tender no.0034 / 2020 bidding documents - punjab

Post on 26-Mar-2022

7 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

Tender No.0034 / 2020

Bidding Documents SPECIAL INSTRUCTIONS

No Cutting erasing is allowed in the Tender bid.

Bid offered strictly in accordance with the bid document will only be accepted.

Only typed bid will be accepted (no hand written)

Bid Security will be accepted in the form of CDR (Call Deposit Receipt)

THIS IS FOR STRICT COMPLIANCE, FAILING WHICH THE RESPECTIVE BID SHALL STAND CANCELLED

Contact Address: Incharge Purchase Cell

University of Veterinary and Animal Sciences,

Sheikh Abdul Qadir Jillani (Outfall Road) Lahore

Tel: 042-99211449, Ext:138

Tel:042-99213650

TERMS & CONDITIONS

IPL No. 8329

1. Please write clearly in the front of Main envelop “Tender number”

2. The tender documents should be in Tape binding shape and attached bidding documents improper manner

and respectively to evaluate the bidding documents

I. Attached bid security

II. Attached copy of deposited challan / tender fee

III. Attached proposal / quotation and write complete detail of tender

IV. Attached copy of NTN, STRN, Professional certificate, active taxpayer list (NTN, STRN)

V. Attached Stamp paper of black listing.

VI. Attached literatures and other helping documents

3. The price of this tender document is Rs.2,000/- (Non Refundable)

4. The Tender complete in all respect along with 1% Bid Security (Refundable) of Estimated Price / Cost in

the shape of only “Call Deposit Receipt” (CDR) in favor of “Treasurer, UVAS”, Lahore should reach in

Purchase Cell by 21-10-2020 at 11:00 a.m in the University of Veterinary & Animal Sciences, Lahore.

5.

Lot

No. Description

Bid Security in

Pak Rupees. (Rs)

01

Procurement of Chemicals & Glassware/Plastic ware under the

Project Establishment of University of Veterinary and Animal Sciences

at Bahawalpur 36000/-

6. The quotations will be opened on 21-10-2020 at 11:30 a.m. in Administration Block, Treasurer Office,

Meeting Room No. 116, 1st Floor, University of Veterinary and Animal Sciences, Lahore.

7. The offered price should be inclusive of all taxes.

8. The rate must be quoted only in Pakistani Rupees

9. Quoted rates must be valid for 120 days

10. No offer shall be considered if it is:

a) Submitted without Tender Document

b) Submitted without Bid Security money.

c) Received after the date and time fixed for the receipt of tenders.

d) Is unsigned

e) Is ambiguous

f) Is conditional

g) Is received by Telegram.

h) Is received with a validity period shorter than the required in the tender enquiry.

i) Does not confirm to general conditions of the enquiry i.e it is not accompanied by sample or

manufacturers literature where required.

j) Is for store materially and substantially different from that required in the tender enquiry.

11. A stamp paper of Rs.50/- will be attached with the bid that the firm is not black listed at PPRA, suspended

or removed in any Government, Semi Government, Autonomous Bodies, Public sector university and any

other Department.

12. In case of warranty 10% amount as security will be deducted from the bills of the firms at the time of

payment and be released after the expiry of warranty period (where applicable).

13. The sample may be provided as & when required by Technical Committee.

14. Applicable Govt. levies will be deducted at source from the bill.

15. The equipment / stores supplied by the bidder shall be brand new, in original manufacturer packing and

complete in all respects. Cost of transportation of supplied equipment / goods to the site of University and

cost of installation and commissioning of equipment shall be the responsibility of the supplier.

16. Supply of material should be made within stipulated period of the Purchase Order positively; in case of

failure the amount of CDR may forfeited and purchase will be made at the risk and cost of the defaulter or

any penalty as per Purchase Rules, 2005 of the University can also be imposed.

17. The buyer shall notify the supplier in writing/through telephone of any defects that occur during the

warranty period. On receipt of such notification/telephonic message the supplier shall attend the breakdown

call within a maximum of 6 working hours.

18. The firm offering prices for supply of machinery and equipment should have sufficient qualified technical

staff and be equipped and having capability to undertake the maintenance or replacement for the equipment

supplied to this University.

19. The bidding documents should be dropped in Tender Box in the office of the Purchase Cell, Room No. 108,

1st Floor, UVAS, Lahore, during five working days till the last date mentioned in tender notice.

20. The successful bidder will submit stamp duty @ 0.25% of the total value of contract / purchase order at the

time of submission of bill to the end user.

21. Bids must be quoted on company’s letter pad duly signed stamped by the bidder

22. The person who will attend the tender meeting as per date mentioned in tender will be compulsory

submitted Authorization letter from individual, firm and company.

23. Delivery time or completion schedule as per requirement of end user.

24. Please attach NTN, GST and professional tax certificates with bidding documents.

25. Please attach the copy of your FBR Active taxpayer serial Number list for the current financial year.

26. Please read, sign all the tender documents, terms and conditions carefully and attached with your bidding

documents.

27. Please clearly mentioned Tender number, company name and address in front of envelop.

28. I or we, solemnly swear (or affirm) participated in UVAS Tendering process that there is no Conflict of

Interest / relations in any shape as well as no direct relationship with University staff, member, employee

and faculty.

29. Any further information if required can be obtained during office hour from 8.00a.m to 4.00 pm

(Monday to Friday) from Purchase Cell, University of Veterinary and Animal Sciences, Lahore

We, M/s. ____________________________ hereby certify that we have read and agreed with all

terms and conditions mentioned above.

Signature: ________________________________

Designation: ________________________________

Dated: ________________________________

Stamp: ________________________________

Incharge Purchase Cell

University of Veterinary and Animal

Sciences, Sheikh Abdul Qadir Jillani

(Outfall Road) Lahore

Tel: 042-99211449, Ext:138

Tel:042-99213650

TENDER DOCUMENTS

Sr# Item Name Specification Company/Origin Pack/Units Qty.

