic predictor in pancreatic adenocarcinoma, J. Proteomics. 91 (2013)
453–465. doi:10.1016/j.jprot.2013.06.032.
[5] G. Kawahara, P.R. Serafini, J.A. Myers, M.S. Alexander, L.M. Kunkel,
Characterization of zebrafish dysferlin by morpholino knockdown,
Biochem. Biophys. Res. Commun. 413 (2011) 358–363.
doi:10.1016/j.bbrc.2011.08.105.
[6] C. Yu, A. Sharma, A. Trane, S. Utokaparch, C. Leung, P. Bernatchez,
Myoferlin gene silencing decreases Tie‐2 expression in vitro and
angiogenesis in vivo, Vascul. Pharmacol. 55 (2011) 26–33.
doi:10.1016/j.vph.2011.04.001.
74
Bibliography
Abdullah, N. et al., 2014. Quantitation of the calcium and membrane binding
properties of the C2 domains of dysferlin. Biophysical Journal, 106(2), pp.382–
389.
Abrams, E.W. & Mullins, M.C., 2009. Early zebrafish development: It’s in the
maternal genes. Current Opinion in Genetics and Development, 19(4), pp.396–
403.
Almlie, C.K., Hsiao, A. & Burrows, S.M., 2016. Dye‐Specific Wavelength Offsets
to Resolve Spectrally Overlapping and Co‐Localized Two‐Photon Induced
Fluorescence. Analytical Chemistry, 88(2), pp.1462–1467.
Anderson, J.L. et al., 2012. Multiple sex‐associated regions and a putative sex
chromosome in zebrafish revealed by RAD mapping and population
genomics. PLoS ONE, 7(7).
Anderson, L. V et al., 1999. Dysferlin is a plasma membrane protein and is
expressed early in human development. Human Molecular Genetics, 8(5),
pp.855–861. Available at:
http://hmg.oxfordjournals.org/content/8/5/855.full.pdf.
Auman, H.J. et al., 2007. Functional modulation of cardiac form through
regionally confined cell shape changes. PLoS Biology, 5(3), pp.0604–0615.
Bakkers, J., 2011. Zebrafish as a model to study cardiac development and human
cardiac disease. Cardiovasc Res, 91(2), pp.279–288. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/21602174.
Barton, C.L., Johnson, E.W. & Tanguay, R.L., 2016. Facility Design and Health
Management Program at the Sinnhuber Aquatic Research Laboratory.
Zebrafish, 0(0), p.zeb.2015.1232. Available at:
http://online.liebertpub.com/doi/10.1089/zeb.2015.1232.
Bashir, R. et al., 1998. A gene related to Caenorhabditis elegans spermatogenesis
75
factor fer‐1 is mutated in limb‐girdle muscular dystrophy type 2B. Nature
genetics, 20(1), pp.37–42. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/9731527.
Bernatchez, P.N. et al., 2009. Myoferlin is critical for endocytosis in endothelial
cells. American journal of physiology. Cell physiology, 297(3), pp.C484–C492.
Bill, B.R. et al., 2009. A primer for morpholino use in zebrafish. Zebrafish, 6(1),
pp.69–77. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2776066&tool=p
mcentrez&rendertype=abstract.
Buss, F. et al., 2001. Myosin VI isoform localized to clathrin‐coated vesicles with a
role in clathrin‐mediated endocytosis. EMBO Journal, 20(14), pp.3676–3684.
Cai, B. et al., 2014. GRAF1 forms a complex with MICAL‐L1 and EHD1 to
cooperate in tubular recycling endosome vesiculation. Frontiers in cell and
developmental biology, 2(May), p.22. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/25364729%5Cnhttp://www.pubmedc
entral.nih.gov/articlerender.fcgi?artid=PMC4214196.
Chatterjee, P. et al., 2015. Otoferlin deficiency in zebrafish results in defects in
balance and hearing: rescue of the balance and hearing phenotype with full‐
length and truncated forms of mouse otoferlin. Molecular and cellular biology,
35(6), pp.1043–54. Available at:
http://mcb.asm.org/lookup/doi/10.1128/MCB.01439‐
14%5Cnhttp://www.ncbi.nlm.nih.gov/pubmed/25582200%5Cnhttp://www.p
ubmedcentral.nih.gov/articlerender.fcgi?artid=PMC4333087.
Chen, Y.A. & Scheller, R.H., 2001. SNARE‐mediated membrane fusion. Nature
Reviews Molecular Cell Biology, 2(2), pp.98–106. Available at:
http://dx.doi.org/10.1038/35052017.
