tender no.0034 / 2020 bidding documents - punjab
Post on 26-Mar-2022
7 Views
Preview:
TRANSCRIPT
Tender No.0034 / 2020
Bidding Documents SPECIAL INSTRUCTIONS
No Cutting erasing is allowed in the Tender bid.
Bid offered strictly in accordance with the bid document will only be accepted.
Only typed bid will be accepted (no hand written)
Bid Security will be accepted in the form of CDR (Call Deposit Receipt)
THIS IS FOR STRICT COMPLIANCE, FAILING WHICH THE RESPECTIVE BID SHALL STAND CANCELLED
Contact Address: Incharge Purchase Cell
University of Veterinary and Animal Sciences,
Sheikh Abdul Qadir Jillani (Outfall Road) Lahore
Tel: 042-99211449, Ext:138
Tel:042-99213650
TERMS & CONDITIONS
IPL No. 8329
1. Please write clearly in the front of Main envelop “Tender number”
2. The tender documents should be in Tape binding shape and attached bidding documents improper manner
and respectively to evaluate the bidding documents
I. Attached bid security
II. Attached copy of deposited challan / tender fee
III. Attached proposal / quotation and write complete detail of tender
IV. Attached copy of NTN, STRN, Professional certificate, active taxpayer list (NTN, STRN)
V. Attached Stamp paper of black listing.
VI. Attached literatures and other helping documents
3. The price of this tender document is Rs.2,000/- (Non Refundable)
4. The Tender complete in all respect along with 1% Bid Security (Refundable) of Estimated Price / Cost in
the shape of only “Call Deposit Receipt” (CDR) in favor of “Treasurer, UVAS”, Lahore should reach in
Purchase Cell by 21-10-2020 at 11:00 a.m in the University of Veterinary & Animal Sciences, Lahore.
5.
Lot
No. Description
Bid Security in
Pak Rupees. (Rs)
01
Procurement of Chemicals & Glassware/Plastic ware under the
Project Establishment of University of Veterinary and Animal Sciences
at Bahawalpur 36000/-
6. The quotations will be opened on 21-10-2020 at 11:30 a.m. in Administration Block, Treasurer Office,
Meeting Room No. 116, 1st Floor, University of Veterinary and Animal Sciences, Lahore.
7. The offered price should be inclusive of all taxes.
8. The rate must be quoted only in Pakistani Rupees
9. Quoted rates must be valid for 120 days
10. No offer shall be considered if it is:
a) Submitted without Tender Document
b) Submitted without Bid Security money.
c) Received after the date and time fixed for the receipt of tenders.
d) Is unsigned
e) Is ambiguous
f) Is conditional
g) Is received by Telegram.
h) Is received with a validity period shorter than the required in the tender enquiry.
i) Does not confirm to general conditions of the enquiry i.e it is not accompanied by sample or
manufacturers literature where required.
j) Is for store materially and substantially different from that required in the tender enquiry.
11. A stamp paper of Rs.50/- will be attached with the bid that the firm is not black listed at PPRA, suspended
or removed in any Government, Semi Government, Autonomous Bodies, Public sector university and any
other Department.
12. In case of warranty 10% amount as security will be deducted from the bills of the firms at the time of
payment and be released after the expiry of warranty period (where applicable).
13. The sample may be provided as & when required by Technical Committee.
14. Applicable Govt. levies will be deducted at source from the bill.
15. The equipment / stores supplied by the bidder shall be brand new, in original manufacturer packing and
complete in all respects. Cost of transportation of supplied equipment / goods to the site of University and
cost of installation and commissioning of equipment shall be the responsibility of the supplier.
16. Supply of material should be made within stipulated period of the Purchase Order positively; in case of
failure the amount of CDR may forfeited and purchase will be made at the risk and cost of the defaulter or
any penalty as per Purchase Rules, 2005 of the University can also be imposed.
17. The buyer shall notify the supplier in writing/through telephone of any defects that occur during the
warranty period. On receipt of such notification/telephonic message the supplier shall attend the breakdown
call within a maximum of 6 working hours.
18. The firm offering prices for supply of machinery and equipment should have sufficient qualified technical
staff and be equipped and having capability to undertake the maintenance or replacement for the equipment
supplied to this University.
19. The bidding documents should be dropped in Tender Box in the office of the Purchase Cell, Room No. 108,
1st Floor, UVAS, Lahore, during five working days till the last date mentioned in tender notice.
20. The successful bidder will submit stamp duty @ 0.25% of the total value of contract / purchase order at the
time of submission of bill to the end user.
21. Bids must be quoted on company’s letter pad duly signed stamped by the bidder
22. The person who will attend the tender meeting as per date mentioned in tender will be compulsory
submitted Authorization letter from individual, firm and company.
23. Delivery time or completion schedule as per requirement of end user.
24. Please attach NTN, GST and professional tax certificates with bidding documents.
25. Please attach the copy of your FBR Active taxpayer serial Number list for the current financial year.
26. Please read, sign all the tender documents, terms and conditions carefully and attached with your bidding
documents.
27. Please clearly mentioned Tender number, company name and address in front of envelop.
28. I or we, solemnly swear (or affirm) participated in UVAS Tendering process that there is no Conflict of
Interest / relations in any shape as well as no direct relationship with University staff, member, employee
and faculty.
29. Any further information if required can be obtained during office hour from 8.00a.m to 4.00 pm
(Monday to Friday) from Purchase Cell, University of Veterinary and Animal Sciences, Lahore
We, M/s. ____________________________ hereby certify that we have read and agreed with all
terms and conditions mentioned above.
Signature: ________________________________
Designation: ________________________________
Dated: ________________________________
Stamp: ________________________________
Incharge Purchase Cell
University of Veterinary and Animal
Sciences, Sheikh Abdul Qadir Jillani
(Outfall Road) Lahore
Tel: 042-99211449, Ext:138
Tel:042-99213650
TENDER DOCUMENTS
Sr# Item Name Specification Company/Origin Pack/Units Qty.