1 (p-nitrophenyl) phosphate sodium salt

N3002 Sigma/Equivalent N3002-100MG 1

2 0.2 ml PCR tubes

sterile/clean transparent suitable for PCR testing

Europe/local 1000/pkt 1

3 0.5 ml PCR tubes

sterile/clean transparent suitable for PCR testing

Europe/local 1000/pkt 1

4 1.5 ml microfuge tubes

sterile/clean transparent suitable for PCR testing

Europe/local 1000/pkt 1

5 10µl-Tips sterile/clean yellow color fine quality/Lab grade

Europe/local 1000/pkt 5

6 100µl-Tips sterile/clean yellow color fine quality/Lab grade

Europe/local 500/pkt 5

7 1000µl-Tips sterile/clean yellow color fine quality/Lab grade

Europe/local 500/pkt 5

8 1-amino 2 naphthol sulphonic acid (ANSA)

Lab grade Europe/local 25 g 1

9 2-Ethoxy ethanol Lab grade Europe/local 500 g 2

10 2XPCR kits Laboratory use Sigma/Equivalent 200 Rxn 2

11 5,5-dithiobis (2-nitrobenzoic acid)

D8130 Sigma/Equivalent 500 mg 1

12 6X Loading dye Molecular analysis Sigma/Equivalent 5 ml 1

13 Acetic acid laboratory grade local/imported 2.5 L/pack 1

14 Acetocarmine Lab grade, slide stain

BDH/Equivalent 100 ml 1

15 Acetone Lab grade local/imported 7.5 L 6

16 Acetyl cholinesterase from electric eel

C3389 Sigma/Equivalent 2000 units 1

17 acetylthiocholine iodide A5751 Sigma/Equivalent 1 g 1

18 Acrylamide-bis acrylamide Mixture

Solid Powder form for preparing SDS gel for protein electrophoresis

local/imported 100g/pack 1

19 Agarose Lab grade local/imported 500g/pack 1

20 AI Rods 25 pcs/ pack Geentech/equivalent 1 Nos. 2

21 AI Sheeths 50 pcs/ pack Geentech/equivalent 1 Nos.

15

22 Alkaline Phosphatase from E. Coli

P5931 Sigma/Equivalent 100 unit/mg 1

23 Almond Oil Food grade Local/Imported 20 mL 1

24 Aluminum foil paper Lab grade local/imported 1 roll 1

25 Amikacin (AN) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

local/equivalent 50 discs/cartridge

2

26 Ammonia Lab grade Merck/equivelent 2.5 L 1

27 Ammonium chloride (NH4Cl)

lab grade Sigma/Equivalent 1.1 kg 4

28 Ammonium molybdate lab grade Sigma/Equivalent 1 kg 1

29 Ammonium per sulphate Solid Powder form for preparing prtein gel/buffer solutions

imported/local 1kg/pack 1

30 Ammonium sulphide solution (S(NH4)2)

Lab grade Sigma/Equivalent 500 ml 1

31 Amoxicillin (AX) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

imported/local 100 discs/cartridge

3

32 Amphotericin B Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

imported/local 50 discs/cartridge

2

33 Ascorbic acid A5960 Sigma/equivalent 100 g 2

34 Auto burrette 10 ml Lab grade imported/local 10 ml 1

35 Autoclavable Glass Petri plates

90x15mm imported/local 100/carton 2

36 Autoclavable Polyester cleanroom Shoe Cover

Light Blue colour, with Soft Tan sole, having Elastic in hem at ankle, Rear snap adjustment, Color coded ribbon at heel, Rugged skid-resistant sole material, Excellent resistance to abrasion

imported/local 500/pack 1

37 Balplex Mannual Syringes

20ml imported/local 1 Nos. 2

38 Barrits reagent

Lab grade/For detecting the indole and identifying the indole-positive and indole-negative microorganisms.

imported/local 100ml/pack 1

39 Beaker 250 ml Pyrex/equivalent 1 Nos. 4

40 Beaker 1000 ml Pyrex/equivalent 1 Nos. 2

41 Beaker 100 ml Pyrex/equivalent 1 Nos. 2

42 Bendages 6 inches imported/ Local 1 Nos.

15

43 Biotin Lab grade imported/ Local 25g/pack 1

44 Bleaching liquid (500 ml) Commercial grade imported/ Local 500ml/pack

10

45 Blood collection tubes (EDTA contain) (5ml)

100 pieces in each pack

imported/ Local 1 pkt 1

46 Blue Nitrile Gloves, Large size, Powder Free 100 pcs/pack

Lab grade imported/ Local 100/pack

30

47 Borax Lab Grade imported/ Local 1 Kg 3

48 Boric acid Labortary grade imported/ Local 1 kg 1

49 Bovine serum albumin satbilize enzymes during biological reactions

imported/ Local 50ul/vial 1

50 Brain Heart Infusion Agar

Fine powder form suitable to prepare culture media to support growth of tedius bacteria

imported/ Local 500g/pack 1

51 Butylated hydroxyl toluene

Analytical imported/ Local 1 kg 1

52 Calcium chloride Lab grade imported/ Local 1kg 2

53 Camphor 96% Sigma/Equivalent 100 g 1

54 Capped Test Tube (Glass) 15 ml fully autoclave able

Lab grade imported/ Local 1 Nos.

10

55 Carbol fuchsin Lab grade imported/ Local 25g/pack 1

56 Carbolic acid Lab Grade imported/ Local 1 Kg 3

57 Cardamom oil Food grade Local/Imported 25 g 1

58 Cetrimonium bromide (CATB)

Lab Grade Sigma/equivalent 500g 1

59 Caustic soda Lab Grade imported/ Local 1 Kg 3

60 Cedar wood oil Lab grade Local/Imported 1000ml/pack 3

61 Cefaclor (CEC) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

Local/Imported 50 discs/cartridge

2

62 Ceftiofur (EFT) Antibiotic Disks cartridge

Lab grade Local/Imported 50discs/cartridge

2

63 Cell culture grade Antibiotic/antimycotic solution

Cell-culture grade mixture with both anti-bacterial and anti-fungal properties/pyrogen free

