similarity index 13% - virginia tech..."new norovirus study findings have been reported by...
Post on 07-Jan-2020
0 Views
Preview:
TRANSCRIPT
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 1/156
198 words / < 1% match - Internet from 12-Nov-2013 12:00AMwww.elbiruniblogspotcom.blogspot.hk
190 words / < 1% match - Internet from 03-Aug-2012 12:00AMfhbgrants.netsoft.net
182 words / < 1% match - Internet from 15-Oct-2011 12:00AMdnareplication.cshl.edu
180 words / < 1% match - Internet from 27-May-2012 12:00AMwww.avpa.asn.au
179 words / < 1% match - Internet from 04-Oct-2012 12:00AMen.engormix.com
159 words / < 1% match - ProQuestMarkis, Milos. "In vivo and in vitro characterization of virus isolates involved in viralenteritis/enteropathy, also known as runting stunting syndrome (rss), in broiler chickens.", Proquest,2014.
149 words / < 1% match - Internet from 02-Dec-2013 12:00AMwww.oie.int
148 words / < 1% match - Internet from 22-Jan-2014 12:00AMwww1.gifu-u.ac.jp
142 words / < 1% match - Internet from 01-Dec-2013 12:00AMwww.picornaviridae.com
137 words / < 1% match - Internet from 02-Oct-2013 12:00AMwww.macvetrev.mk
126 words / < 1% match - Publications
sources:
Pathogenesis and Cross-species Infection of Hep...By: DANIELLE YUGO
As of: Dec 19, 2018 5:21:16 PM 69,868 words - 481 matches - 244 sources
Similarity Index
13%
Mode:
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 2/156
Clemente-Casares, Pilar Pina, Sonia Buti. "Hepatitis E virus epidemiology in industrialized countries.(Research).", Emerging Infectious Diseases, April 2003 Issue
119 words / < 1% match - Internet from 26-Aug-2013 12:00AMwww.labome.org
118 words / < 1% match - Internet from 29-Sep-2012 12:00AMclinet.cn
116 words / < 1% match - Crossref Posted ContentIjeoma M. Ifeorah, Temitope O. C. Faleye, Adeleye S. Bakarey, Moses Olubusuyi Adewumi et al. "AcuteHepatitis E Virus infection in two geographical regions of Nigeria", Cold Spring Harbor Laboratory,2017
115 words / < 1% match - Internet from 08-Apr-2012 12:00AMwww.izw-berlin.de
112 words / < 1% match - Internet from 05-Aug-2012 12:00AMwww.�u.starszenaseks.malopolska.pl
107 words / < 1% match - Internet from 16-Aug-2012 12:00AMwww.researchgate.net
105 words / < 1% match - Internet from 21-Jan-2014 12:00AMwww.vetmed.vt.edu
103 words / < 1% match - Internet from 19-Nov-2012 12:00AMwww.biomedcentral.com
94 words / < 1% match - Internet from 08-Aug-2012 12:00AMwwwnc.cdc.gov
91 words / < 1% match - Crossref"Hepatitis E Virus", Springer Nature, 2016
90 words / < 1% match - Internet from 21-Sep-2017 12:00AMlib.dr.iastate.edu
87 words / < 1% match - Internet from 17-Jun-2013 12:00AMwww.biomedcentral.com
83 words / < 1% match - Internet from 12-Oct-2017 12:00AMelib.tiho-hannover.de
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 3/156
81 words / < 1% match - Internet from 25-Jul-2012 12:00AMwww.rsghb.cn
81 words / < 1% match - Internet from 04-Apr-2017 12:00AMrepub.eur.nl
80 words / < 1% match - Internet from 18-Jul-2013 12:00AMwww.virologyj.com
80 words / < 1% match - Internet from 28-Mar-2014 12:00AMwww.comprehensivephysiology.com
78 words / < 1% match - Internet from 20-Oct-2012 12:00AMdyxy.nwsuaf.edu.cn
78 words / < 1% match - Internet from 26-Oct-2013 12:00AMwww.picornaviridae.com
78 words / < 1% match - Internet from 14-Nov-2014 12:00AMaran.library.nuigalway.ie
75 words / < 1% match - Internetaac.asm.org
74 words / < 1% match - Internet from 09-Jun-2012 12:00AMwww.uniklinik-freiburg.de
72 words / < 1% match - Internet from 01-Sep-2013 12:00AMwww.cresa.cat
70 words / < 1% match - Internet from 21-Nov-2017 12:00AMlib.dr.iastate.edu
67 words / < 1% match - Internet from 22-Sep-2011 12:00AMmedicina.udea.edu.co
67 words / < 1% match - Internet from 04-Feb-2013 12:00AMonlinelibrary.wiley.com
64 words / < 1% match - Internet from 11-Jul-2018 12:00AMd-nb.info
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 4/156
63 words / < 1% match - Internetintl-vir.sgmjournals.org
63 words / < 1% match - Internet from 23-Oct-2018 12:00AMwww.newmicrobiologica.org
62 words / < 1% match - Internet from 13-Oct-2013 12:00AMeatris.it
60 words / < 1% match - PublicationsSaniewski, Mona(Institut für Medizinische Virologie). "Struktur und Funktion der Ober�ächenproteinevon ungewöhnlichen Hepatitis B Virus-Varianten", Justus-Liebig-Universität Gießen, 2009.
