snorks - ledbetter biologyledbetterbio.weebly.com/uploads/5/7/2/4/57247505/zork... · web viewzorks...
Post on 03-Apr-2020
0 Views
Preview:
TRANSCRIPT
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 - height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 - eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 - fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 - horns his - iso 2 horns
his - his 1 horn
Gene 6 - lips gly - pro - val purple
val - phe - tyr green
Gene 7 - wings asp - iso - leu - leu - pro - ser 2 wings
asp - iso - pro - pro - pro - thre no wings
Gene 8 - skin val - lys - asp - ala green
asp - asp - asp - ala yellow
Gene 9 - legs phe – gly - gly 1 leg
phe - phe - gly 2 legs
Gene 10 - eyebrow arg - tyr - cys - phe thick
arg - arg - asp - thre thin
Zork Sample #1CATAGGAAT ATAGGGGTTGTTTTT GAAGAGGATGGCCGGCAGCAC GTATAG CCGGGGCAT TTGTAGGAAGAGGGGTGG CATTTCTTACGT
AAACCGCCT GCCATAACATTTGene 1 Transcription
_____________________________________________________ Gene 1 Translation
_____________________________________________________ Gene 2 Transcription
_____________________________________________________ Gene 2 Translation
_____________________________________________________ Gene 3 Transcription
_____________________________________________________ Gene 3 Translation
_____________________________________________________ Gene 4 Transcription
_____________________________________________________ Gene 4 Translation
_____________________________________________________ Gene 5 Transcription
_____________________________________________________ Gene 5 Translation
_____________________________________________________ Gene 6 Transcription
_____________________________________________________ Gene 6 Translation
_____________________________________________________ Gene 7 Transcription
_____________________________________________________ Gene 7 Translation
_____________________________________________________ Gene 8 Transcription
_____________________________________________________ Gene 8 Translation
_____________________________________________________ Gene 9 Transcription
_____________________________________________________ Gene 9 Translation
_____________________________________________________ Gene 10 Transcription
_____________________________________________________ Gene 10 Translation
_____________________________________________________
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism
Zork Sample #2:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA
GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA AAAAAGCCT GCCTCCTTATGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 - height val - ser - phe tall
val - ser - lys short
Gene 2 - body style tyr - pro - glu - glu - lys green
val - pro - thr - glu - phe yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
ala - ala - ala 3 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrow arg - tyr - cys - lys thick
arg - arg - asp - ser thin
Zork Sample #2:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA
GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA AAAAAGCCT GCCTCCTTATGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #3:
CATAGGAAT ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - leu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu – pro 1 eye
leu - leu - ser – ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala – ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 –wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #3:CATAGGAAT
ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #4:
CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - pro - leu tall
val - pro - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #4:CATAGGTTT
CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #5:
CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - leu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala – ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips gly - pro - val purple
gly - phe - tyr green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - lys - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #5:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG
CGGCAGCAC GTAGTG CCGGGGCAT
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #6:
CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #6:CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC
CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism
Zork Sample #7:CATAGGAAT ATAGGGGTTGTTTTT
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips gly - pro - val purple
gly - phe - tyr green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - lys - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #7:CATAGGAAT ATAGGGGTTGTTTTT
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #8:
CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #8:CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC
CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #9:
CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #9:CATAGGTTT
CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #10:
CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips gly - pro - val purple
gly - phe - tyr green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - lys - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #10:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG
CGGCAGCAC GTAGTG CCGGGGCAT
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism
Zork Sample #11:CATAGGTTT
CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #11:CATAGGTTT
CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #12:
CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #12:CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC
CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #13:
CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips gly - pro - val purple
gly - phe - tyr green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - lys - asp - ala green
asp - lys - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #13:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG
CGGCAGCAC GTAGTG CCGGGGCAT
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #14:
CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #14:CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC
CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #15:
CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val - phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #15:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG
CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG
Amino Acid: Codon Translation Sheet
Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #16:
CATAGGAAT ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC GTATAG
CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA
Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description
Gene 1 – height val - ser - leu tall
val - ser - lys short
Gene 2 – hair color tyr - pro - glu - glu - lys green
val - pro - thr - glu - lys yellow
Gene 3 – eyes leu - leu - leu - pro 1 eye
leu - leu - ser - ala 3 eyes
Gene 4 – fangs ala - val - val 1 fang
val - ala - ala 2 fangs
Gene 5 – horns his - iso 2 horns
his - his 1 horn
Gene 6 – lips ser - pro purple
val – phe green
Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings
lys - iso - pro - pro - pro - thre no wings
Gene 8 – skin val - asp - asp - ala green
asp - asp - asp - ala yellow
Gene 9 – legs phe - ser - gly 1 leg
phe - phe - gly 2 legs
Gene 10 – eyebrows arg - tyr - cys - lys thick
arg - arg - asp - thre thin
Zork Sample #16:CATAGGAAT
ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC GTATAG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA
Amino Acid: Codon Translation Sheet
top related