wang - molecular basis of genetic diseases
Post on 08-Oct-2015
16 Views
Preview:
DESCRIPTION
TRANSCRIPT
-
Molecular basis of
Genetic diseases
Dr Tao Wang
1.014 A V Hill Building
Wednesday 26th 2011, 10:00
E-mail: tao.wang@manchester.ac.uk
-
Molecular Basis of Genetic Diseases
Types of mutations affecting genes
e.g., mutation at regulatory region of a gene,
mutation affecting the protein product, frame
shift, splicing, etc.
Epigenetic changes affecting genes
Independent of DNA sequence change
Determinants of phenotypic expression
Genotype-phenotype correlation
-
Basic types of mutations Mis-sense mutation
Single nucleotide change leads to amino acid change
Example: CGC (Arg) TGC (Cys)
Nonsense mutation
Single nucleotide change introduce a stop cordon
Example: TGC (Cys) TGA (STOP)
Synonymous substitution
No amino acid change
Example: CGC (Arg) CGA (Arg)
Deletions, insertions
Trinucleotide expansion
CAGCAGCAGCAGCAGCAGCAGCAG
-
Over view of
Transcription and translation
Gene variations affecting any of the above process can give rise to disease phenotype by
generating abnormal polypeptides/proteins quantitatively or qualitatively.
-
How can a mutation cause the clinical phenotype?
Loss-of-function mutation A mutation that results in reduced or abolished protein function
e.g., thalassemia, Duchenne muscular dystrophy, fragile X syndrome
Gain-of-function mutation A mutation that results in an abnormal activity on a protein
e.g., Huntingtons disease, T-ALL
Dominant negative effect Mutant product interfere with the function of the normal product in
a heterozygote
A special case of loss-of-function
e.g., COL1A1 or COL1A2 mutation
-
Loss-of-function mutation (I) -- Regulatory Mutations
Haemophilia B (OMIM 306900): Promoter mutations in human factor IX gene
Bowen D J Mol Path 2002;55:1-18
2002 by BMJ Publishing Group Ltd and Association of Clinical Pathologists
Factor IX promoter region has:
Binding sites for transcription factors LF-A1/HNF4 and C/EBP
- Mutations in this region cause
Haemophilia B Leyden
Androgen response element (ARE)
- Hormonally regulated
- Amelioration effect at puberty
- Haemophilia B Brandenburg
causes lifelong haemophilia B
-
Autosomal recessive
Point mutation or deletion results in reduced rate of synthesis or no synthesis of one of the globin chains that make up haemoglobin.
Too few globins synthesized
Loss-of-function mutation (II) -- Protein Products - Quantitative
Hemoglobins:
Embryonic: z2e2 , a2e2, z2g2 Fetal: a2g2 (HbF) Adult : a2d2 (HbA2)
a2b2 (HbA)
from embryo to adult
z a2 a1
e Gg Ag d b
Developmental expression of globin chains
Thalassemia (OMIM 613985)
-
Loss-of-function mutation (III) -- Protein Products - Qualitative
Autosomal recessive
Red blood cells abnormal, rigid, sickle shape, decreases cells' flexibility
Mutation: single nucleotide change in the -globin gene
GAG (glutamic acid) to GTG (valine)
Abnormal function of globin
A qualitative problem
Sickle cell disease (OMIM 603903)
-
Loss-of-function mutation (IV) -- Large deletions
Two typical conditions:
Duchenne muscular dystrophy (DMD)
Becker muscular dystrophy (BMD)
Caused by mutation in dystrophin gene (DMD)
Introduce Frame shift
-
Duchenne muscular dystrophy (DMD) (OMIM 310200)
X-linked recessive; female carriers usually OK
Affects ~1 in 3,000 boys
Clinical:
Mainly affecting young boys (3-5 years)
progressive muscle weakness
OK up to age 10, wheelchair in teens, steady decline, die
in 20s (respiratory and cardiac involvement)
No effective treatment.