1 (p-nitrophenyl) phosphate sodium salt
N3002 Sigma/Equivalent N3002-100MG 1
2 0.2 ml PCR tubes
sterile/clean transparent suitable for PCR testing
Europe/local 1000/pkt 1
3 0.5 ml PCR tubes
sterile/clean transparent suitable for PCR testing
Europe/local 1000/pkt 1
4 1.5 ml microfuge tubes
sterile/clean transparent suitable for PCR testing
Europe/local 1000/pkt 1
5 10µl-Tips sterile/clean yellow color fine quality/Lab grade
Europe/local 1000/pkt 5
6 100µl-Tips sterile/clean yellow color fine quality/Lab grade
Europe/local 500/pkt 5
7 1000µl-Tips sterile/clean yellow color fine quality/Lab grade
Europe/local 500/pkt 5
8 1-amino 2 naphthol sulphonic acid (ANSA)
Lab grade Europe/local 25 g 1
9 2-Ethoxy ethanol Lab grade Europe/local 500 g 2
10 2XPCR kits Laboratory use Sigma/Equivalent 200 Rxn 2
11 5,5-dithiobis (2-nitrobenzoic acid)
D8130 Sigma/Equivalent 500 mg 1
12 6X Loading dye Molecular analysis Sigma/Equivalent 5 ml 1
13 Acetic acid laboratory grade local/imported 2.5 L/pack 1
14 Acetocarmine Lab grade, slide stain
BDH/Equivalent 100 ml 1
15 Acetone Lab grade local/imported 7.5 L 6
16 Acetyl cholinesterase from electric eel
C3389 Sigma/Equivalent 2000 units 1
17 acetylthiocholine iodide A5751 Sigma/Equivalent 1 g 1
18 Acrylamide-bis acrylamide Mixture
Solid Powder form for preparing SDS gel for protein electrophoresis
local/imported 100g/pack 1
19 Agarose Lab grade local/imported 500g/pack 1
20 AI Rods 25 pcs/ pack Geentech/equivalent 1 Nos. 2
21 AI Sheeths 50 pcs/ pack Geentech/equivalent 1 Nos.
15
22 Alkaline Phosphatase from E. Coli
P5931 Sigma/Equivalent 100 unit/mg 1
23 Almond Oil Food grade Local/Imported 20 mL 1
24 Aluminum foil paper Lab grade local/imported 1 roll 1
25 Amikacin (AN) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
local/equivalent 50 discs/cartridge
2
26 Ammonia Lab grade Merck/equivelent 2.5 L 1
27 Ammonium chloride (NH4Cl)
lab grade Sigma/Equivalent 1.1 kg 4
28 Ammonium molybdate lab grade Sigma/Equivalent 1 kg 1
29 Ammonium per sulphate Solid Powder form for preparing prtein gel/buffer solutions
imported/local 1kg/pack 1
30 Ammonium sulphide solution (S(NH4)2)
Lab grade Sigma/Equivalent 500 ml 1
31 Amoxicillin (AX) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
imported/local 100 discs/cartridge
3
32 Amphotericin B Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
imported/local 50 discs/cartridge
2
33 Ascorbic acid A5960 Sigma/equivalent 100 g 2
34 Auto burrette 10 ml Lab grade imported/local 10 ml 1
35 Autoclavable Glass Petri plates
90x15mm imported/local 100/carton 2
36 Autoclavable Polyester cleanroom Shoe Cover
Light Blue colour, with Soft Tan sole, having Elastic in hem at ankle, Rear snap adjustment, Color coded ribbon at heel, Rugged skid-resistant sole material, Excellent resistance to abrasion
imported/local 500/pack 1
37 Balplex Mannual Syringes
20ml imported/local 1 Nos. 2
38 Barrits reagent
Lab grade/For detecting the indole and identifying the indole-positive and indole-negative microorganisms.
imported/local 100ml/pack 1
39 Beaker 250 ml Pyrex/equivalent 1 Nos. 4
40 Beaker 1000 ml Pyrex/equivalent 1 Nos. 2
41 Beaker 100 ml Pyrex/equivalent 1 Nos. 2
42 Bendages 6 inches imported/ Local 1 Nos.
15
43 Biotin Lab grade imported/ Local 25g/pack 1
44 Bleaching liquid (500 ml) Commercial grade imported/ Local 500ml/pack
10
45 Blood collection tubes (EDTA contain) (5ml)
100 pieces in each pack
imported/ Local 1 pkt 1
46 Blue Nitrile Gloves, Large size, Powder Free 100 pcs/pack
Lab grade imported/ Local 100/pack
30
47 Borax Lab Grade imported/ Local 1 Kg 3
48 Boric acid Labortary grade imported/ Local 1 kg 1
49 Bovine serum albumin satbilize enzymes during biological reactions
imported/ Local 50ul/vial 1
50 Brain Heart Infusion Agar
Fine powder form suitable to prepare culture media to support growth of tedius bacteria
imported/ Local 500g/pack 1
51 Butylated hydroxyl toluene
Analytical imported/ Local 1 kg 1
52 Calcium chloride Lab grade imported/ Local 1kg 2
53 Camphor 96% Sigma/Equivalent 100 g 1
54 Capped Test Tube (Glass) 15 ml fully autoclave able
Lab grade imported/ Local 1 Nos.
10
55 Carbol fuchsin Lab grade imported/ Local 25g/pack 1
56 Carbolic acid Lab Grade imported/ Local 1 Kg 3
57 Cardamom oil Food grade Local/Imported 25 g 1
58 Cetrimonium bromide (CATB)
Lab Grade Sigma/equivalent 500g 1
59 Caustic soda Lab Grade imported/ Local 1 Kg 3
60 Cedar wood oil Lab grade Local/Imported 1000ml/pack 3
61 Cefaclor (CEC) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
Local/Imported 50 discs/cartridge
2
62 Ceftiofur (EFT) Antibiotic Disks cartridge
Lab grade Local/Imported 50discs/cartridge
2
63 Cell culture grade Antibiotic/antimycotic solution
Cell-culture grade mixture with both anti-bacterial and anti-fungal properties/pyrogen free