Europe/local/equivalent

100ml/pack 1

64 Cell culture iscoves modified Dulbecco medium (IMDM)

Cell-culture grade with stable pH and indicator of pH change

Europe/local/equivalent

500ml/pack 1

65 Cement commercial Local 50 kg bag 1

66 Cetyl trimethyl ammonium bromide

Lab grade Local/Imported 500 gms 1

67 China crucibles 25 ml Local/Imported 1 Nos.

18

68 China dishes 35 ml Local/Imported 1 Nos.

24

69 Chitosan 70,000 Dalton Analytical Merk/Equivalent 25 g 1

70 Chlorhexidine Soln. (LP Lon) 1lit

Topical Chlorhexidine Soln. 1.50% Liquid 1000ml

Local/Imported 1L

12

71 Chloroform Lab Grade Local/Imported 2.5 L 9

72 Chromic Acid Lab grade Merck/equivelent 1 kg 1

73 Ciprofloxacin (CIP) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/Imported 50 discs/cartridge

2

74 Colchicine powder form Local/Imported 5 tablets 1

75 Conical flask 1 L Local/Imported 1 Nos. 1

76 Conical flask 500 ml Local/Imported 1 Nos. 1

77 Conical flask 250 ml Local/Imported 1 Nos. 1

78 Conical flask 100 ml Local/Imported 1 Nos. 1

79 Coomassie blue R 100g powder form lab grade

Europe/equivalent 500g/pack 1

80 Copper sulphate Commercial Sigma/Equivalent 1 kg 4

81 Cotton Roles 1 pound Local 1 Nos.

10

82 Cotton roll (0.5kg)

Absorbent Cotton 500gm, 100% hydrophilic cotton purfied, bleached and carded, Suitable for First aid

Local/Imported 1 Nos. 2

83 Cotton Swab sterilized Lab grade Local/Imported 01 Pack 1

84 Cover slips 18x18 mm Lab grade Local/imported 1 Pack

28

85 Crystal Violet Lab grade Local/Imported 25g/pack 1

86 Cu wire (99.99%) Laboratory use Sigma/Equivalent 10gram 1

87 CuSO4.5H2O Lab use Sigma/Equivalent 1kg 3

88 DEPC (Di-ethyl pyrocarbonate) powder or >90% solution

>90% solution with its 1ml used to make 1 liter solution (v/v), suitable to inactivate RNAses in solutions used for RNA extraction

Local/Imported 100ml/pack 1

89 Detergents Lab Grade Local/Imported 1 Kg

10

90 Detol Commercial grade Local/Imported 1 L 5

91 Dextrose 10% 500 ml Local/ Equivalent 1 Nos.

10

92 Dextrose 25% 25 ml Local/ Equivalent 1 Nos.

100

93 Dicalcium phosphate (DCP)

lab grade Local/ Equivalent 1 kg

20

94 Diethyl ether

=98.0% contains ≤2% ethanol and ≤10ppm BHT as inhibitor

Sigma/Equivalent 1.00 L 8

95 Different organ permanent slides

Laboratory use Local/ Equivalent 1 pack 1

96 Disodium hydrogen Phosphate

Lab grade Sigma/equvalint 1 kg 3

97 Disposable Face Masks Face mask suitable for laboratory work

Local/ Equivalent 100/pack

11

98 Dissection box fine quality

complete set including dissecting scissors with with curved and serrated tips with sharp straight points, dissecting scalpel 6" long, 1½" cuting edge, scalpel handle, set

Local/ Equivalent 1 box 3

of forceps, needles, probe, 1 Plastic ruler 6", 1/16" div., millimeter and centimeter

99 DMSO Lab grade Local/ Equivalent 2.5liter/pack 1

100 DP syringes 1 cc Graduated fine quality

Local/ Equivalent 100/pack 3

101 DP syringes 3 cc Graduated fine quality

Local/ Equivalent 100/pack 3

102 DP syringes 5 cc Graduated fine quality

Local/ Equivalent 100/pack 8

103 DPX Lab Grade Local/ Equivalent 500 ml 1

104 Dropper amber bottle Lab grade Local/ Equivalent 1 Nos. 4

105 Ear model Ear model Local/ Equivalent 1 Nos. 1

106 EDTA Lab grade Invitrogen/equavilent 500 gm 5

107 EDTA Blood Collecting Tubes

Lab grade China/imported 1 Pack 2

108 ELISA reagent reservoirs

Sterile high-impact disposable polystyrene reservoirs to facilitate repeated multi-channel pipetting for reagent delivery to microplates.

Local/ Equivalent 100 piece/pack 1

109 Enrofloxacin (ENR) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

110 Eosin Stain powder (yellow)

Lab grade Sigma/Equivalent 500 gm 1

111 Eppendorf tubes (2 ml) 500 pieces in each pack

Imported 1 pkt 1

112 Erythromycin (E) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

3

113 Ethanol 99.80% Sigma/Equivalent 1.00 L

26

114 Ethidium bromide Molecular analysis Europe/Equivalent 1 g 1

115 Examination gloves medium box

Low Protein, Lightly Powdered, Size: Medium

Local/ Equivalent 50pairs/1 pack

12

116 Eye model Eye model Local/ Equivalent 1 Nos.

1

117 Eye-Protection Goggles

specified for laboratory work providing sufficient eyes' safety to aovid spalshes of hazardous material