59 words / < 1% match - Internet from 02-Aug-2013 12:00AMbiosciencetrends.com
59 words / < 1% match - Crossref Posted ContentMaliki Ankavay, Claire Montpellier, Ibrahim M Sayed, Jean-Michel Saliou et al. "New insights into theORF2 capsid protein, a key player of the hepatitis E virus lifecycle", Cold Spring Harbor Laboratory,2018
58 words / < 1% match - Internet from 25-Sep-2012 12:00AMwww.biosecurity.govt.nz
56 words / < 1% match - Internet from 01-Jul-2014 12:00AMmmbr.asm.org
55 words / < 1% match - Internet from 09-Sep-2017 12:00AMhal.archives-ouvertes.fr
54 words / < 1% match - Internet from 14-Oct-2017 12:00AMonlinelibrary.wiley.com
54 words / < 1% match - Crossref Posted ContentMatthias Fritsche, Floris P de Lange. "Reference Repulsion Is Not a Perceptual Illusion", Cold SpringHarbor Laboratory, 2018
52 words / < 1% match - Internet from 28-Jul-2013 12:00AMxkb.bjmu.edu.cn
50 words / < 1% match - Internet from 02-Sep-2013 12:00AMwww.gallusimmunotech.com
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 5/156
50 words / < 1% match - Internet from 10-Sep-2018 12:00AMcmr.asm.org
50 words / < 1% match - Internet from 12-Nov-2018 12:00AMkrishikosh.egranth.ac.in
50 words / < 1% match - Internet from 27-Jul-2014 12:00AMwww.biomedcentral.com
47 words / < 1% match - Internet from 03-Oct-2003 12:00AMpneumocystis.uc.edu
46 words / < 1% match - Internet from 05-Oct-2012 12:00AMen.nwsuaf.edu.cn
46 words / < 1% match - Internet from 10-Sep-2013 12:00AMwww.recentmedical�ndings.com
46 words / < 1% match - Internet from 14-Oct-2013 12:00AMwww0.nih.go.jp
46 words / < 1% match - PublicationsSchildgen, Oliver. "Identi�zierung einer O-Glykosylierungsstelle der Woodchuck Hepatitis Virus (WHV)preS2-Domäne und deren Ein�uß auf den intrazellulären Transport des middle surface antigen(WHmsAg)", DuEPublico: University of Duisburg-Essen Publications Online, 2002.
46 words / < 1% match - PublicationsÖZPINAR, Haydar, TEZMEN, Gündüz, GÖKÇE, İnci and TEKİNER, İsmail Hakkı. "Detection of animalspecies in some meat and meat products by comparatively using DNA Microarray and Real time PCRmethods", Kafkas Üniversitesi, 2013.
46 words / < 1% match - PublicationsAppel, Bernd, Filter, Matthias, Johne, Reimar and Schielke, Anika. "Thermal stability of hepatitis E virusassessed by a molecular biological approach", Infektionsepidemiologie, 2011.
45 words / < 1% match - Internet from 16-Aug-2010 12:00AMfaculty.vetmed.ucdavis.edu
44 words / < 1% match - Internet from 29-Jan-2012 12:00AMdaff.gov.au
44 words / < 1% match - Internet from 05-May-2012 12:00AMwww.cs.afrims.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 6/156
42 words / < 1% match - Internet from 13-Sep-2018 12:00AMwww.vhpb.org
42 words / < 1% match - Internetntp.niehs.nih.gov
42 words / < 1% match - Internet from 27-Jul-2013 12:00AMwww.veteffect.nl
41 words / < 1% match - Internet from 01-Nov-2013 12:00AMwww.vetmed.vt.edu
41 words / < 1% match - Internet from 11-Oct-2017 12:00AMhal.archives-ouvertes.fr
41 words / < 1% match - Internet from 22-Aug-2014 12:00AMwww.cienciaanimal.ufpa.br
40 words / < 1% match - Internet from 15-Mar-2012 12:00AMwww.europic.org.uk
39 words / < 1% match - Internet from 13-Aug-2012 12:00AMwww.imi.si
39 words / < 1% match - Internet from 24-Jan-2014 12:00AMwww.jci.org
39 words / < 1% match - Internet from 11-Dec-2011 12:00AMwww.avian.uga.edu
38 words / < 1% match - Internet from 05-Jun-2015 12:00AMwww.acpv.info
37 words / < 1% match - Publications"New Norovirus Study Findings Have Been Reported by Researchers at Children's Hospital (Increasedand", Science Letter, June 3 2016 Issue
36 words / < 1% match - Internet from 05-Jun-2012 12:00AMwww.biosecurity.govt.nz
36 words / < 1% match - Internet from 12-Mar-2016 12:00AMwww.mdpi.com
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 7/156
36 words / < 1% match - Internet from 28-Mar-2011 12:00AMjsv.umin.jp
36 words / < 1% match - PublicationsScholtes, Caroline. "Chronic Genotype 3 Hepatitis E in Pregnant Woman Receiving In�iximab andAzathioprine.(RESEARCH LETTERS)", Emerging Infectious Diseases
35 words / < 1% match - Internet from 07-Feb-2012 12:00AMwww.wildlifedisease.org
34 words / < 1% match - Internet from 12-Dec-2018 12:00AMwww.pnas.org
34 words / < 1% match - Internet from 14-Jan-2014 12:00AMsegsydney.com.au
34 words / < 1% match - PublicationsHANSEN, Peter James, DENICOL, Anna Carolina and DOBBS, Kyle Bradley. "Maternal embryokines thatregulate development of the bovine preimplantation embryo", TÜBİTAK, 2014.