Codding, S.J. et al., 2016. Dysferlin Binds SNAREs and Stimulates Membrane
Fusion in a Calcium Sensitive Manner. Journal of Biological Chemistry,
p.jbc.M116.727016. Available at:
76
http://www.jbc.org/lookup/doi/10.1074/jbc.M116.727016.
Davis, D.B. et al., 2000. Myoferlin, a candidate gene and potential modifier of
muscular dystrophy. Human molecular genetics, 9(2), pp.217–226.
Dimple Bansal, Katsuya Miyake, Steven S. Vogel, Se´verine Groh, Chien‐Chang
Chen, Roger Williamson, P.L.M.& K.P.C., 2003. Defective membrane repair
in dysferlin‐deficient muscular dystrophy. Nature, 423(May), pp.1–5.
Doherty, K.R. et al., 2005. Normal myoblast fusion requires myoferlin.
Development (Cambridge, England), 132(24), pp.5565–75. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=4066872&tool=p
mcentrez&rendertype=abstract.
Doherty, K.R. et al., 2008. The endocytic recycling protein EHD2 interacts with
myoferlin to regulate myoblast fusion. Journal of Biological Chemistry, 283(29),
pp.20252–20260.
Eisenberg, M.C. et al., 2011. Mechanistic modeling of the effects of myoferlin on
tumor cell invasion. Proceedings of the National Academy of Sciences of the
United States of America, 108(50), pp.20078–20083. Available at:
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3250187&tool=p
mcentrez&rendertype=abstract%5Cn%3CGo to ISI%3E://000298034800051.
Finn, R.D. et al., 2014. Pfam: The protein families database. Nucleic Acids Research,
42(D1).
Flicek, P. et al., 2013. Ensembl 2013. Nucleic Acids Research, 41(D1).
Helfmann, S. et al., 2011. The crystal structure of the C 2A domain of
otoferlin reveals an unconventional top loop region. Journal of Molecular
Biology, 406(3), pp.479–490. Available at:
http://dx.doi.org/10.1016/j.jmb.2010.12.031.
Hui, E. et al., 2011. Mechanism and function of synaptotagmin‐mediated
membrane apposition. Nat. Struct. Mol. Biol., 18(7), pp.813–821. Available at:
http://dx.doi.org/10.1038/nsmb.2075.
77
Hui, E. et al., 2009. Synaptotagmin‐Mediated Bending of the Target Membrane Is
a Critical Step in Ca2+‐Regulated Fusion. Cell, 138(4), pp.709–721.
Inoue, M. et al., 2006. Expression of myoferlin in skeletal muscles of patients with
dysferlinopathy. Tohoku Journal of Experimental Medicine, 209(2), pp.109–116.
Jimenez, J.L. & Bashir, R., 2007. In silico functional and structural characterisation
of ferlin proteins by mapping disease‐causing mutations and evolutionary
information onto three‐dimensional models of their C2 domains. Journal of
the Neurological Sciences, 260(1–2), pp.114–123.
Johnson, C.P. & Chapman, E.R., 2010. Otoferlin is a calcium sensor that directly
regulates SNARE‐mediated membrane fusion. Journal of Cell Biology, 191(1),
pp.187–197.
Kawahara, G. et al., 2011. Characterization of zebrafish dysferlin by morpholino
knockdown. Biochemical and Biophysical Research Communications, 413(2),
pp.358–363.
Kerr, J.P., Ward, C.W. & Bloch, R.J., 2014. Dysferlin at transverse tubules
regulates Ca2+ homeostasis in skeletal muscle. Frontiers in Physiology, 5
MAR(March), pp.1–5.
Kettleborough, R.N. et al., 2013. A systematic genome‐wide analysis of zebrafish
protein‐coding gene function. Nature, 496(7446), pp.494–497. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/23594742.
Kettleborough, R.N.W. et al., 2011. High‐throughput target‐selected gene
inactivation in zebrafish. Methods in Cell Biology, 104, pp.121–127.
Kok, F.O. et al., 2015. Reverse genetic screening reveals poor correlation between
morpholino‐induced and mutant phenotypes in zebrafish. Developmental
Cell, 32(1), pp.97–108.
Lang, C.T. et al., 2009. Placental dysferlin expression is reduced in severe
preeclampsia. Placenta, 30(8), pp.711–718. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/19545895.
78
Larkin, M. et al., 2007. ClustalW and ClustalX version 2. Bioinformatics, 23(21),
pp.2947–2948.
Ledig, S., Röpke, A. & Wieacker, P., 2010. Copy number variants in premature
ovarian failure and ovarian dysgenesis. Sexual Development, 4(4–5), pp.225–
232.