Europe/local/equivalent
100ml/pack 1
64 Cell culture iscoves modified Dulbecco medium (IMDM)
Cell-culture grade with stable pH and indicator of pH change
Europe/local/equivalent
500ml/pack 1
65 Cement commercial Local 50 kg bag 1
66 Cetyl trimethyl ammonium bromide
Lab grade Local/Imported 500 gms 1
67 China crucibles 25 ml Local/Imported 1 Nos.
18
68 China dishes 35 ml Local/Imported 1 Nos.
24
69 Chitosan 70,000 Dalton Analytical Merk/Equivalent 25 g 1
70 Chlorhexidine Soln. (LP Lon) 1lit
Topical Chlorhexidine Soln. 1.50% Liquid 1000ml
Local/Imported 1L
12
71 Chloroform Lab Grade Local/Imported 2.5 L 9
72 Chromic Acid Lab grade Merck/equivelent 1 kg 1
73 Ciprofloxacin (CIP) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/Imported 50 discs/cartridge
2
74 Colchicine powder form Local/Imported 5 tablets 1
75 Conical flask 1 L Local/Imported 1 Nos. 1
76 Conical flask 500 ml Local/Imported 1 Nos. 1
77 Conical flask 250 ml Local/Imported 1 Nos. 1
78 Conical flask 100 ml Local/Imported 1 Nos. 1
79 Coomassie blue R 100g powder form lab grade
Europe/equivalent 500g/pack 1
80 Copper sulphate Commercial Sigma/Equivalent 1 kg 4
81 Cotton Roles 1 pound Local 1 Nos.
10
82 Cotton roll (0.5kg)
Absorbent Cotton 500gm, 100% hydrophilic cotton purfied, bleached and carded, Suitable for First aid
Local/Imported 1 Nos. 2
83 Cotton Swab sterilized Lab grade Local/Imported 01 Pack 1
84 Cover slips 18x18 mm Lab grade Local/imported 1 Pack
28
85 Crystal Violet Lab grade Local/Imported 25g/pack 1
86 Cu wire (99.99%) Laboratory use Sigma/Equivalent 10gram 1
87 CuSO4.5H2O Lab use Sigma/Equivalent 1kg 3
88 DEPC (Di-ethyl pyrocarbonate) powder or >90% solution
>90% solution with its 1ml used to make 1 liter solution (v/v), suitable to inactivate RNAses in solutions used for RNA extraction
Local/Imported 100ml/pack 1
89 Detergents Lab Grade Local/Imported 1 Kg
10
90 Detol Commercial grade Local/Imported 1 L 5
91 Dextrose 10% 500 ml Local/ Equivalent 1 Nos.
10
92 Dextrose 25% 25 ml Local/ Equivalent 1 Nos.
100
93 Dicalcium phosphate (DCP)
lab grade Local/ Equivalent 1 kg
20
94 Diethyl ether
=98.0% contains ≤2% ethanol and ≤10ppm BHT as inhibitor
Sigma/Equivalent 1.00 L 8
95 Different organ permanent slides
Laboratory use Local/ Equivalent 1 pack 1
96 Disodium hydrogen Phosphate
Lab grade Sigma/equvalint 1 kg 3
97 Disposable Face Masks Face mask suitable for laboratory work
Local/ Equivalent 100/pack
11
98 Dissection box fine quality
complete set including dissecting scissors with with curved and serrated tips with sharp straight points, dissecting scalpel 6" long, 1½" cuting edge, scalpel handle, set
Local/ Equivalent 1 box 3
of forceps, needles, probe, 1 Plastic ruler 6", 1/16" div., millimeter and centimeter
99 DMSO Lab grade Local/ Equivalent 2.5liter/pack 1
100 DP syringes 1 cc Graduated fine quality
Local/ Equivalent 100/pack 3
101 DP syringes 3 cc Graduated fine quality
Local/ Equivalent 100/pack 3
102 DP syringes 5 cc Graduated fine quality
Local/ Equivalent 100/pack 8
103 DPX Lab Grade Local/ Equivalent 500 ml 1
104 Dropper amber bottle Lab grade Local/ Equivalent 1 Nos. 4
105 Ear model Ear model Local/ Equivalent 1 Nos. 1
106 EDTA Lab grade Invitrogen/equavilent 500 gm 5
107 EDTA Blood Collecting Tubes
Lab grade China/imported 1 Pack 2
108 ELISA reagent reservoirs
Sterile high-impact disposable polystyrene reservoirs to facilitate repeated multi-channel pipetting for reagent delivery to microplates.
Local/ Equivalent 100 piece/pack 1
109 Enrofloxacin (ENR) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
110 Eosin Stain powder (yellow)
Lab grade Sigma/Equivalent 500 gm 1
111 Eppendorf tubes (2 ml) 500 pieces in each pack
Imported 1 pkt 1
112 Erythromycin (E) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
3
113 Ethanol 99.80% Sigma/Equivalent 1.00 L
26
114 Ethidium bromide Molecular analysis Europe/Equivalent 1 g 1
115 Examination gloves medium box
Low Protein, Lightly Powdered, Size: Medium
Local/ Equivalent 50pairs/1 pack
12
116 Eye model Eye model Local/ Equivalent 1 Nos.
1
117 Eye-Protection Goggles
specified for laboratory work providing sufficient eyes' safety to aovid spalshes of hazardous material