Local/ Equivalent 1 goggle

10

118 Face Mask Commercial Local/ Equivalent Box (50 pieces/box)

10

119 Face with brain 8 parts Face with brain 8 parts

Local/ Equivalent 1 Nos. 1

120 Ferrous sulphate commercial Local/ Equivalent 1 kg 1

121 Fetal bovine serum

Lab grade, free from fungal/bacterial/viral pathogens

Local/ Equivalent 500ml/pack 1

122 Field Stain A Liquid Form BDH/Equivalent 1 Liter 1

123 Field Stain B Liquid Form BDH/ Equivalent 1 Liter 1

124 Filtration flask Lab grade Local/ Equivalent 500 ml 1

125 Flat top capped Falcon tubes (15 ml)

Graduated fine quality

Local/ Equivalent 50/pack 6

126 Flat top capped Falcon tubes (50 ml)

Graduated fine quality

Local/ Equivalent 50/pack 5

127 Fluorescein isothiocyanate (FITC)

Lab grade Local/ Equivalent 50 mg 1

128 Formaldehyde Lab Grade Local/ Equivalent 2.5 L

29

129 Frosted Glass slides

Clean glass slides frosted at one end suitable for labelling

Local/ Equivalent 50 slides/pack

15

130 Furacine Cream 28 g Local/ Equivalent 1 Nos.

10

131

Fwd: AGGAACTCGGAGTCCATCAC Rev: TGAAGGCCCAGAGGCGGAAC

Primer synthesis Local/ Equivalent 1 package 1

132

Fwd: CGCCTGTTTATCAAAAACAT Rev: CTC CGG TTT GAA CTC AGA TC

Primer synthesis Local/ Equivalent 1 package 1

133

Fwd: CTCTGCCTGCCCTGGACT Rev: GGAGAAGCAGAAGGCAACC

Primer synthesis Local/ Equivalent 1 package 1

134 Giemsa Stain Lab grade BDH/Equivalent 1 liter 3

136 Glass Culture Spreader

For uniform spreading of Clinical/bacterial sample on culture plate

Local/ Equivalent 1/unit

50

137 Glass funnels SEPARATORY FUNNEL WITH GLASS

Local/ Equivalent 1 Nos. 2

138 Glass rods Stirring rod Local/ Equivalent 1 Nos. 5

139 Glass slides Laboratory use Local/ Equivalent 1 Pack

20

140 Glass stain dropper Lab grade Local/ Equivalent 1 Nos. 2

141 Glucose and Fructose Laboratory use Sigma/Equivalent 1 kg 1

142 Glycerin Laboratory use Sigma/Equivalent 2.5 L 7

143 Glycial acetic Acid Lab grade Local/ Equivalent 2.5 L 2

144 Glycine Solid Powder form Lab grade

Local/ Equivalent 1kg/pack 1

145 Graduated Plastic Cylinder (1000 ml)

Commercial Local/ Equivalent 1 Piece 5

146 Graduated Measuring glass Cylinder Set 100ml

Lab grade Local/ Equivalent 1 No. 2

147 Graduated Measuring glass Cylinder Set 10ml

Lab grade Local/ Equivalent 1 No. 1

148 Graduated Measuring glass Cylinder Set 50ml,

Lab grade Local/ Equivalent 1 No. 2

149 Graduated Measuring glass Cylinder Set 5ml

Lab grade Local/ Equivalent 1 set 1

150 Graduated Plastic Cylinder (500 ml)

Commercial Local/ Equivalent 1 Piece 5

151 Gram Staining Kit (Set Of WSG0001,02,03,04)

4 x 1litre Sigma/Equivalent 1 Nos. 1

152 HCL Lab Grade Local/ Equivalent 2.5 L 8

153 Head and neck Head and neck Local/ Equivalent 1 Nos. 1

154 Heart middle jumbo size Heart middle jumbo size

Local/ Equivalent 1 Nos. 1

155 Heart model life size Heart model life size

Local/ Equivalent 1 Nos. 1

156 Heavy-duty Heat-insulated Gloves

Suitable to handle autoclaved/boiling liquid

Local/ Equivalent 2/pair 1

157 Hematoxylin Lab Grade Local/ Equivalent 25 g 2

158 High quality plastic test tube spice rack/stand

Lab grade Local/ Equivalent 1 No. 1

159 Histidine L-histidine, Purity: 99%, lab grade

Local/ Equivalent 25g/pack 1

160 Histology slide set of 100 slides Carolina marked

Histology slide set of 100 slides Carolina marked

USA/equivakent 1 Nos. 1

161 HNO3 Laboratory use Sigma/Equivalent 2.5L 1

162 Human skeleton full size Human skeleton full size

Local/ Equivalent 1 Nos. 1

163 Hydrofluoric acid Laboratory use Sigma/Equivalent 500 mL 1

164 Hydrogen Peroxide Lab Grade Local/ Equivalent 1 L 8

165 Indian Ink 95% soultion lab grade

Europe/imported 500ml/pack 1

166 Inj. Adrenaline 1ml Adrenaline 1mg/1ml Ampuole

Local/ Equivalent 100 ampoules/box

1

167 Inj. Amoxicilline Trihydrate

150 mg Amoxycillin base per ml

Local/ Equivalent 1 Nos. 5

168 Inj. Atropine 25ml vial

Atropine Sulphate(BP) 1mg/ml injection for IV,IM and SC use in 25ml vial

Local/ Equivalent 1 Nos.

20

169 Inj. CaC 10ml Local/ Equivalent 1 Nos.

45

170 Inj. Diazepam (valium) 1ml

Diazepam 10mg/2ml Ampoule

Local/ Equivalent 1 Nos.

20

171 Inj. Enro 20% 100ml Local/ Equivalent 1 Nos. 5

172 Inj. Gentafer 100 ml Local/ Equivalent 1 Nos. 7

173 Inj. Ketamine 50mg/ml 10 ml

Ketamine HCL 500mg/10ml vial

Local/ Equivalent 1 Nos.

20

174 Inj. Ketoject

Ketoprofen BP 100mg/ml, 100ml vial Injection for IV,IM and SC use

Local/ Equivalent 1 Nos.

21

175 Inj. Lignocaine 2% (50ml vial)

Lignocaine HCl 2% w/v per ml in 50ml packaging

Local/ Equivalent 1 Nos.

20

176 Inj. Milfone C 300ml Local/ Equivalent 1 Nos. 5

177 Inj. Nugmentin 100 ml Local/ Equivalent 1 Nos. 8

178 Inj. Oxytocin 50 ml Local/ Equivalent 1 Nos. 5

179 Inj. Prostenol 10ml Local/ Equivalent 1 Nos. 2

180 Inj. Xylazine 20mg/ml 25ml vial

Inj. Xylazine 20mg/ml 25ml vial

Local/ Equivalent 1 Nos. 4

181 Iodine (I2) 99.99% Local/ Equivalent 100 g 1

182 Isoamyl alcohol Labortary grade BDH/Equivalent 2.5 lit 1

183 Isopropanol Lab grade Local/ Equivalent 2.5liter/pack

2

184 Ketamine Lab Grade Local/ Equivalent 1 Vial 4

185 Kidney model Kidney model Local/ Equivalent 1 Nos. 1

186 Kjeldahl flasks Lab use Local/ Equivalent 1 Nos. 4

187 KMnO4 Analytical grade Sigma/Equivalent 25g 4

188 KOH Analytical grade Sigma/Equivalent 1Kg 2

189 Kovac’s reagent

Lab grade/For detecting the indole and identifying the indole-positive and indole-negative microorganisms.