Lek, A. et al., 2012. Ferlins: Regulators of Vesicle Fusion for Auditory
Neurotransmission, Receptor Trafficking and Membrane Repair. Traffic,
13(2), pp.185–194.
Lek, A. et al., 2010. Phylogenetic analysis of ferlin genes reveals ancient
eukaryotic origins. BMC Evolutionary Biology, 10, p.231. Available at:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2923515/pdf/1471‐2148‐10‐
231.pdf.
Lenhart, K.C. et al., 2014. GRAF1 promotes ferlin‐dependent myoblast fusion.
Developmental Biology, 393(2), pp.298–311.
Leto, D. & Saltiel, A.R., 2012. Regulation of glucose transport by insulin: traffic
control of GLUT4. Nature reviews. Molecular cell biology, 13(6), pp.383–96.
Available at:
http://www.nature.com.ep.fjernadgang.kb.dk/nrm/journal/v13/n6/full/nrm3
351.html.
Leung, C. et al., 2013. Expression of myoferlin in human and murine carcinoma
tumors: Role in membrane repair, cell proliferation, and tumorigenesis.
American Journal of Pathology, 182(5), pp.1900–1909.
Liu, J. et al., 1998. Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi
myopathy and limb girdle muscular dystrophy. Nature genetics, 20(1), pp.31–
36.
Marlin, S. et al., 2010. Temperature‐sensitive auditory neuropathy associated
with an otoferlin mutation: Deafening fever! Biochemical and Biophysical
Research Communications, 394(3), pp.737–742. Available at:
http://dx.doi.org/10.1016/j.bbrc.2010.03.062.
79
Marty, N.J. et al., 2013. The C2 domains of otoferlin, dysferlin, and myoferlin
alter the packing of lipid bilayers. Biochemistry, 52(33), pp.5585–5592.
Moens, C.B. et al., 2008. Reverse genetics in zebrafish by TILLING. Briefings in
Functional Genomics and Proteomics, 7(6), pp.454–459.
de Morree, A. et al., 2013. Dysferlin regulates cell adhesion in human monocytes.
Journal of Biological Chemistry, 288(20), pp.14147–14157.
Padmanarayana, M. et al., 2014. Characterization of the lipid binding properties
of otoferlin reveals specific interactions between PI(4,5)P2 and the C2C and
C2F Domains. Biochemistry, 53(30), pp.5023–5033.
Pang, Z.P. & S??dhof, T.C., 2010. Cell biology of Ca2+‐triggered exocytosis.
Current Opinion in Cell Biology, 22(4), pp.496–505.
Pesciotta, E.N. et al., 2014. Dysferlin and other non‐red cell proteins accumulate
in the red cell membrane of Diamond‐Blackfan anemia patients. PLoS ONE,
9(1), p.e85504.
Petryszak, R. et al., 2016. Expression Atlas update‐an integrated database of gene
and protein expression in humans, animals and plants. TL ‐ 44. Nucleic acids
research, 44 VN‐r(D1), p.52. Available at:
http://dx.doi.org/10.1093/nar/gkv1045.
Posey, A.D. et al., 2014. EHD1 mediates vesicle trafficking required for normal
muscle growth and transverse tubule development. Developmental Biology,
387(2), pp.179–190.
Posey, A.D. et al., 2011. Endocytic recycling proteins EHD1 and EHD2 interact
with Fer‐1‐like‐5 (Fer1L5) and mediate myoblast fusion. Journal of Biological
Chemistry, 286(9), pp.7379–7388.
Redpath, G.M.I. et al., 2016. Ferlins Show Tissue‐Specific Expression and
Segregate as Plasma Membrane/Late Endosomal or Trans‐Golgi/Recycling
Ferlins. Traffic, 17(3), pp.245–266. Available at:
http://doi.wiley.com/10.1111/tra.12370.
80
Robu, M.E. et al., 2007. P53 Activation By Knockdown Technologies. PLoS
Genetics, 3(5), pp.787–801.
Rochlin, K. et al., 2010. Myoblast fusion: When it takes more to make one.
Developmental Biology, 341(1), pp.66–83. Available at:
http://dx.doi.org/10.1016/j.ydbio.2009.10.024.
Roux, I. et al., 2006. Otoferlin, Defective in a Human Deafness Form, Is Essential
for Exocytosis at the Auditory Ribbon Synapse. Cell, 127(2), pp.277–289.
Schulte‐Merker, S. & Stainier, D.Y.R., 2014. Out with the old, in with the new:
reassessing morpholino knockdowns in light of genome editing technology.
Development, 141, pp.3103–3104. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/25100652.
Sharma, A. et al., 2010. A new role for the muscle repair protein dysferlin in
endothelial cell adhesion and angiogenesis. Arteriosclerosis, Thrombosis, and
Vascular Biology, 30(11), pp.2196–2204.