34 words / < 1% match - PublicationsAhlemeyer, Gabriele, Beyrer, Konrad, Dreesman, Johannes, Feil, Fabian, Hornig, Angelika, Kirchner,Markus, Krause, Gérard, Mankertz, Annette, Marcic, Anne, Matysiak-Klose, Dorothea, Reiter, Sabine,Santibanez, Sabine, Scharkus, Sibylle, Siedler, Anette and Wichmann, Ole. "Closer to the Goal: Effortsin Measles Elimination in Germany 2010", Infektionsepidemiologie, 2011.
33 words / < 1% match - Internet from 15-Dec-2014 12:00AMrepository.ias.ac.in
33 words / < 1% match - Internet from 21-Jan-2014 12:00AMps.fass.org
33 words / < 1% match - Internet from 16-Oct-2012 12:00AMwww.afrims.org
33 words / < 1% match - Internet from 29-Jul-2013 12:00AMwww.mdpi.com
33 words / < 1% match - Internet from 27-Jan-2015 12:00AMwww.listeriosis-listeriose.investigation-enquete.gc.ca
32 words / < 1% match - Internet from 27-Mar-2009 12:00AMwww.oie.int
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 8/156
31 words / < 1% match - Internet from 02-Oct-2013 12:00AMwww.virosin.org
31 words / < 1% match - Internet from 19-Sep-2011 12:00AMaac.asm.org
31 words / < 1% match - Internet from 26-Aug-2013 12:00AMwww.labome.org
31 words / < 1% match - Internet from 22-Sep-2013 12:00AMwww.els.net
31 words / < 1% match - Internet from 10-Feb-2014 12:00AMwww.medcamer.org
31 words / < 1% match - PublicationsMiao, Zengmin. "Detection and Characterization of Hepatitis E Virus in Goats at Slaughterhouse inTai'an Region, China.(Research Article)(Report)", BioMed Research International
30 words / < 1% match - Internet from 22-May-2012 12:00AMetd.uovs.ac.za
30 words / < 1% match - Internet from 06-Nov-2010 12:00AMwww.avian.uga.edu
30 words / < 1% match - PublicationsAbraham, Priya. "Expanded diagnostic approach to hepatitis E virus detection in patients with acute-on-chronic liver failure: A pilot study.(Original Article)(Clinical report)", Indian Journal of MedicalMicrobiology
29 words / < 1% match - Internet from 30-Jan-2016 12:00AMwww.wjgnet.com
29 words / < 1% match - Internet from 27-Nov-2015 12:00AMwww.researchgate.net
29 words / < 1% match - Internet from 11-Sep-2016 12:00AMftp.palgrave-journals.com
29 words / < 1% match - Internet from 14-Dec-2005 12:00AMvir.sgmjournals.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 9/156
29 words / < 1% match - Internet from 10-Oct-2013 12:00AMwww.klimik.org.tr
29 words / < 1% match - PublicationsDOAN, Huong Thi Thanh, LE, Xuyen Thi Kim, DO, Roan Thi, NGUYEN, Khue Thi and LE, Thanh Hoa."Sequencing and Phylogenetic Analysis Reveal the Prevalence of Duck Hepatitis A Virus Genotype-3 inVietnam", Kafkas Üniversitesi, 2017.