Local/ Equivalent 1 goggle
10
118 Face Mask Commercial Local/ Equivalent Box (50 pieces/box)
10
119 Face with brain 8 parts Face with brain 8 parts
Local/ Equivalent 1 Nos. 1
120 Ferrous sulphate commercial Local/ Equivalent 1 kg 1
121 Fetal bovine serum
Lab grade, free from fungal/bacterial/viral pathogens
Local/ Equivalent 500ml/pack 1
122 Field Stain A Liquid Form BDH/Equivalent 1 Liter 1
123 Field Stain B Liquid Form BDH/ Equivalent 1 Liter 1
124 Filtration flask Lab grade Local/ Equivalent 500 ml 1
125 Flat top capped Falcon tubes (15 ml)
Graduated fine quality
Local/ Equivalent 50/pack 6
126 Flat top capped Falcon tubes (50 ml)
Graduated fine quality
Local/ Equivalent 50/pack 5
127 Fluorescein isothiocyanate (FITC)
Lab grade Local/ Equivalent 50 mg 1
128 Formaldehyde Lab Grade Local/ Equivalent 2.5 L
29
129 Frosted Glass slides
Clean glass slides frosted at one end suitable for labelling
Local/ Equivalent 50 slides/pack
15
130 Furacine Cream 28 g Local/ Equivalent 1 Nos.
10
131
Fwd: AGGAACTCGGAGTCCATCAC Rev: TGAAGGCCCAGAGGCGGAAC
Primer synthesis Local/ Equivalent 1 package 1
132
Fwd: CGCCTGTTTATCAAAAACAT Rev: CTC CGG TTT GAA CTC AGA TC
Primer synthesis Local/ Equivalent 1 package 1
133
Fwd: CTCTGCCTGCCCTGGACT Rev: GGAGAAGCAGAAGGCAACC
Primer synthesis Local/ Equivalent 1 package 1
134 Giemsa Stain Lab grade BDH/Equivalent 1 liter 3
136 Glass Culture Spreader
For uniform spreading of Clinical/bacterial sample on culture plate
Local/ Equivalent 1/unit
50
137 Glass funnels SEPARATORY FUNNEL WITH GLASS
Local/ Equivalent 1 Nos. 2
138 Glass rods Stirring rod Local/ Equivalent 1 Nos. 5
139 Glass slides Laboratory use Local/ Equivalent 1 Pack
20
140 Glass stain dropper Lab grade Local/ Equivalent 1 Nos. 2
141 Glucose and Fructose Laboratory use Sigma/Equivalent 1 kg 1
142 Glycerin Laboratory use Sigma/Equivalent 2.5 L 7
143 Glycial acetic Acid Lab grade Local/ Equivalent 2.5 L 2
144 Glycine Solid Powder form Lab grade
Local/ Equivalent 1kg/pack 1
145 Graduated Plastic Cylinder (1000 ml)
Commercial Local/ Equivalent 1 Piece 5
146 Graduated Measuring glass Cylinder Set 100ml
Lab grade Local/ Equivalent 1 No. 2
147 Graduated Measuring glass Cylinder Set 10ml
Lab grade Local/ Equivalent 1 No. 1
148 Graduated Measuring glass Cylinder Set 50ml,
Lab grade Local/ Equivalent 1 No. 2
149 Graduated Measuring glass Cylinder Set 5ml
Lab grade Local/ Equivalent 1 set 1
150 Graduated Plastic Cylinder (500 ml)
Commercial Local/ Equivalent 1 Piece 5
151 Gram Staining Kit (Set Of WSG0001,02,03,04)
4 x 1litre Sigma/Equivalent 1 Nos. 1
152 HCL Lab Grade Local/ Equivalent 2.5 L 8
153 Head and neck Head and neck Local/ Equivalent 1 Nos. 1
154 Heart middle jumbo size Heart middle jumbo size
Local/ Equivalent 1 Nos. 1
155 Heart model life size Heart model life size
Local/ Equivalent 1 Nos. 1
156 Heavy-duty Heat-insulated Gloves
Suitable to handle autoclaved/boiling liquid
Local/ Equivalent 2/pair 1
157 Hematoxylin Lab Grade Local/ Equivalent 25 g 2
158 High quality plastic test tube spice rack/stand
Lab grade Local/ Equivalent 1 No. 1
159 Histidine L-histidine, Purity: 99%, lab grade
Local/ Equivalent 25g/pack 1
160 Histology slide set of 100 slides Carolina marked
Histology slide set of 100 slides Carolina marked
USA/equivakent 1 Nos. 1
161 HNO3 Laboratory use Sigma/Equivalent 2.5L 1
162 Human skeleton full size Human skeleton full size
Local/ Equivalent 1 Nos. 1
163 Hydrofluoric acid Laboratory use Sigma/Equivalent 500 mL 1
164 Hydrogen Peroxide Lab Grade Local/ Equivalent 1 L 8
165 Indian Ink 95% soultion lab grade
Europe/imported 500ml/pack 1
166 Inj. Adrenaline 1ml Adrenaline 1mg/1ml Ampuole
Local/ Equivalent 100 ampoules/box
1
167 Inj. Amoxicilline Trihydrate
150 mg Amoxycillin base per ml
Local/ Equivalent 1 Nos. 5
168 Inj. Atropine 25ml vial
Atropine Sulphate(BP) 1mg/ml injection for IV,IM and SC use in 25ml vial
Local/ Equivalent 1 Nos.
20
169 Inj. CaC 10ml Local/ Equivalent 1 Nos.
45
170 Inj. Diazepam (valium) 1ml
Diazepam 10mg/2ml Ampoule
Local/ Equivalent 1 Nos.
20
171 Inj. Enro 20% 100ml Local/ Equivalent 1 Nos. 5
172 Inj. Gentafer 100 ml Local/ Equivalent 1 Nos. 7
173 Inj. Ketamine 50mg/ml 10 ml
Ketamine HCL 500mg/10ml vial
Local/ Equivalent 1 Nos.
20
174 Inj. Ketoject
Ketoprofen BP 100mg/ml, 100ml vial Injection for IV,IM and SC use
Local/ Equivalent 1 Nos.
21
175 Inj. Lignocaine 2% (50ml vial)
Lignocaine HCl 2% w/v per ml in 50ml packaging
Local/ Equivalent 1 Nos.
20
176 Inj. Milfone C 300ml Local/ Equivalent 1 Nos. 5
177 Inj. Nugmentin 100 ml Local/ Equivalent 1 Nos. 8
178 Inj. Oxytocin 50 ml Local/ Equivalent 1 Nos. 5
179 Inj. Prostenol 10ml Local/ Equivalent 1 Nos. 2
180 Inj. Xylazine 20mg/ml 25ml vial
Inj. Xylazine 20mg/ml 25ml vial
Local/ Equivalent 1 Nos. 4
181 Iodine (I2) 99.99% Local/ Equivalent 100 g 1
182 Isoamyl alcohol Labortary grade BDH/Equivalent 2.5 lit 1
183 Isopropanol Lab grade Local/ Equivalent 2.5liter/pack
2
184 Ketamine Lab Grade Local/ Equivalent 1 Vial 4
185 Kidney model Kidney model Local/ Equivalent 1 Nos. 1
186 Kjeldahl flasks Lab use Local/ Equivalent 1 Nos. 4
187 KMnO4 Analytical grade Sigma/Equivalent 25g 4
188 KOH Analytical grade Sigma/Equivalent 1Kg 2
189 Kovac’s reagent
Lab grade/For detecting the indole and identifying the indole-positive and indole-negative microorganisms.