Local/ Equivalent 100ml/pack 1

190 Laboratory-grade Snood Caps

Polyester taffeta and grid fabric "shower-style" cap having full elastic enclosure

Local/ Equivalent 500/pack 1

191 Lactophenol Cotton Blue Lab grade Local/ Equivalent 100ml/pack 1

192 Ladder/Marker (100bp) Molecular analysis USA/equivakent 500 ul 1

193 Lemon Flavor Food grade BDH/Equivalent 500 mL 1

194 Levofloxacin (LVX) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

195 Lignocaine Gell 30 g Local/ Equivalent 1 Nos.

10

196 Liquid Parafin 450 ml Local/ Equivalent 1 Nos.

50

197 Liquid Soap 1 litre/ Bottle Dettol/Equivalent 1 Nos. 3

198 Lithium Chloride L4408 Sigma/equivalent 100g 1

199 Liver model Liver model Local/ Equivalent 1 Nos. 1

200 Loeffler stain 95% soultion lab grade

European grade/imported

500ml/pack 1

201 Loose bones complete skeleton

Loose bones complete skeleton

Local/ Equivalent 1 Set 1

202 Lower limb 13 parts muscle

Lower limb 13 parts muscle

Local/ Equivalent 1Nos. 1

203 Lugols Iodine 30 ml Local/ Equivalent 1Nos. 5

204 MacConkey-Sorbitol Agar

Lab grade Local/ Equivalent 500 g 1

205 Magnesium chloride M8266 Sigma/Equivalent 100 g 1

206 Malachite Green Lab grade Local/ Equivalent 25 g

1

207 Mallein reagent Lab grade Local/ Equivalent 5ml/vial 3

208 Measuring cylinder 25 ml Pyrex/Equivalent 1 Nos. 2

209 Mercury (II) iodide (HgI2) 99% Sigma/Equivalent 50 g 1

210 Metal test tube rack/stand Stainless steel

For 15ml falcon tubes

Local/ Equivalent 1 Nos. 2

211 Methanol Absolute BDH/Equivalent 2.5 Liters 5

212 Methyl Alcohol commercial

10 Litre Scharlau/ Equivalent 10 Litre 1

213 Methylated Spirit

For routine disinfection of laboratory surfaces, commercial grade

Local/ Equivalent 2.5liter/pack 7

214 Methylene Blue Trihydrate 97% GR

Lab grade Local/ Equivalent 25g/pack 1

215 Methylene Blue stain Liquid Form BDH/Equivalent 1 Liter 1

216 MgSO4 1kg Scharlau/ Equivalent 1 kg 2

217 Micropipette Tips (50 ul) 500 pcs/pack

Lab grade Local/ Equivalent 01 pack 1

218 Microtitration plates 96 well U-bottom

Lab grade Local/ Equivalent 1 plate

70

219 Modified starch (corn starch octemyl sucinic anhydride )

Food grade Local/ Equivalent 1 kg 1

220 Mueller Hinton agar (MHA)

Lab grade Sigma/Equivalent 500 g 1

221 NaOH 1kg Sigma/Equivalent 1kg 4

222 Naphthalene Laboratory use Sigma/Equivalent 500 g 1

223 Needles 16 (1.5 inches) 10 pcs/ pack Local/ Equivalent 1 Nos. 1

224 Needles 18 G (0.75 inches)

10 pcs/ pack Local/ Equivalent 1 Nos. 1

225 Needles 18 G (1.5 inches)

10 pcs/ pack Local/ Equivalent 1 Nos. 1

226 Neostigmine methyl sulphate

N2126 Sigma/Equivalent 500 mg 1

227 Ninhydrin Laboratory use Sigma/Equivalent 25 g 1

228 Nitric acid Laboratory use Sigma/Equivalent 2.5 L 4

229 Nobel Agar Lab grade Local/ Equivalent 500 gm 1

230 Normal Saline 1000ml Local/ Equivalent 1 Nos.

70

231 Nutrient Agar Lab grade Local/ Equivalent 500g/pack 1

232 Nutrient broth

Fine powder form suitable to prepare broth culture media for bacteria

Local/ Equivalent 500g/pack 1

233 Ofloxacin (OFX) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

234 Orange flavor Food grade Local/ Equivalent 500 mL 1

235 Oxoid Cephradine (CE) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

236 Oxoid Tylosin (TY) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

237 Oxyrase packs for anaerobic culture

Lab grade Europe/equivalent 1 pack 1

238 Oxytetracycline (T) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

239 Paraffin Wax Lab grade Europe/equivalent 2 kg 3

240 Paraffin-sealing film

width 50mm and length 70M, Extendable to seal petri plates/microfuge tubes to avoid leakage/spillage of culture/biological material

Local/ Equivalent 1 roll 1

241 Pathology specimens slides (50) set

Histopathology lessions

Europe/equivalent 50 per set 1

242 Penicillin (PEN) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

243 Perchloric acid Laboratory use Sigma/Equivalent 500 mL 2

244 Petri dish (large ) Commercial Local/ Equivalent Box (10 pieces/pack)

11

245 Phenol Lab grade Local/ Equivalent 25 g 1

246 Phenolphthalein Laboratory use Sigma/Equivalent 25 g 1

247 Phenyl Lab Grade Local/ Equivalent 1 L

12

248 Phosphate buffered saline tablets

Lab grade Local/ Equivalent 100 tab/pack 2

249 Pipette 10 ml, lab use Local/ Equivalent 1 Nos.

20

250 Pipette filler Lab grade Local/ Equivalent 1 Nos. 2

251 Pistachio Oil Food grade Local/ Equivalent 20 mL 1

252 Plain Glass Slides Box of 50 Pieces Local/ Equivalent 1 Nos. 5

253 Plastic centrifuge tubes 15mL

Lab grade/conical bottom

Local/ Equivalent 100/pack 1

254 Plastic wash bottle for laboratory, 250 mL

Lab grade Local/ Equivalent 1 Nos. 2

255 Polymyxin B (PB) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/ Equivalent 50 discs/cartridge

2

256 Polypropylene USP 1 china

Polypropylene suture-Suture gauge : USP 1 with 75cm suture length and 1/2 circle reverse cutting needle (prolene)

Local/ Equivalent 12pcs/box 1

257 Polythene hand gloves, Large size 50 pairs/pack

Lab grade Local/ Equivalent 1 pack 1

258 Pop Bandage

Gypsona POP Bandage Size: 4inch, Colour: White

Local/ Equivalent 1 Nos.