28 words / < 1% match - Internet from 20-Jan-2014 12:00AMwww.ciwf.org.uk
28 words / < 1% match - Internet from 25-Oct-2018 12:00AMvdocuments.site
28 words / < 1% match - Internet from 11-Aug-2013 12:00AMwww.rdb.or.kr
28 words / < 1% match - Internet from 23-Sep-2013 12:00AMwww.sciencedirect.com
28 words / < 1% match - PublicationsJournal of Manufacturing Technology Management, Volume 26, Issue 2 (2015)
27 words / < 1% match - Internet from 18-Jun-2011 12:00AMbuy-cheap.lp-idaho.org
27 words / < 1% match - Internet from 02-Jul-2013 12:00AMwww.elbiruniblogspotcom.blogspot.hk
27 words / < 1% match - Internet from 01-Mar-2012 12:00AMdaff.gov.au
27 words / < 1% match - Internet from 24-Aug-2014 12:00AMgeb.uni-giessen.de
27 words / < 1% match - Internet from 20-May-2012 12:00AMwww.spvet.it
27 words / < 1% match - Internet from 25-Jul-2013 12:00AMwww.burnet.edu.au
27 words / < 1% match - Internet from 08-Feb-2006 12:00AM
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 10/156
diaglab.vet.cornell.edu
27 words / < 1% match - Internet from 01-Jun-2013 12:00AMwww.bic.canterbury.ac.nz
26 words / < 1% match - Internet from 09-Dec-2016 12:00AMjgv.microbiologyresearch.org
26 words / < 1% match - Internet from 03-May-2011 12:00AMwww.cahfs.ucdavis.edu
26 words / < 1% match - Internet from 26-Jan-2015 12:00AMwww.science.gov
26 words / < 1% match - Internetwww.fccc.edu
26 words / < 1% match - PublicationsGiordani, Maria T. Fabris, Paolo Brunett. "Hepatitis E and Lymphocytic Leukemia in Man, Italy.(LETTERS)(Clinical report)(Letter to the editor)", Emerging Infectious Diseases, Dec 2013 Issue
25 words / < 1% match - Internet from 22-Nov-2012 12:00AMwww.pvj.com.pk
25 words / < 1% match - Internet from 08-Sep-2017 12:00AMhzi.openrepository.com
24 words / < 1% match - Internet from 31-Oct-2012 12:00AMwww.es.lancs.ac.uk
24 words / < 1% match - Internet from 03-Jul-2013 12:00AMblog.chinesemeddiets.com
24 words / < 1% match - Internet from 20-Oct-2013 12:00AMsu.diva-portal.org
24 words / < 1% match - Crossref Posted ContentNian Yang, Jennifer McLelland, David McLelland, Judy Clarke, Lucy Woolford, Paul Eden, David Phalen."Psittacid Adenovirus-2 infection in the critically endangered orange-bellied parrot (Neophemachrysogastor): A key threatening process or an example of a host-adapted virus?", Cold Spring HarborLaboratory, 2018
23 words / < 1% match - Internet from 31-Mar-2012 12:00AM
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 11/156
www.wjgnet.com
23 words / < 1% match - Internet from 26-Jan-2014 12:00AMps.fass.org
23 words / < 1% match - Internet from 01-Dec-2013 12:00AMwww.picornaviridae.com
23 words / < 1% match - Internet from 07-Aug-2012 12:00AMwww.isvhld2012.org
23 words / < 1% match - PublicationsLegrand-Abravanel, Florence Mansuy, Jean. "Hepatitis E virus genotype 3 diversity, France.(DISPATCHES)", Emerging Infectious Diseases, Jan 2009 Issue
23 words / < 1% match - Publications"New hepatitis E virus research from University of Berlin outlined.", Hepatitis Weekly, June 1 2009Issue
22 words / < 1% match - Internet from 03-Oct-2010 12:00AMwww.hotgen.com.cn
22 words / < 1% match - Internet from 07-Dec-2013 12:00AMwww.hivpepsingapore.com
22 words / < 1% match - PublicationsArbab, Ahmed H. Parvez, Mohammad K. Al-D. "Hepatoprotective and antiviral e�cacy of Acaciamellifera leaves fractions against hepatitis B vir", BioMed Research International, Annual 2015 Issue
21 words / < 1% match - Internetvir.sgmjournals.org
21 words / < 1% match - Internet from 16-Nov-2010 12:00AMetd.ohiolink.edu
21 words / < 1% match - PublicationsYENTÜR DONİ, Nebiye, ŞİMŞEK, Zeynep, GÜRSES, Gülcan, YILDIZ ZEYREK, Fadile and AKBABA,Muhsin. "The knowledge and high seroprevalence of hepatitis A in a high-risk group (agriculturalreproductive-aged women) in the southeastern region of Turkey", TÜBİTAK, 2017.