Local/ Equivalent 100ml/pack 1
190 Laboratory-grade Snood Caps
Polyester taffeta and grid fabric "shower-style" cap having full elastic enclosure
Local/ Equivalent 500/pack 1
191 Lactophenol Cotton Blue Lab grade Local/ Equivalent 100ml/pack 1
192 Ladder/Marker (100bp) Molecular analysis USA/equivakent 500 ul 1
193 Lemon Flavor Food grade BDH/Equivalent 500 mL 1
194 Levofloxacin (LVX) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
195 Lignocaine Gell 30 g Local/ Equivalent 1 Nos.
10
196 Liquid Parafin 450 ml Local/ Equivalent 1 Nos.
50
197 Liquid Soap 1 litre/ Bottle Dettol/Equivalent 1 Nos. 3
198 Lithium Chloride L4408 Sigma/equivalent 100g 1
199 Liver model Liver model Local/ Equivalent 1 Nos. 1
200 Loeffler stain 95% soultion lab grade
European grade/imported
500ml/pack 1
201 Loose bones complete skeleton
Loose bones complete skeleton
Local/ Equivalent 1 Set 1
202 Lower limb 13 parts muscle
Lower limb 13 parts muscle
Local/ Equivalent 1Nos. 1
203 Lugols Iodine 30 ml Local/ Equivalent 1Nos. 5
204 MacConkey-Sorbitol Agar
Lab grade Local/ Equivalent 500 g 1
205 Magnesium chloride M8266 Sigma/Equivalent 100 g 1
206 Malachite Green Lab grade Local/ Equivalent 25 g
1
207 Mallein reagent Lab grade Local/ Equivalent 5ml/vial 3
208 Measuring cylinder 25 ml Pyrex/Equivalent 1 Nos. 2
209 Mercury (II) iodide (HgI2) 99% Sigma/Equivalent 50 g 1
210 Metal test tube rack/stand Stainless steel
For 15ml falcon tubes
Local/ Equivalent 1 Nos. 2
211 Methanol Absolute BDH/Equivalent 2.5 Liters 5
212 Methyl Alcohol commercial
10 Litre Scharlau/ Equivalent 10 Litre 1
213 Methylated Spirit
For routine disinfection of laboratory surfaces, commercial grade
Local/ Equivalent 2.5liter/pack 7
214 Methylene Blue Trihydrate 97% GR
Lab grade Local/ Equivalent 25g/pack 1
215 Methylene Blue stain Liquid Form BDH/Equivalent 1 Liter 1
216 MgSO4 1kg Scharlau/ Equivalent 1 kg 2
217 Micropipette Tips (50 ul) 500 pcs/pack
Lab grade Local/ Equivalent 01 pack 1
218 Microtitration plates 96 well U-bottom
Lab grade Local/ Equivalent 1 plate
70
219 Modified starch (corn starch octemyl sucinic anhydride )
Food grade Local/ Equivalent 1 kg 1
220 Mueller Hinton agar (MHA)
Lab grade Sigma/Equivalent 500 g 1
221 NaOH 1kg Sigma/Equivalent 1kg 4
222 Naphthalene Laboratory use Sigma/Equivalent 500 g 1
223 Needles 16 (1.5 inches) 10 pcs/ pack Local/ Equivalent 1 Nos. 1
224 Needles 18 G (0.75 inches)
10 pcs/ pack Local/ Equivalent 1 Nos. 1
225 Needles 18 G (1.5 inches)
10 pcs/ pack Local/ Equivalent 1 Nos. 1
226 Neostigmine methyl sulphate
N2126 Sigma/Equivalent 500 mg 1
227 Ninhydrin Laboratory use Sigma/Equivalent 25 g 1
228 Nitric acid Laboratory use Sigma/Equivalent 2.5 L 4
229 Nobel Agar Lab grade Local/ Equivalent 500 gm 1
230 Normal Saline 1000ml Local/ Equivalent 1 Nos.
70
231 Nutrient Agar Lab grade Local/ Equivalent 500g/pack 1
232 Nutrient broth
Fine powder form suitable to prepare broth culture media for bacteria
Local/ Equivalent 500g/pack 1
233 Ofloxacin (OFX) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
234 Orange flavor Food grade Local/ Equivalent 500 mL 1
235 Oxoid Cephradine (CE) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
236 Oxoid Tylosin (TY) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
237 Oxyrase packs for anaerobic culture
Lab grade Europe/equivalent 1 pack 1
238 Oxytetracycline (T) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
239 Paraffin Wax Lab grade Europe/equivalent 2 kg 3
240 Paraffin-sealing film
width 50mm and length 70M, Extendable to seal petri plates/microfuge tubes to avoid leakage/spillage of culture/biological material
Local/ Equivalent 1 roll 1
241 Pathology specimens slides (50) set
Histopathology lessions
Europe/equivalent 50 per set 1
242 Penicillin (PEN) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
243 Perchloric acid Laboratory use Sigma/Equivalent 500 mL 2
244 Petri dish (large ) Commercial Local/ Equivalent Box (10 pieces/pack)
11
245 Phenol Lab grade Local/ Equivalent 25 g 1
246 Phenolphthalein Laboratory use Sigma/Equivalent 25 g 1
247 Phenyl Lab Grade Local/ Equivalent 1 L
12
248 Phosphate buffered saline tablets
Lab grade Local/ Equivalent 100 tab/pack 2
249 Pipette 10 ml, lab use Local/ Equivalent 1 Nos.
20
250 Pipette filler Lab grade Local/ Equivalent 1 Nos. 2
251 Pistachio Oil Food grade Local/ Equivalent 20 mL 1
252 Plain Glass Slides Box of 50 Pieces Local/ Equivalent 1 Nos. 5
253 Plastic centrifuge tubes 15mL
Lab grade/conical bottom
Local/ Equivalent 100/pack 1
254 Plastic wash bottle for laboratory, 250 mL
Lab grade Local/ Equivalent 1 Nos. 2
255 Polymyxin B (PB) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/ Equivalent 50 discs/cartridge
2
256 Polypropylene USP 1 china
Polypropylene suture-Suture gauge : USP 1 with 75cm suture length and 1/2 circle reverse cutting needle (prolene)
Local/ Equivalent 12pcs/box 1
257 Polythene hand gloves, Large size 50 pairs/pack
Lab grade Local/ Equivalent 1 pack 1
258 Pop Bandage
Gypsona POP Bandage Size: 4inch, Colour: White
Local/ Equivalent 1 Nos.