12

259 Pot. Hydrogen Phthalate Laboratory use Sigma/Equivalent 25 gram 1

260 Potassium chloride (KCl) Lab grade Europe/equivalent 1kg/pack 2

261 Potassium dichromate Lab Grade Local/ Equivalent 500 gm 1

262 Potassium hydrogen phosphate

Lab Grade Local/ Equivalent 1 kg 1

263 Potassium hydroxide (KOH)

Lab grade Europe/equivalent 1kg/pack 2

264 Potassium iodide (KI) > 99.0 % Europe/equivalent 100 g 2

265 Potassium oxalate Laboratory use Europe/equivalent 1 kg 1

266 Potassium Sodium Tartrate

Lab grade Europe/equivalent 1kg 1

267 Potassium sulphate Lab grade Europe/equivalent 1 kg 7

268 Proteinase K Molecular analysis USA/equivakent 100 mg 1

269 pTZ vector

TA cloning vector having restriction sites for enzymes to produce sticky ends

Europe/equivalent 50ul/vial 2

270 Purified Oil of turpentine Lab grade Sigma/Equivalent 1.00 L 1

271 Pyodine Solution 450ml/Bottle Local/equivalent 1 Nos.

48

272 Blood DNA extraction kit (50 samples)

Labortary use Qiagen/equivalent 1 kit 2

273 R2A culture media

Fine powder form suitable to prepare culture media to support growth of tedius bacteria

Local/equivalent 500g/pack 1

274 Rack for 10µl Tips Autoclavabel rack with cover to place tips of 10ul volume

Local/equivalent 1 rack

15

275 Rack for 100µl Tips

Autoclavabel rack with cover to place tips of 100ul volume

Local/equivalent 2 rack

15

276 Rack for 1000µl Tips

Autoclavabel rack with cover to place tips of 1000ul volume

Local/equivalent 3 rack

15

277 Racks for Microfuge test tube (Eppendorf) 1.5ml

24 wells lab use double side PCR 1.5ml centrifuge test tubes rack

Local/equivalent 1 rack

15

278 Random hexamer primer 20X sufficient to synthesize cDNA from RNA

Europe/equivalent 50ul/vial 1

279 RBPT reagent for diagnosis of Brucella

Lab grade Local/equivalent 100 samples/vial 6

280 Rectal Palpation Gloves (Geentech)

100 pcs/pack Geentech/equivalent 1 Nos.

24

281 Restriction enzymes and NEBuffers

Molecular Labortary use

Biolabs/Equivalent 1 Vial 1

282 Reverse transcriptase enzyme

enzyme to synthesize cDNA from RNA

Europe/equivalent 100 U/vial 1

283 Rope for restraining 50 feet Local/equivalent 1 Nos. 1

284 Safranine Lab grade Local/equivalent 25g/pack 1

285 Salicyclic acid 99+% Sigma/Equivalent 100 g 1

286 Salinite broth

Fine powder form suitable to prepare culture media to support growth of salmonella

Local/equivalent 500g/pack 1

287 Sanitizer

Lab grade quality to kill pathogens/microbes present on skin

Local/equivalent 1 No.