20 words / < 1% match - Internet from 03-Sep-2013 12:00AMphage-therapy.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 12/156
20 words / < 1% match - Internet from 25-Sep-2014 12:00AMwww3.niddk.nih.gov
20 words / < 1% match - Internet from 09-Jul-2016 12:00AMwww.intechopen.com
20 words / < 1% match - Internet from 11-Feb-2008 12:00AMwww.animalgenome.org
20 words / < 1% match - Internet from 26-Dec-2012 12:00AMwww.medworm.com
19 words / < 1% match - Internet from 27-Jan-2014 12:00AMps.fass.org
19 words / < 1% match - Internet from 17-Sep-2012 12:00AMwww.biomedcentral.com
19 words / < 1% match - Internet from 14-Aug-2012 12:00AMwww.labome.org
19 words / < 1% match - Internet from 04-Oct-2016 12:00AMja.scribd.com
19 words / < 1% match - Internet from 29-Jul-2012 12:00AMwwwnc.cdc.gov
19 words / < 1% match - Internet from 17-Nov-2016 12:00AMwww.wjgnet.com
19 words / < 1% match - Internet from 24-May-2014 12:00AMwww.jalas.jp
19 words / < 1% match - Internet from 02-Dec-2013 12:00AMwww.researchgate.net
19 words / < 1% match - Internet from 19-Mar-2012 12:00AMwww.virologyj.com
19 words / < 1% match - Internet from 14-Oct-2011 12:00AMacademicjournals.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 13/156
19 words / < 1% match - Crossref Posted ContentMark Kowarsky, Iwijn De Vlaminck, Jennifer Okamoto, Norma F Neff et al. "Cell-free DNA RevealsPotential Zoonotic Reservoirs in Non-Human Primates", Cold Spring Harbor Laboratory, 2018
18 words / < 1% match - Internet from 31-May-2012 12:00AMen.fftc.org.tw
18 words / < 1% match - Internet from 06-Feb-2017 12:00AMonlinelibrary.wiley.com
18 words / < 1% match - Internet from 01-Mar-2015 12:00AMwww.cnrvha-vhe.org
18 words / < 1% match - Internet from 28-Oct-2013 12:00AMwww.nimr.mrc.ac.uk
18 words / < 1% match - Internet from 13-Dec-2013 12:00AMwww.jneuroin�ammation.com
18 words / < 1% match - PublicationsRAJANİ, Monika. "Hindistan kentsel kesimde bir üçüncü basamak hastanesinde fekal-oral yollabulaşan viral hepatit", Sağlık Araştırmaları Derneği, 2013.
18 words / < 1% match - PublicationsMartelli, Francesca <1980>(Ostanello, dott. Fabio). "L'epatite E nei suidi: epidemiologia, diagnosi e�logenesi", Alma Mater Studiorum - Università di Bologna, 2011.
16 words / < 1% match - Internet from 27-Aug-2012 12:00AMsuperstarsofscience.com
16 words / < 1% match - Internet from 04-Dec-2014 12:00AMwww.cdc.gov
16 words / < 1% match - Internet from 10-Jan-2014 12:00AMwww.biosecurity.govt.nz
16 words / < 1% match - PublicationsTan, Boon Hooi Leow, Thean Chor Foo, Hoo. "Molecular characterization of a recombinant manganesesuperoxide dismutase from Lactococcus lactis M", BioMed Research International, Annual 2014 Issue
15 words / < 1% match - Internet from 22-Sep-2010 12:00AMwww.jwildlifedis.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 14/156
15 words / < 1% match - Internet from 03-Aug-2012 12:00AMwww.biojournals.com
15 words / < 1% match - Internet from 15-Sep-2012 12:00AMwww.aasp.org
15 words / < 1% match - Internet from 13-Oct-2013 12:00AMwww.crosbi.znanstvenici.hr
15 words / < 1% match - Internet from 20-Nov-2013 12:00AMzhion.com
14 words / < 1% match - Internet from 21-Apr-2016 12:00AM948.indexcopernicus.com
14 words / < 1% match - Internetvetgate.ac.uk
14 words / < 1% match - Internet from 25-Mar-2012 12:00AMchori.academia.edu
14 words / < 1% match - Publications"New Virology Study Findings Recently Were Reported by Researchers at Shandong AgriculturalUniversit", Life Science Weekly, Dec 18 2012 Issue
14 words / < 1% match - PublicationsRutz, Sascha Kayagaki, Nobuhiko Phung, Q. "Deubiquitinase DUBA is a post-translational brake oninterleukin-17 production in T cells.(RESEARCH:", Nature, Feb 19 2015 Issue
13 words / < 1% match - Internet from 18-Sep-2012 12:00AMwww.biomedcentral.com
13 words / < 1% match - Internetbibd.uni-giessen.de
13 words / < 1% match - Internet from 01-Dec-2010 12:00AMwww.snarc.ars.usda.gov
13 words / < 1% match - Internet from 14-Oct-2010 12:00AMwww.cloetta-stiftung.ch
13 words / < 1% match - Internet from 11-Mar-2013 12:00AMen.wikipedia.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 15/156
13 words / < 1% match - Internet from 13-Aug-2013 12:00AMopexatherapeutics.com
13 words / < 1% match - Publications"VIRGINIA TECH RESEARCHER WORKS TO END GASTRIC ILLNESS IN PEOPLE, INCREASEPRODUCTION OF PIGS.", States News Service, April 17 2015 Issue