12
259 Pot. Hydrogen Phthalate Laboratory use Sigma/Equivalent 25 gram 1
260 Potassium chloride (KCl) Lab grade Europe/equivalent 1kg/pack 2
261 Potassium dichromate Lab Grade Local/ Equivalent 500 gm 1
262 Potassium hydrogen phosphate
Lab Grade Local/ Equivalent 1 kg 1
263 Potassium hydroxide (KOH)
Lab grade Europe/equivalent 1kg/pack 2
264 Potassium iodide (KI) > 99.0 % Europe/equivalent 100 g 2
265 Potassium oxalate Laboratory use Europe/equivalent 1 kg 1
266 Potassium Sodium Tartrate
Lab grade Europe/equivalent 1kg 1
267 Potassium sulphate Lab grade Europe/equivalent 1 kg 7
268 Proteinase K Molecular analysis USA/equivakent 100 mg 1
269 pTZ vector
TA cloning vector having restriction sites for enzymes to produce sticky ends
Europe/equivalent 50ul/vial 2
270 Purified Oil of turpentine Lab grade Sigma/Equivalent 1.00 L 1
271 Pyodine Solution 450ml/Bottle Local/equivalent 1 Nos.
48
272 Blood DNA extraction kit (50 samples)
Labortary use Qiagen/equivalent 1 kit 2
273 R2A culture media
Fine powder form suitable to prepare culture media to support growth of tedius bacteria
Local/equivalent 500g/pack 1
274 Rack for 10µl Tips Autoclavabel rack with cover to place tips of 10ul volume
Local/equivalent 1 rack
15
275 Rack for 100µl Tips
Autoclavabel rack with cover to place tips of 100ul volume
Local/equivalent 2 rack
15
276 Rack for 1000µl Tips
Autoclavabel rack with cover to place tips of 1000ul volume
Local/equivalent 3 rack
15
277 Racks for Microfuge test tube (Eppendorf) 1.5ml
24 wells lab use double side PCR 1.5ml centrifuge test tubes rack
Local/equivalent 1 rack
15
278 Random hexamer primer 20X sufficient to synthesize cDNA from RNA
Europe/equivalent 50ul/vial 1
279 RBPT reagent for diagnosis of Brucella
Lab grade Local/equivalent 100 samples/vial 6
280 Rectal Palpation Gloves (Geentech)
100 pcs/pack Geentech/equivalent 1 Nos.
24
281 Restriction enzymes and NEBuffers
Molecular Labortary use
Biolabs/Equivalent 1 Vial 1
282 Reverse transcriptase enzyme
enzyme to synthesize cDNA from RNA
Europe/equivalent 100 U/vial 1
283 Rope for restraining 50 feet Local/equivalent 1 Nos. 1
284 Safranine Lab grade Local/equivalent 25g/pack 1
285 Salicyclic acid 99+% Sigma/Equivalent 100 g 1
286 Salinite broth
Fine powder form suitable to prepare culture media to support growth of salmonella
Local/equivalent 500g/pack 1
287 Sanitizer
Lab grade quality to kill pathogens/microbes present on skin
Local/equivalent 1 No.