13

288 Saturated ammonium oxalate

Local/equivalent 100grams 1

289 Scalpel Blades 4.No Lab grade Local/equivalent 100 pcs/pack 7

290 Silver Nitrate Imported Local/equivalent 25 Gram

1

291 Skull with veins and numbering and brosher

Skull with veins and numbering and brosher

Local/equivalent 1 Nos. 1

292 Slide boxes For storing 100 slides in a box

Local/equivalent 1 No. 7

293 Soap Lab Grade Local/equivalent 1 Kg 5

294 Sodan Block B Lab grade Sigma/equvalint 25 gm 1

295 Sodium benzoate Lab grade Korea/Equivalent 1 kg 1

296 Sodium carbonate Laboratory use Sigma/Equivalent 1 kg 1

297 Sodium chloride Lab Grade Standard Equipment Company

1 Kg

30

298 Sodium citrate Laboratory use Sigma/Equivalent 1 kg 1

299 Sodium Dehydroge Phosphate

Lab grade Sigma/equvalint 1 kg 2

300 Sodium Dodecyl Sulphate (SDS)

Solid Powder form for preparing Protein gel solutions

Local/equivalent 1kg/pack 2

301 Sodium hydroxide (NaOH)

Laboratory use BDH/Equivalent 1 kg 2

302 Sodium Hypochlorite solution

425044 Sigma/Equivalent 250 ml 1

303 Sodium lauryl sulphate Laboratory use Local/equivalent 1 kg 3

304 Sodium metasulphite (sodium bi sulphite)

Laboratory use Local/equivalent 1 kg 1

305 Sodium Nitroprusside Laboratory use Sigma/Equivalent 100g 2

306 Sodium Phosphate dibasic

Laboratory use Sigma/Equivalent 1kg 1

307 Sodium Phosphate Monobasic

Laboratory use Sigma/Equivalent 1kg 1

308 Sodium sulphite Laboratory use Local/equivalent 1 kg 2

309 Sodium tetra borate Laboratory use Local/equivalent 1 kg 2

310 Sodium thiocyanate Laboratory use Sigma/Equivalent 1 kg 1

311 Sodium thiosulfate Laboratory use Sigma/Equivalent 1 kg 1

312 Sorbitol 1kg Local/equivalent 1kg 1

313 Spirit Lamp Labortary use Local/equivalent 1 Nos.

11

314 Spray bottles

Refillable, leak proof, non-clogging nozzle sutable to produce mist spray

Local/equivalent 1 Nos. 7

315 Starch and related complex polysaccharides

Labortary use Sigma/equivalent 500g 5

316 Sterile pipettes (20 ml) Cell-culture grade disposable

Local/equivalent 200/pack 1

317 Human Stomach Human Stomach model plastic

Local/equivalent 1 Nos. 1

318 Strawberry flavor Food grade BDH/Equivalent 500 mL 1

319 Streptomycin (S) Antibiotic Disk cartridge

lab grade suitable for antibiotic sensitivity testing

Local/equivalent 50 discs/cartridge

3

320 Streptomycin (S) Antibiotic Disks

Lab grade Local/equivalent 50 disks/ pack 1

321 Succinic acid Laboratory use Sigma/Equivalent 500 g 1

322 Sulfbactam (SCF) cartridge

lab grade suitable for antibiotic sensitivity testing

Local/equivalent 50 discs/cartridge

2

323 Sulfuric acid (H2SO4) lab grade Local/equivalent 2.5 liters

12

324 Sulphur (S) 99.80% Sigma/Equivalent 1.00 kg 1

325 Surgical cap

Green, non-woven, soft texture, elsticated, dustproof

Local/equivalent 50pcs/1 pack 5

326 Surgical Mask

Blue, 3 ply 75 GSM Dispossable Surgical Mask With Melt Blown Fabric Layer and nose pin

Local/equivalent 50pcs/1 pack 6

327 Syringes (5 ml) Commercial Local/equivalent 1 piece

150

328

Taq polymerase (500U/100μl each) supplied with ready to use MgCl2 and PCR-buffer

Taq enzyme supplied with MgCl2 and PCR buffer

Local/equivalent 500units/vial 2

329 Technical Agar agar Lab grade Local/equivalent 500g/pack 1

330 Teflon comb for SDS assembly (10-lane; a0.75 mm)

10 lane Teflon comb

Local/equivalent 1 Nos. 1

331 TEMED (Tetramethyl-ethylene-diamine)

Solid Powder form for preparing prtein gel/buffer solutions

Local/equivalent 100g/pack 1

332 Tert-butylhydroquinone Analytical Local/equivalent 5 g 1

333 Thioglycolate broth

Fine powder form suitable to prepare culture media to support growth of tedius bacteria

Local/equivalent 500g/pack 1

334 Tincture iodine 450 ml

Tincture Iodine USP (Methylated) 450 ml liquid, iodine B.P 5% and Pot. Iodide B.P 10%

Local/equivalent 1 Nos. 5

335 Tissue casets Lab grade Local/equivalent 500 pcs/pack 1

336 Tissue molds Lab grade Local/equivalent 1 pc steel

25

337 Tissue rings Lab grade Local/equivalent 500 pcs/pack 1

338 Tissue Roll Lab grade Local/equivalent 1 Pack

30

339 Tissue towels For surface cleaning/disinfection

Local/equivalent 1roll

10

340 Torso china good Torso china good Local/equivalent 1 Nos. 1

341 Transparent Vacuum Packaging Bags

Multivac 200X300X90 Microns, Multivac 350X450X90 Microns

Local/equivalent 1000 pieces per size

2

342 Trichloroacetic acid (TCA)

Local/equivalent 500 grams 1

343 Tris base Lab Grade Local/equivalent 500 g 1

344 Tris-HCl Solid Powder form for preparing buffer solutions

Local/equivalent 500g/pack 1

345 Trisodium citric dehydrate

Lab Grade Local/equivalent 1 Kg 1

346 Trizol

suitable quality for denaturation of proteins during genomic extraction

Local/equivalent 500ml/pack 1

347 Trypsin Cell-culture grade disposable, for cell passaging

Local/equivalent 100ml/pack 1

348 Tuberculin (mammalian) reagent

Lab grade Local/equivalent 5ml/vial 3

349 Ultrasound Gel (Thick US Grade)

5 L/ Bottle Local/equivalent 1Nos. 8

350 Universal primer 28S for fungus identification

Lyophilized primers for identification of fungus pair of 46 bases

Local/equivalent 23bases/primer 2

351 Upper limb muscle 7 parts with veins and numbering and brosher

Upper limb muscle 7 parts with veins and numbering and brosher

Local/equivalent 1Nos. 1

352 Urea fertilizer commercial Local/equivalent 50kg bag 1

353 Urea lab grade extra Lab grade extra Local/equivalent 500 grams

pure pure 1

354 Urease Medium

Fine powder form suitable to prepare culture media to support growth of tedius bacteria

Local/equivalent 100g/pack 1

355 UV-protection transparent face hield

Effective to filter out UV rays and avoid exposure to UV light while working in laboratory settings, Anti-UV, Anti-Fog, Dust-Proof Headband Hat

Local/equivalent 1 unit 2

356 Vacuum containers (plain tube)

Commercial Local/equivalent 1 pack 3

357 Vacuum containers (EDTA tube)

Commercial Local/equivalent 1 pack 3

358 Vancomycin (VA)) Antibiotic Disks cartridge

lab grade suitable for antibiotic sensitivity testing

Local/equivalent 50 discs/cartridge

2

359 Vaseline 1 Sigma/Equivalent 1.00 kg 1

360 Vicryl 2 (china)

Polyglycolic acid suture-Suture gauge : USP 2 with 75cm suture length and 1/2 circle roundbodied needle (polyglycol)

Local/equivalent 12pcs/box 2

361 Virkon-S Disinfectant 5gram tablets

5g Tablets to make 500mls of disinfectant solution/effective against both enevloped and non-enveloped viral pathogens