12 words / < 1% match - Internet from 11-Nov-2008 12:00AMjgv.sgmjournals.org
12 words / < 1% match - Internet from 02-Oct-2010 12:00AMlib.bioinfo.pl
12 words / < 1% match - Internet from 06-Dec-2012 12:00AMwww.rothamsted.ac.uk
12 words / < 1% match - Internet from 17-Jun-2011 12:00AMwww.todaysengineer.org
12 words / < 1% match - Internet from 14-Jun-2012 12:00AMwwwnc.cdc.gov
12 words / < 1% match - Internet from 29-Jul-2014 12:00AMwww.vetmed.vt.edu
12 words / < 1% match - Publications"Study Findings from Fujian Medical University Provide New Insights into Helicobacter pylori (Impact ",Health & Medicine Week, Oct 30 2015 Issue
12 words / < 1% match - Publications"New pig virus found to be a potential threat to humans.", Space Daily
12 words / < 1% match - Publications"Letters to the Editor.", Image: Journal of Nursing Scholarship, Fall 1999 Issue
11 words / < 1% match - Internet from 12-Nov-2008 12:00AMwww.vetmed.iastate.edu
11 words / < 1% match - Internet from 08-Aug-2014 12:00AMwww.oie.int
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 16/156
11 words / < 1% match - Internetwww.merckbooks.com
11 words / < 1% match - Internet from 13-Dec-2012 12:00AMscholar.lib.vt.edu
11 words / < 1% match - Internetwww.merckvetmanual.com
11 words / < 1% match - Internet from 04-Nov-2012 12:00AMwww.biosecurity.govt.nz
11 words / < 1% match - Internet from 18-Jul-2013 12:00AMwww.traveldoctoronline.net
11 words / < 1% match - Internet from 07-Nov-2013 12:00AMwww.biolegend.de
11 words / < 1% match - PublicationsTakahashi, Kazuaki Okamoto, Hiroaki Abe,. "Virulent strain of Hepatitis E virus genotype 3, Japan.(RESEARCH)", Emerging Infectious Diseases, May 2009 Issue
11 words / < 1% match - Publications"Research from China Agricultural University broadens understanding of hepatitis.", Hepatitis Weekly,July 13 2009 Issue
11 words / < 1% match - PublicationsMacLean, Dick J. Arthur, J. Richard Ward. "Common-source outbreak of acute infection due to theNorth American liver �uke Metorchis conjunctus", The Lancet, Jan 20 1996 Issue
11 words / < 1% match - Publications"Reports from Virginia Tech Describe Recent Advances in Reproduction and Fertility (Biallelic modi�c",Life Science Weekly, Nov 29 2016 Issue
11 words / < 1% match - PublicationsGuo, Peng Hirano, Masayuki Herrin, Brant. "Dual nature of the adaptive immune system in lampreys.(Report)", Nature, June 11 2009 Issue
10 words / < 1% match - Internet from 21-Sep-2011 12:00AMdels-old.nas.edu
10 words / < 1% match - Internet from 10-Sep-2013 12:00AMfacsmail.org
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 17/156
10 words / < 1% match - Internet from 24-Aug-2014 12:00AMwww.vetres.org
10 words / < 1% match - Internet from 19-Oct-2018 12:00AMonlinelibrary.wiley.com
10 words / < 1% match - Internet from 30-May-2014 12:00AMwwwnc.cdc.gov
10 words / < 1% match - Internet from 17-Feb-2014 12:00AMwww.uptodate.com
10 words / < 1% match - Internet from 20-Nov-2016 12:00AMwwwnc.cdc.gov
10 words / < 1% match - Internet from 07-Feb-2014 12:00AMwww.paza.ca
10 words / < 1% match - Internet from 25-Dec-2012 12:00AMhepatop.biopredictive.com
10 words / < 1% match - Internet from 29-Jun-2013 12:00AMwww.ilovereading.com.au
10 words / < 1% match - Internet from 21-Aug-2011 12:00AMwww.helpforhomeowners.org
10 words / < 1% match - Internet from 12-Mar-2012 12:00AMwww.multimericbio.com
10 words / < 1% match - Internet from 23-Nov-2013 12:00AMwww.vtnews.vt.edu
10 words / < 1% match - PublicationsSonder, Gerard J.B.. "Hepatitis E in Long-Term Travelers from the Netherlands to Subtropical andTropical Countries, 2008-2011.", Emerging Infectious Diseases
10 words / < 1% match - PublicationsBald, Tobias Quast, Thomas Landsberg, Jennifer Rogava, Meri Glodde, Nicole Lopez-Ramos, DorysKohlme. "Ultraviolet-radiation-induced in�ammation promotes angiotropism and metastasis inmelanoma.(RESEARC", Nature, March 6 2014 Issue
9 words / < 1% match - Internet from 07-Feb-2012 12:00AM
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 18/156
www.hepatologytextbook.com
9 words / < 1% match - Internet from 22-Sep-2013 12:00AMwww.jci.org
9 words / < 1% match - Internet from 06-Oct-2010 12:00AMwww.plosone.org
9 words / < 1% match - Internet from 30-May-2014 12:00AMwwwnc.cdc.gov
9 words / < 1% match - Internet from 15-Dec-2010 12:00AMwww.biomedcentral.com