Sollner, T. et al., 1993. A Protein Assembly‐Disassembly Pathway In Vitro That
May Correspond to Sequential Steps of Synaptic Vesicle Docking ,
Activation , and Fusion. Cell, 75, pp.409–418.
Song, D. et al., 2015. Myoferlin expression in non‐small cell lung cancer:
Prognostic role and correlation with VEGFR‐2 expression. Oncology Letters,
pp.998–1006. Available at: http://www.spandidos‐
publications.com/10.3892/ol.2015.3988.
Staudt, D. & Stainier, D., 2011. Uncovering the Molecular and Cellular
Mechanisms of Heart Development Using the Zebrafish. Annual Review of
Genetics, 46(1), p.120913144909001. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/22974299.
Südhof, T.C., 2004. THE SYNAPTIC VESICLE CYCLE. Annual Review of
Neuroscience, 27(1), pp.509–547. Available at:
http://www.annualreviews.org/doi/10.1146/annurev.neuro.26.041002.131412.
81
Taylor, J.S. et al., 2003. Genome Duplication , a Trait Shared by 22 , 000 Species of
Ray‐Finned Fish. Genome Research, (13), pp.382–390.
Thisse, C. & Thisse, B., 2008. High‐resolution in situ hybridization to whole‐
mount zebrafish embryos. Nature Protocols, 3(1), pp.59–69.
Turtoi, A. et al., 2013. Myoferlin is a key regulator of EGFR activity in breast
cancer. Cancer Research, 73(17), pp.5438–5448.
Uhlén, M. et al., 2015. Tissue‐based map of the human proteome. Science,
347(6220), pp.1260419–1260419. Available at:
http://www.ncbi.nlm.nih.gov/pubmed/25613900.
Varga, R. et al., 2003. Non‐syndromic recessive auditory neuropathy is the result
of mutations in the otoferlin (OTOF) gene. Journal of medical genetics, 40(1),
pp.45–50.
Varga, R. et al., 2006. OTOF mutations revealed by genetic analysis of hearing
loss families including a potential temperature sensitive auditory
neuropathy allele. Journal of medical genetics, 43(August), pp.576–581.
Volakis, L.I. et al., 2014. Loss of myoferlin redirects breast cancer cell motility
towards collective migration. PLoS ONE, 9(2).
Wang, M. et al., 2012. PaxDb, a Database of Protein Abundance Averages Across
All Three Domains of Life. Molecular & Cellular Proteomics, 11(8), pp.492–500.
Available at: http://www.mcponline.org/cgi/doi/10.1074/mcp.O111.014704.
Wang, W.S. et al., 2013. ITRAQ‐based quantitative proteomics reveals myoferlin
as a novel prognostic predictor in pancreatic adenocarcinoma. Journal of
Proteomics, 91, pp.453–465.
Wang, X.G. et al., 2007. The timing and extent of “juvenile ovary” phase are
highly variable during zebrafish testis differentiation. Journal of Fish Biology,
70(SUPPL. A), pp.33–44.
Washington, N.L. & Ward, S., 2006. FER‐1 regulates Ca2+ ‐mediated membrane
82
fusion during C. elegans spermatogenesis. Journal of cell science, 119(Pt 12),
pp.2552–62. Available at: http://jcs.biologists.org/content/119/12/2552.short.
Wilson, C.A. et al., 2014. Wild sex in zebrafish: Loss of the natural sex determinant in
domesticated strains,
Wu, M.C. et al., 2010. Powerful SNP‐Set Analysis for Case‐Control Genome‐wide
Association Studies. American Journal of Human Genetics, 86(6), pp.929–942.
Xia, T. et al., 2015. Long noncoding RNA FER1L4 suppresses cancer cell growth
by acting as a competing endogenous RNA and regulating PTEN
expression. Scientific reports, 5(4), p.13445. Available at:
/pmc/articles/PMC4549704/?report=abstract.
Yamashita, T., 2012. Ca2+‐dependent regulation of synaptic vesicle endocytosis.
Neuroscience Research, 73(1), pp.1–7. Available at:
http://dx.doi.org/10.1016/j.neures.2012.02.012.
Yu, C. et al., 2011. Myoferlin gene silencing decreases Tie‐2 expression in vitro
and angiogenesis in vivo. Vascular Pharmacology, 55(1–3), pp.26–33.
Yue, B. et al., 2015. Long non‐coding RNA Fer‐1‐like protein 4 suppresses
oncogenesis and exhibits prognostic value by associating with miR‐106a‐5p
in colon cancer. Cancer Science, 106(10), pp.1323–1332.