13
288 Saturated ammonium oxalate
Local/equivalent 100grams 1
289 Scalpel Blades 4.No Lab grade Local/equivalent 100 pcs/pack 7
290 Silver Nitrate Imported Local/equivalent 25 Gram
1
291 Skull with veins and numbering and brosher
Skull with veins and numbering and brosher
Local/equivalent 1 Nos. 1
292 Slide boxes For storing 100 slides in a box
Local/equivalent 1 No. 7
293 Soap Lab Grade Local/equivalent 1 Kg 5
294 Sodan Block B Lab grade Sigma/equvalint 25 gm 1
295 Sodium benzoate Lab grade Korea/Equivalent 1 kg 1
296 Sodium carbonate Laboratory use Sigma/Equivalent 1 kg 1
297 Sodium chloride Lab Grade Standard Equipment Company
1 Kg
30
298 Sodium citrate Laboratory use Sigma/Equivalent 1 kg 1
299 Sodium Dehydroge Phosphate
Lab grade Sigma/equvalint 1 kg 2
300 Sodium Dodecyl Sulphate (SDS)
Solid Powder form for preparing Protein gel solutions
Local/equivalent 1kg/pack 2
301 Sodium hydroxide (NaOH)
Laboratory use BDH/Equivalent 1 kg 2
302 Sodium Hypochlorite solution
425044 Sigma/Equivalent 250 ml 1
303 Sodium lauryl sulphate Laboratory use Local/equivalent 1 kg 3
304 Sodium metasulphite (sodium bi sulphite)
Laboratory use Local/equivalent 1 kg 1
305 Sodium Nitroprusside Laboratory use Sigma/Equivalent 100g 2
306 Sodium Phosphate dibasic
Laboratory use Sigma/Equivalent 1kg 1
307 Sodium Phosphate Monobasic
Laboratory use Sigma/Equivalent 1kg 1
308 Sodium sulphite Laboratory use Local/equivalent 1 kg 2
309 Sodium tetra borate Laboratory use Local/equivalent 1 kg 2
310 Sodium thiocyanate Laboratory use Sigma/Equivalent 1 kg 1
311 Sodium thiosulfate Laboratory use Sigma/Equivalent 1 kg 1
312 Sorbitol 1kg Local/equivalent 1kg 1
313 Spirit Lamp Labortary use Local/equivalent 1 Nos.
11
314 Spray bottles
Refillable, leak proof, non-clogging nozzle sutable to produce mist spray
Local/equivalent 1 Nos. 7
315 Starch and related complex polysaccharides
Labortary use Sigma/equivalent 500g 5
316 Sterile pipettes (20 ml) Cell-culture grade disposable
Local/equivalent 200/pack 1
317 Human Stomach Human Stomach model plastic
Local/equivalent 1 Nos. 1
318 Strawberry flavor Food grade BDH/Equivalent 500 mL 1
319 Streptomycin (S) Antibiotic Disk cartridge
lab grade suitable for antibiotic sensitivity testing
Local/equivalent 50 discs/cartridge
3
320 Streptomycin (S) Antibiotic Disks
Lab grade Local/equivalent 50 disks/ pack 1
321 Succinic acid Laboratory use Sigma/Equivalent 500 g 1
322 Sulfbactam (SCF) cartridge
lab grade suitable for antibiotic sensitivity testing
Local/equivalent 50 discs/cartridge
2
323 Sulfuric acid (H2SO4) lab grade Local/equivalent 2.5 liters
12
324 Sulphur (S) 99.80% Sigma/Equivalent 1.00 kg 1
325 Surgical cap
Green, non-woven, soft texture, elsticated, dustproof
Local/equivalent 50pcs/1 pack 5
326 Surgical Mask
Blue, 3 ply 75 GSM Dispossable Surgical Mask With Melt Blown Fabric Layer and nose pin
Local/equivalent 50pcs/1 pack 6
327 Syringes (5 ml) Commercial Local/equivalent 1 piece
150
328
Taq polymerase (500U/100μl each) supplied with ready to use MgCl2 and PCR-buffer
Taq enzyme supplied with MgCl2 and PCR buffer
Local/equivalent 500units/vial 2
329 Technical Agar agar Lab grade Local/equivalent 500g/pack 1
330 Teflon comb for SDS assembly (10-lane; a0.75 mm)
10 lane Teflon comb
Local/equivalent 1 Nos. 1
331 TEMED (Tetramethyl-ethylene-diamine)
Solid Powder form for preparing prtein gel/buffer solutions
Local/equivalent 100g/pack 1
332 Tert-butylhydroquinone Analytical Local/equivalent 5 g 1
333 Thioglycolate broth
Fine powder form suitable to prepare culture media to support growth of tedius bacteria
Local/equivalent 500g/pack 1
334 Tincture iodine 450 ml
Tincture Iodine USP (Methylated) 450 ml liquid, iodine B.P 5% and Pot. Iodide B.P 10%
Local/equivalent 1 Nos. 5
335 Tissue casets Lab grade Local/equivalent 500 pcs/pack 1
336 Tissue molds Lab grade Local/equivalent 1 pc steel
25
337 Tissue rings Lab grade Local/equivalent 500 pcs/pack 1
338 Tissue Roll Lab grade Local/equivalent 1 Pack
30
339 Tissue towels For surface cleaning/disinfection
Local/equivalent 1roll
10
340 Torso china good Torso china good Local/equivalent 1 Nos. 1
341 Transparent Vacuum Packaging Bags
Multivac 200X300X90 Microns, Multivac 350X450X90 Microns
Local/equivalent 1000 pieces per size
2
342 Trichloroacetic acid (TCA)
Local/equivalent 500 grams 1
343 Tris base Lab Grade Local/equivalent 500 g 1
344 Tris-HCl Solid Powder form for preparing buffer solutions
Local/equivalent 500g/pack 1
345 Trisodium citric dehydrate
Lab Grade Local/equivalent 1 Kg 1
346 Trizol
suitable quality for denaturation of proteins during genomic extraction
Local/equivalent 500ml/pack 1
347 Trypsin Cell-culture grade disposable, for cell passaging
Local/equivalent 100ml/pack 1
348 Tuberculin (mammalian) reagent
Lab grade Local/equivalent 5ml/vial 3
349 Ultrasound Gel (Thick US Grade)
5 L/ Bottle Local/equivalent 1Nos. 8
350 Universal primer 28S for fungus identification
Lyophilized primers for identification of fungus pair of 46 bases
Local/equivalent 23bases/primer 2
351 Upper limb muscle 7 parts with veins and numbering and brosher
Upper limb muscle 7 parts with veins and numbering and brosher
Local/equivalent 1Nos. 1
352 Urea fertilizer commercial Local/equivalent 50kg bag 1
353 Urea lab grade extra Lab grade extra Local/equivalent 500 grams
pure pure 1
354 Urease Medium
Fine powder form suitable to prepare culture media to support growth of tedius bacteria
Local/equivalent 100g/pack 1
355 UV-protection transparent face hield
Effective to filter out UV rays and avoid exposure to UV light while working in laboratory settings, Anti-UV, Anti-Fog, Dust-Proof Headband Hat
Local/equivalent 1 unit 2
356 Vacuum containers (plain tube)
Commercial Local/equivalent 1 pack 3
357 Vacuum containers (EDTA tube)
Commercial Local/equivalent 1 pack 3
358 Vancomycin (VA)) Antibiotic Disks cartridge
lab grade suitable for antibiotic sensitivity testing
Local/equivalent 50 discs/cartridge
2
359 Vaseline 1 Sigma/Equivalent 1.00 kg 1
360 Vicryl 2 (china)
Polyglycolic acid suture-Suture gauge : USP 2 with 75cm suture length and 1/2 circle roundbodied needle (polyglycol)
Local/equivalent 12pcs/box 2
361 Virkon-S Disinfectant 5gram tablets
5g Tablets to make 500mls of disinfectant solution/effective against both enevloped and non-enveloped viral pathogens