9 words / < 1% match - Internet from 18-Sep-2014 12:00AMmicrobial-intelligence-group.us
9 words / < 1% match - Internet from 18-Oct-2011 12:00AMmemorias.ioc.�ocruz.br
9 words / < 1% match - Internet from 13-Dec-2010 12:00AMwww.biomedcentral.com
9 words / < 1% match - Internet from 11-Jun-2015 12:00AMresearchers.general.hokudai.ac.jp
9 words / < 1% match - Internet from 27-Nov-2015 12:00AMwww.who.int
9 words / < 1% match - Internet from 09-Oct-2011 12:00AMwww.veec.nl
9 words / < 1% match - Internet from 21-Apr-2013 12:00AMwww.nzpib.co.nz
9 words / < 1% match - Internet from 11-Jun-2012 12:00AMdels-old.nas.edu
9 words / < 1% match - Internetwww.poultryscience.org
9 words / < 1% match - Internet from 04-Aug-2012 12:00AM
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 19/156
endeavourpartners.net
9 words / < 1% match - Internet from 03-Aug-2013 12:00AMwww.affymetrix.co.jp
9 words / < 1% match - Internet from 15-Dec-2013 12:00AMwww.science.gov
9 words / < 1% match - PublicationsImamura, T. Yokosuka, O. Kurihara, T. Ka. "Distribution of hepatitis B viral genotypes and mutations inthe core promoter and precore regions i", Gut, Nov 2003 Issue
9 words / < 1% match - PublicationsRudolf, Rebeka Tomic, Sergej Anzel, Ivan Hartner, Tjasa Zupancic Colic, Miodrag. "Microstructure andbiocompatibility of gold-lanthanum strips.(ORIGINAL PAPER)(Report)", Gold Bulletin, Dec 2014 Issue
9 words / < 1% match - PublicationsWorld Veterinary Poultry Association(Klinik für Vögel, Reptilien, Amphibien und Fische). "Proceedings/ V. International Symposium on Avian Corona- and Pneumoviruses and Complicating Pathogens,Rauischholzhausen, Germany, 14-16 May 2006 ", Justus-Liebig-Universität Gießen, 2006.
9 words / < 1% match - PublicationsLiang, Chao Guo, Baosheng Wu, Heng Shao,. "Aptamer-functionalized lipid nanoparticles targetingosteoblasts as a novel RNA interference-based b", Nature Medicine, March 2015 Issue
paper text:
Pathogenesis and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo
Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial
ful�llment of the requirements for the degree of Doctor of Philosophy In Biomedical Sciences and
Pathobiology Dr. Xiang-Jin Meng, Committee Chair Dr. F. William Pierson Dr. Virginia Buechner-Maxwell Dr. Isis
Kanevsky December 11, 2018 Blacksburg, VA Keywords: Hepatitis E Virus (HEV); gnotobiotic pig; Ig heavy-
chain knock-out; novel model; animal reservoir; bovine; seroprevalence; cross-species infection Pathogenesis
and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo ABSTRACT
Hepatitis E Virus (HEV), the causative agent of hepatitis E, is a zoonotic pathogen of worldwide
signi�cance. The genus Orthohepevirus A of the family Hepeviridae
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 20/156
includes all mammalian strains of HEV and consists of 8 recognized genotypes. Genotypes 1 and 2 HEVs only
infect humans and
genotypes 3 and 4 infect humans and several other animal species including pigs and
rabbits. An ever-expanding host range of genetically-diversi�ed strains of HEV now include bat, �sh, rat, ferret,
moose, wild boar, mongoose, deer, and camel. Additionally, the ruminant species goats, sheep, and cattle have
been implicated as potential reservoirs as well. My dissertation research investigates a novel animal model for
HEV, examines the immune dynamics during acute infection, and evaluates the possibility of additional animal
reservoirs of HEV. The �rst project established an immunoglobulin (Ig) heavy chain knock-out JH (-/-)
gnotobiotic piglet model that mimics the course of acute HEV infection observed in humans and evaluated the
pathogenesis of HEV infection in this novel animal model. The dynamics of acute HEV infection in gnotobiotic
pigs were systematically determined with a genotype 3 human strain of HEV. We also investigated the potential
role of immunoglobulin heavy-chain JH in HEV pathogenesis and immune dynamics during the acute stage of
virus infection. This novel gnotobiotic pig model will aid in future studies into HEV pathogenicity, an aspect
which has thus far been di�cult to reproduce in the available animal model systems. The objective of the
second project for my PhD dissertation was to determine if cattle in the United States are infected with a
bovine strain of HEV. We demonstrated serological evidence of an HEV-related agent in cattle populations with