Local/equivalent 50 tablets of 5g each/pack

2

362 Vitamin A Analytical BDH/Equivalent 250 g 1

363 Vitamin D3 Analytical Local/equivalent 5 g 1

364 Vitamin E Analytical Local/equivalent 500 g 1

365 Vitamin K4 Analytical Local/equivalent 50 g 1

366 Volumetric flasks 1 liter Pyrex/equivalent 1 Nos. 1

367 Volumetric flasks 500 ml Pyrex/equivalent 1 Nos. 2

368 Volumetric flasks 250 ml Pyrex/equivalent 1 Nos. 1

369 Volumetric flasks 100 ml Pyrex/equivalent 1 Nos. 1

370 Wash bottles plastic lab grade Local/equivalent 1 Nos. 2

371 Washing Bleach 5.25–8.25% sodium hypochlorite

Local/equivalent 5 Liters 2

372 Whatman Filter paper Paper 42 no Local/equivalent 1 Pack 3

373 Whatmann No. I Laboratory use Sigma/Equivalent 1 Packets 1

374 Whey protein isolate Food grade Local/equivalent 1 kg 1

375 Wright Stain 1 litre Wellcosol/Equivalent 1 Nos. 2

376 Xylaz Lab Grade Local/equivalent 1 Vial 2

377 Xylazin 20mg/ 50ml Local/equivalent 1 Nos. 5

378 Xylene Lab Grade Local/equivalent 2.5 L 7

379 Xylocaine 20 mg/ml Local/equivalent 1 Nos.

50

380 Yeast Food grade Local/equivalent 500 g 1

381 Yeast Extract–Peptone–Dextrose (YPD) Medium

Lab grade quality for microbiological cultruing

Local/equivalent 500g/pack 1

382 Zeil-Neilsen stain Lab grade Local/equivalent 500 g/pack 1

383 Zinc sulphate powder Lab grade Local/equivalent 1kg/pack 1

384 ZnCl2 analytical grade Sigma/equivalent 1kg 1

385 Distilled water 5 lit 5 liter botel Local/equivalent 1 botel 1

386 California mastitis test Lab use Sigma/Equivalent 1 kit 1

387 Seguvan powder dry powder form Local/equivalent 1 Kg 1

388 Test tube 1Pkt=100 tubes Local/equivalent I packet 1

389 Wooden test tube clamp Lab use Local/equivalent 1 Nos.

10

390 Petri dishes 90 mm autoclaveable

Germany/Equivalent 1 carton (72 pieces)

1

391 Glass beaker 100mL Local/equivalent 1 Nos. 3

392 Calibrated Lactometer (with 14 – 42 graduations)

Local/equivalent 1 Nos. 3

393 Glass cylinder (250mL) Local/equivalent 1 Nos. 3

394 Calibrated Butyrometer For milk measurement

Germany/Equivalent 1 Nos. 3

395 Calibrated Pipette Lab use Local/equivalent 1 Nos. 2

396 Key Stopper Lab use Local/equivalent 1 Nos. 4

397 Pipette 1mL autoclavable Germany/Equivalent 1 Nos. 3

398 Pippete 10 mL autoclavable Germany/Equivalent 1 Nos. 5

399 Pippete sucker bulb type Germany/Equivalent 1 Nos. 3

400 Automatic measure 10.94ml capacity for Sulphuric Acid

Local/ Equivalent 1 Nos. 1

401 0.1 N Sulfuric acid Vial Vial Local/Imported 1 Nos. 1

402 Calibrated thermometer 0 – 110°C UK/ Equivalent 1 Nos. 4

Technical Evaluation Criteria

The Bidders who have duly complied with the Eligibility / Qualification and Evaluation Criteria will be eligible for further processing.

• The Bids which do not conform to the Technical Specifications or Bid conditions or Bids from

the Bidders without adequate capabilities for supply of Goods/Items/Services will be rejected.

• The Eligible/Technically Qualified Bidders will be considered for further evaluation.

• The Technical proposals shall be evaluated by the technical evaluation committee in the light

of following evaluation criteria:

Category Description Points

Legal

(Mandatory)

Certificate of Company/Individual / Firm

Registration/Incorporation under the laws of Pakistan.

Mandatory

Valid Income Tax Registration. Mandatory

Valid General Sales Tax Registration (Status = Active with FBR

as on the date of submission)

Mandatory

Submission of undertaking on legal valid and attested stamp

paper that the firm is not black listed by any of Provincial or

Federal Government Department, Agency, Organization or

autonomous body or Private Sector.

Mandatory

Eligibility

Criteria

Organization anywhere in Pakistan.

Must have 3 Years’ Experience with Principal /

Manufacturer as Authorized Distributor

Mandatory

Compliance to the technical specifications of all items to be

procured.

Mandatory

Minimum 3 Deployment for the same class of Equipment and

similar value of costing of Rs.3.0 M (PO Required) each with

Govt. and Semi Govt.

Departments in last five years

Mandatory

At least 1 year Repair / After Sale Service Satisfactory Certificate

from Semi Government / Government Departments/ public sector

universities (where applicable)

Mandatory

For warranty and after sales support a parts hub/storage facility

should be in Pakistan. (where applicable)

Mandatory

Mandatory Note:

• Verifiable documentary proofs for all above requirements are mandatory.

• Vendor/ Supplier will be responsible for installation and configuration of the supplied

equipment in client environment as per client's requirements (where necessary)

• Brand and Model Number of quoted equipment must be mentioned. (where applicable)

• Technical Brochures of quoted equipment must be attached. (where applicable)

PROCUREMENT OF CHEMICALS & GLASSWARE/PLASTIC WARE

Technical Parameters

Category Description Marks

Relevant Experience

(Max points 15)

3 to 8 years 5

9 to 14 10

15 and above 15

Financial

(Max points 25)

Audited Annual

Turnover

Rs. 1 million 5

Rs. 2 million 10

Rs. 3 Million and above 15

Audited Financial

Reports

For the Past 3 Years 5 (1.67 per year)

Income Tax Returns For the Past 3 Years 5 (1.67 per year)

Relevant Projects in Govt.

public sector university

and Semi Govt.

Departments

(Minimum 03

Projects)

Cost of 3 Projects in the

Past 3 Years

Each project carries 10

Marks

Rs. 3 million and above

30

Human Resource

(Max points 20)

Total Number of

Employees including

minimum 3 Designer /

Professional

0 – 10 10

20 – 30 15

31 and above 20

Company Website Accomplished with Complete Products and

Details

5

At least 1 Repair / After Sale Service Satisfactory Certificate from

Semi Government / Government Departments

5

Note:

• Verifiable documentary proofs for all above requirements are mandatory.

• Vendor/ Supplier will be responsible for transportation and installation of equipment in client

environment as per client's requirements. (where applicable)

• Sample may be provided within 7 working days if required.

Delivery at Cholistan University of Veterinary & Animal Sciences, Bahawalpur

Qaisar Iqbal Project Manager (F&P) CUVAS, Bahawalpur

top related