Local/equivalent 50 tablets of 5g each/pack
2
362 Vitamin A Analytical BDH/Equivalent 250 g 1
363 Vitamin D3 Analytical Local/equivalent 5 g 1
364 Vitamin E Analytical Local/equivalent 500 g 1
365 Vitamin K4 Analytical Local/equivalent 50 g 1
366 Volumetric flasks 1 liter Pyrex/equivalent 1 Nos. 1
367 Volumetric flasks 500 ml Pyrex/equivalent 1 Nos. 2
368 Volumetric flasks 250 ml Pyrex/equivalent 1 Nos. 1
369 Volumetric flasks 100 ml Pyrex/equivalent 1 Nos. 1
370 Wash bottles plastic lab grade Local/equivalent 1 Nos. 2
371 Washing Bleach 5.25–8.25% sodium hypochlorite
Local/equivalent 5 Liters 2
372 Whatman Filter paper Paper 42 no Local/equivalent 1 Pack 3
373 Whatmann No. I Laboratory use Sigma/Equivalent 1 Packets 1
374 Whey protein isolate Food grade Local/equivalent 1 kg 1
375 Wright Stain 1 litre Wellcosol/Equivalent 1 Nos. 2
376 Xylaz Lab Grade Local/equivalent 1 Vial 2
377 Xylazin 20mg/ 50ml Local/equivalent 1 Nos. 5
378 Xylene Lab Grade Local/equivalent 2.5 L 7
379 Xylocaine 20 mg/ml Local/equivalent 1 Nos.
50
380 Yeast Food grade Local/equivalent 500 g 1
381 Yeast Extract–Peptone–Dextrose (YPD) Medium
Lab grade quality for microbiological cultruing
Local/equivalent 500g/pack 1
382 Zeil-Neilsen stain Lab grade Local/equivalent 500 g/pack 1
383 Zinc sulphate powder Lab grade Local/equivalent 1kg/pack 1
384 ZnCl2 analytical grade Sigma/equivalent 1kg 1
385 Distilled water 5 lit 5 liter botel Local/equivalent 1 botel 1
386 California mastitis test Lab use Sigma/Equivalent 1 kit 1
387 Seguvan powder dry powder form Local/equivalent 1 Kg 1
388 Test tube 1Pkt=100 tubes Local/equivalent I packet 1
389 Wooden test tube clamp Lab use Local/equivalent 1 Nos.
10
390 Petri dishes 90 mm autoclaveable
Germany/Equivalent 1 carton (72 pieces)
1
391 Glass beaker 100mL Local/equivalent 1 Nos. 3
392 Calibrated Lactometer (with 14 – 42 graduations)
Local/equivalent 1 Nos. 3
393 Glass cylinder (250mL) Local/equivalent 1 Nos. 3
394 Calibrated Butyrometer For milk measurement
Germany/Equivalent 1 Nos. 3
395 Calibrated Pipette Lab use Local/equivalent 1 Nos. 2
396 Key Stopper Lab use Local/equivalent 1 Nos. 4
397 Pipette 1mL autoclavable Germany/Equivalent 1 Nos. 3
398 Pippete 10 mL autoclavable Germany/Equivalent 1 Nos. 5
399 Pippete sucker bulb type Germany/Equivalent 1 Nos. 3
400 Automatic measure 10.94ml capacity for Sulphuric Acid
Local/ Equivalent 1 Nos. 1
401 0.1 N Sulfuric acid Vial Vial Local/Imported 1 Nos. 1
402 Calibrated thermometer 0 – 110°C UK/ Equivalent 1 Nos. 4
Technical Evaluation Criteria
The Bidders who have duly complied with the Eligibility / Qualification and Evaluation Criteria will be eligible for further processing.
• The Bids which do not conform to the Technical Specifications or Bid conditions or Bids from
the Bidders without adequate capabilities for supply of Goods/Items/Services will be rejected.
• The Eligible/Technically Qualified Bidders will be considered for further evaluation.
• The Technical proposals shall be evaluated by the technical evaluation committee in the light
of following evaluation criteria:
Category Description Points
Legal
(Mandatory)
Certificate of Company/Individual / Firm
Registration/Incorporation under the laws of Pakistan.
Mandatory
Valid Income Tax Registration. Mandatory
Valid General Sales Tax Registration (Status = Active with FBR
as on the date of submission)
Mandatory
Submission of undertaking on legal valid and attested stamp
paper that the firm is not black listed by any of Provincial or
Federal Government Department, Agency, Organization or
autonomous body or Private Sector.
Mandatory
Eligibility
Criteria
Organization anywhere in Pakistan.
Must have 3 Years’ Experience with Principal /
Manufacturer as Authorized Distributor
Mandatory
Compliance to the technical specifications of all items to be
procured.
Mandatory
Minimum 3 Deployment for the same class of Equipment and
similar value of costing of Rs.3.0 M (PO Required) each with
Govt. and Semi Govt.
Departments in last five years
Mandatory
At least 1 year Repair / After Sale Service Satisfactory Certificate
from Semi Government / Government Departments/ public sector
universities (where applicable)
Mandatory
For warranty and after sales support a parts hub/storage facility
should be in Pakistan. (where applicable)
Mandatory
Mandatory Note:
• Verifiable documentary proofs for all above requirements are mandatory.
• Vendor/ Supplier will be responsible for installation and configuration of the supplied
equipment in client environment as per client's requirements (where necessary)
• Brand and Model Number of quoted equipment must be mentioned. (where applicable)
• Technical Brochures of quoted equipment must be attached. (where applicable)
PROCUREMENT OF CHEMICALS & GLASSWARE/PLASTIC WARE
Technical Parameters
Category Description Marks
Relevant Experience
(Max points 15)
3 to 8 years 5
9 to 14 10
15 and above 15
Financial
(Max points 25)
Audited Annual
Turnover
Rs. 1 million 5
Rs. 2 million 10
Rs. 3 Million and above 15
Audited Financial
Reports
For the Past 3 Years 5 (1.67 per year)
Income Tax Returns For the Past 3 Years 5 (1.67 per year)
Relevant Projects in Govt.
public sector university
and Semi Govt.
Departments
(Minimum 03
Projects)
Cost of 3 Projects in the
Past 3 Years
Each project carries 10
Marks
Rs. 3 million and above
30
Human Resource
(Max points 20)
Total Number of
Employees including
minimum 3 Designer /
Professional
0 – 10 10
20 – 30 15
31 and above 20
Company Website Accomplished with Complete Products and
Details
5
At least 1 Repair / After Sale Service Satisfactory Certificate from
Semi Government / Government Departments
5
Note:
• Verifiable documentary proofs for all above requirements are mandatory.
• Vendor/ Supplier will be responsible for transportation and installation of equipment in client
environment as per client's requirements. (where applicable)
• Sample may be provided within 7 working days if required.
top related