-
Becker muscular dystrophy (BMD) (OMIM 300376)
X-linked recessive
Affects ~1 in 20,000 men
Same clinical picture as Duchenne dystrophy, but symptoms very variable and occurs much later
Can have normal lifespan
-
Dystrophin anchors the contractile machinery to the sarcolemma
Burton & Davies Cell 108 : 5-8; 2002
-
Duchenne vs. Becker dystrophy
deletions in DMD, mis-sense mutations in BMD?
large deletions in DMD, small ones in BMD?
deletion of an essential part of the gene in DMD, other parts in BMD?
no correlation with size of deletion
deletions overlap;
in some cases a BMD deletion encompasses 1 or more DMD deletions
65% deletions in both DMD and BMD
-
----------- --------------- Delete exon 2 ---------------- -----------
CATCATCA TCATCATCAT CATCATCAT CATCATCAT
CATCATCATCATCATCATCATCATCATCATCATCAT mRNA
His - His - His - His - His - His - His - His - His - His - His - His protein
DNA 1 2 3 4
CATCATCATTCATCATCATCATCATCAT
His - His - His - Ser - Ser - Ser - Ser - Ser - Ser
mRNA
protein
DNA TCATCATCAT CATCATCAT CATCATCAT
1 3 4
Frame shift
-
-------------------------- Delete exon 3 ---------------------------
CATCATCA CATCATCAT
CATCATCATCATCATCACATCATCAT.
His - His - His - His - His - His - Ile - Ile -
mRNA
protein
DNA CATCATCAT
1 2 4
Frame shift
CATCATCA TCATCATCAT CATCATCAT CATCATCAT
CATCATCATCATCATCATCATCATCATCATCATCAT mRNA
His - His - His - His - His - His - His - His - His - His - His - His protein
DNA 1 2 3 4
-
----------------------- Delete exons 2 and 3 ----------------------
CATCATCATCATCATCAT
His - His - His - His - His - His
mRNA
protein
DNA CATCATCAT CATCATCAT
1 4
In frame
CATCATCA TCATCATCAT CATCATCAT CATCATCAT
CATCATCATCATCATCATCATCATCATCATCATCAT mRNA
His - His - His - His - His - His - His - His - His - His - His - His protein
DNA 1 2 3 4
-
Deletions of exons that
create a frameshift completely
abolish synthesis of dystrophin
in males
Deletions that leave the
reading frame intact result in
synthesis of a smaller but
partially functional protein
Gene sequence is 99.3% intron - so most deletion breakpoints
are in introns & remove one or more complete exons
consequence is
Duchenne dystrophy
consequence is
Becker dystrophy
Dystrophin gene deletions
-
T-cell acute lymphoblastic leukemia (T-ALL) (OMIM 190198)
NOTCH1 mutation in over 50% of patients
Activating mutations
Gain-of-function mutation
-
Gain-of-function Notch1 mutations in T-ALL
Annual Reviews
Two mutational hot spots are present within the extracellular heterodimerization Domain (HD) and the C-terminal PEST domain.
HD mutations cause ligand-independent generation of activated Notch1 (ICN1); PEST mutations sustain ICN1 activity.
-
Trinucleotide Repeats Expansion
Two examples:
Huntingtons disease
Gain-of-function mutation
Fragile X syndrome
Loss-of-function mutation
-
Huntington Disease (OMIM 143100)
Autosomal dominant
Late onset (typically 40s) Neurodegenerative disorder
Involuntary movements
Memory loss
Apathy
Changes in personality and mood
depression and anxiety, Seizures
-
Molecular basis of HD
Genotype-phenotype correlations:
Huntingtin gene
(CAG)n
8-29 normal
29-35 premutation
>37 pathological mutation
>60 Juvenile HD
Exon 1
QQQQQQQQQQ
-
Molecular mechanisms involved in pathogenesis of PolyQ diseases
Everett C M , Wood N W Brain 2004;127:2385-2405
Using HD as an example:
-
Fragile-X Syndrome (OMIM 309550)
Borderline to severe mental retardation
~20% autistic
Characteristic long face, large ears in adult men
Macro orchidism in 80-90%
Incidence ca. 1 in 4,000 males
-
The Fragile-X chromosome
Marker X seen in a proportion of cells under special
culture conditions
-
Molecular basis of Fragile-X
7-60 normal
60-230 premutation
>230 full mutation
(CGG)n
5UTR 3UTR
NKS RGG
NE
S
FMR1 gene
-
Function of the FMR1 gene
Wild type FMRP function: CGG expended FMRP:
AAAAA
AAAAA
AAAAA
AAAAA
-
AAAAA
AAAAA
FMRP with a point mutation (1304N):
-
How does mutant FMRP1 leads to Fragile-X?
