Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 - height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 - eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 - fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 - horns his - iso 2 horns

his - his 1 horn

Gene 6 - lips gly - pro - val purple

val - phe - tyr green

Gene 7 - wings asp - iso - leu - leu - pro - ser 2 wings

asp - iso - pro - pro - pro - thre no wings

Gene 8 - skin val - lys - asp - ala green

asp - asp - asp - ala yellow

Gene 9 - legs phe – gly - gly 1 leg

phe - phe - gly 2 legs

Gene 10 - eyebrow arg - tyr - cys - phe thick

arg - arg - asp - thre thin

 

Zork Sample #1CATAGGAAT ATAGGGGTTGTTTTT GAAGAGGATGGCCGGCAGCAC GTATAG CCGGGGCAT TTGTAGGAAGAGGGGTGG CATTTCTTACGT

AAACCGCCT GCCATAACATTTGene 1 Transcription

_____________________________________________________ Gene 1 Translation

_____________________________________________________ Gene 2 Transcription

_____________________________________________________ Gene 2 Translation

_____________________________________________________ Gene 3 Transcription

_____________________________________________________ Gene 3 Translation

_____________________________________________________ Gene 4 Transcription

_____________________________________________________ Gene 4 Translation

_____________________________________________________ Gene 5 Transcription

_____________________________________________________ Gene 5 Translation

_____________________________________________________ Gene 6 Transcription

_____________________________________________________ Gene 6 Translation

_____________________________________________________ Gene 7 Transcription

_____________________________________________________ Gene 7 Translation

_____________________________________________________ Gene 8 Transcription

_____________________________________________________ Gene 8 Translation

_____________________________________________________ Gene 9 Transcription

_____________________________________________________ Gene 9 Translation

_____________________________________________________ Gene 10 Transcription

_____________________________________________________ Gene 10 Translation

_____________________________________________________

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism

Zork Sample #2:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA

GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA AAAAAGCCT GCCTCCTTATGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 - height val - ser - phe tall

val - ser - lys short

Gene 2 - body style tyr - pro - glu - glu - lys green

val - pro - thr - glu - phe yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

ala - ala - ala 3 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrow arg - tyr - cys - lys thick

arg - arg - asp - ser thin

 

Zork Sample #2:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA

GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA AAAAAGCCT GCCTCCTTATGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #3:

CATAGGAAT ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - leu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu – pro 1 eye

leu - leu - ser – ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala – ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 –wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #3:CATAGGAAT

ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #4:

CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - pro - leu tall

val - pro - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #4:CATAGGTTT

CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #5:

CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - leu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala – ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips gly - pro - val purple

gly - phe - tyr green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - lys - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #5:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG

CGGCAGCAC GTAGTG CCGGGGCAT

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #6:

CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #6:CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC

CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism

Zork Sample #7:CATAGGAAT ATAGGGGTTGTTTTT

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips gly - pro - val purple

gly - phe - tyr green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - lys - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #7:CATAGGAAT ATAGGGGTTGTTTTT

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #8:

CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #8:CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC

CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #9:

CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #9:CATAGGTTT

CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #10:

CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips gly - pro - val purple

gly - phe - tyr green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - lys - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #10:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG

CGGCAGCAC GTAGTG CCGGGGCAT

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism

Zork Sample #11:CATAGGTTT

CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #11:CATAGGTTT

CATGGGTGTGTTTTTGAAGAGGATGGCCGGCAGCAC GTAGTG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #12:

CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #12:CATAGGAAT CATGGGTGTGTTTTT GAAGAGGATGGC

CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #13:

CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG CGGCAGCAC GTAGTG CCGGGGCAT

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips gly - pro - val purple

gly - phe - tyr green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - lys - asp - ala green

asp - lys - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #13:CATAGGTTT ATAGGGGTTGTTTTT GAAGAGAGACGG

CGGCAGCAC GTAGTG CCGGGGCAT

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #14:

CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #14:CATAGGTTT CATGGGTGTGTTTTTGAAGAGGATGGC

CAGCGTCGA GTAGTG CATAAATTCTAGGGGGGCGGTTGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #15:

CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val - phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #15:CATAGGTTT CATGGGTGTGTTTTT GAAGAGAGACGG

CAGCGTCGA GTAGTG CATAAA TTCTAGGGGGGCGGTTGG

 Amino Acid: Codon Translation Sheet

Name: ____________________________________________ Period: _____How Does DNA Determine the Traits of an Organism Zork Sample #16:

CATAGGAAT ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC GTATAG

CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA

Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Zork. Zorks were discovered on the planet Dee Enae in a distant solar system. Zorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the zork. Genes Amino Acid Sequence Description

Gene 1 – height val - ser - leu tall

val - ser - lys short

Gene 2 – hair color tyr - pro - glu - glu - lys green

val - pro - thr - glu - lys yellow

Gene 3 – eyes leu - leu - leu - pro 1 eye

leu - leu - ser - ala 3 eyes

Gene 4 – fangs ala - val - val 1 fang

val - ala - ala 2 fangs

Gene 5 – horns his - iso 2 horns

his - his 1 horn

Gene 6 – lips ser - pro purple

val – phe green

Gene 7 – wings lys - iso - leu - leu - pro - thre 2 wings

lys - iso - pro - pro - pro - thre no wings

Gene 8 – skin val - asp - asp - ala green

asp - asp - asp - ala yellow

Gene 9 – legs phe - ser - gly 1 leg

phe - phe - gly 2 legs

Gene 10 – eyebrows arg - tyr - cys - lys thick

arg - arg - asp - thre thin

 

Zork Sample #16:CATAGGAAT

ATAGGGGTTGTTTTTGAAGAGGATGGCCGGCAGCAC GTATAG CATAAA TTCTAGGGGGGCGGTTGG TTGTTATTGCGA

 Amino Acid: Codon Translation Sheet