Repeat is in 5 untranslated region of FMR1
Full expansion triggers methylation of the DNA through histone deacetylation
Methylation switches off expression of the gene
Loss of FMRP1 is the underlying mechanism of Fragile-X Syndrome.
-
Unique properties of dynamic mutations
Anticipation A phenomenon whereby the symptoms of a
genetic disorder become apparent at an earlier age and severer as it is passed on to the next generation.
Repeat unstable, tend to expend
The size of expansion is often correlated with the severity of symptoms and/or with onset at younger age
-
Dominant negative effect Osteogenesis imperfecta Type III (OMIM 259420):
Mutations in COL1A1 or COL1A2 genes
Bones fracture easily, deformity, Loose joints
Respiratory problems
Short stature, spinal curvature and sometimes barrel-shaped rib cage
Poor muscle tone in arms and legs
Discolouration of the sclera
Early loss of hearing possible
-
Self-assembly of collagen fibres
Mutations with the most drastic effect on protein synthesis are not the one that produce the most severe phenotypes. The mutant protein has dominant negative effect on the triple helix assembly.
-
Molecular Basis of Genetic Diseases
Types of mutations affecting genes
Epigenetic changes affecting genes
Determinants of phenotypic expression
-
Epigenetic Changes Affecting Gene Expression
Heritable (cell to daughter cell, or through a pedigree )
changes in the gene expression that do not depend on
a DNA sequence change.
Mechanisms: DNA methylation
Histone modification and Chromatin structure
RNA silencing by non-coding RNAs
Examples: Genomic imprinting: AS, PWS
X-chromosome inactivation
-
Chromatin structure - open vs closed
Berger Curr Opin Genet Dev 12 142-148 ; 2002
-
slow development
unusual movements
sever learning difficulties epilepsy happy face (Happy Puppet
Syndrome) poor communication skills and
little or absent speech
Angelman syndrome (AS) (OMIM 105830)
-
Prader-Willi syndrome (PWS) (OMIM 176270)
marked hypotonia: low muscle tone
short stature excessive appetite
obesity
immature physical development
learning disabilities emotional instability
almond shaped eyes with thin, down-turned lips
nearly always left-handed
-
Both cases had Deletion of proximal portion of chromosome 15 (15q11)
FISH (Fluorescent In-Situ Hybridization) test for deletions
-
15q11 deletions
Maternal deletion
Angelman
Paternal deletion
Prader-Willi
Reason: Genomic imprinting A phenomenon that gene expression of a small number of genes (~80) in mammals
depends on parental origin.
-
Molecular Basis of Genetic Diseases
Types of mutations affecting genes
Epigenetic changes affecting genes
Determinants of phenotypic expression
-
Determinants of phenotypic expression
Nature of the mutation Mutation type
Mutation position Different mutations in the same gene can lead to more- or less-severe
phenotypes depending on the effects of the mutations on the expression of the gene or on the function of the protein product
Genetic background Heterogeneity in genetic background
Environmental influences Lifestyle, diet, and living environment may affect the disease
phenotype
-
Genetic background
The background genes may influence the disease phenotype Two individuals within a family may have the same mutated gene,
however, they will certainly (unless they are identical twins) have a lot of genes that are not similar
Genetic variants (polymorphisms) in the same gene may influence the disease phenotype Example: polymorphism H558R has mutation-specific effects on
SCN5A-related Sick Sinus Syndrome (SSS)
-
Polymorphism modulate disease phenotype
Loss-of-function defect of D1275N in SCN5A was rescued by R558 through enhancing cell surface targeting and improving steady-state activation of the mutant channels.
Whole-cell current recordings by patch clamping:
J Gui et al, J Cardiovasc Electrophysiol. 2010,;21(5):564-73.
-
Summary
Types of mutation affecting gene function
Los-of-function mutation Thalassemia, Duchenne muscular dystrophy, fragile X syndrome
Gain-of-function mutation Huntingtons disease, T-ALL
Dominant negative effect Osteogenesis imperfecta Type III
Epigenetic mechanisms in genetic diseases
PWS, AS
Genotype-phenotype correlations
top related