a high level of IgG anti-HEV prevalence. We demonstrated that calves from a seropositive cattle herd
seroconverted to IgG binding HEV during a prospective study. We also showed that the IgG anti-HEV present in
cattle has an ability to neutralize genotype 3 human HEV in vitro. However, our exhaustive attempts to detect
HEV- related sequence from cattle in the United States failed, suggesting that one should be cautious in
interpreting the IgG anti-HEV serological results in bovine and other species. Collectively, the work from my
PhD dissertation delineated important mechanisms in HEV pathogenesis and established a novel animal
model for future HEV research. Pathogenesis and Cross-species Infection of Hepatitis E Virus Danielle M. Yugo
GENERAL AUDIENCE ABSTRACT
Hepatitis E Virus (HEV), the causative agent of hepatitis E, is a zoonotic pathogen of
worldwide signi�cance. According to the World Health Organization, there are approximately
20 million HEV infections annually, which result in 3. 3 million cases of acute hepatitis E and >44
,000 HEV-related deaths. Hepatitis E is
a self-limiting acute disease in general, but carries the ability to cause
high mortality in pregnant women and chronic hepatitis in immunocompromised
individuals. The underlying mechanisms of HEV host tropism and progression of disease to chronicity are
unknown. My dissertation work investigates a novel animal model for HEV, evaluates the possibility of
additional animal reservoirs of HEV, and examines the immune dynamics during acute infection. The �rst
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 21/156
project established an immunoglobulin (Ig) heavy chain knock-out JH (-/-) gnotobiotic piglet model that mimics
the course of acute HEV infection observed in humans. The dynamics of acute HEV infection were determined
in both the knock-out and wild-type piglets with a genotype 3 strain of human HEV. We also investigated the
potential role of immunoglobulin heavy-chain JH in HEV pathogenesis and virus infection. In the second
project, we determined if cattle in the United States are infected with a bovine strain of HEV. We showed
serological evidence of an HEV-related agent in cattle as well as calves born in a seropositive herd. Despite the
detection of speci�c antibodies recognizing HEV in cattle, de�nitive evidence of virus infection could not be
demonstrated. Our exhaustive attempts to detect HEV-related sequence from cattle in the United States failed,
suggesting that one should be cautious in interpreting the IgG anti-HEV serological results in bovine and other
species. Collectively, the work from my PhD dissertation research delineated important mechanisms in HEV
pathogenesis and established a novel animal model for future HEV research. ACKNOWLEDGEMENTS I am
extremely grateful to my advisor, Dr. X.J. Meng, for his continuing support, experience, and encouragement
throughout this journey. My success in graduate school was greatly impacted by his expertise and direction.
Under his mentorship, I have developed as a scientist, writer, veterinarian, and expert in our �eld. I am forever
thankful.
I would like to thank my committee members, Dr. Bill Pierson, Dr. Isis Kanevsky, and
Dr. Virginia Buechner-Maxwell for their continued encouragement, support, and assistance on my many
graduate career projects. I greatly appreciate the amount of time and effort they committed on my behalf.
I would also like to thank my collaborators, Dr. Lijuan Yuan and her lab, Dr.
Kiho Lee and his lab, Dr. Tanya LeRoith, Dr. Tom Cecere, Dr. Sherrie Clark-Deener, Dr. Tanja Opriessnig, Dr. Anbu
Karuppannan Dr. Amelia Woolums, Dr. David Hurley, Dr. Eric Delwart and his lab, and Dr. Amit Kapoor for the
assistance, samples, expertise, and editing that made my projects a success. I am forever grateful to my
current and past lab mates Dr. Caitlin Cossaboom, Dr. Yao-Wei Huang, Dr. Scott Kenney, Dr. Sakthivel
Subramaniam, Dr. Shannon Matzinger, Dr. Chris Overend, Dr. Dianjun Cao, Dr. Harini Sooryanarain, Dr. Pablo
Pineyro, Nick Catanzano, Dr. Qian Cao, Dr. Debin Tian, and Dr. Adam Rogers, who provided insight, support,
suggestions, and critiques and without them, the many animal projects would never have been completed. A
special thanks goes to my lab manager and friend Lynn Heffron who spent many weekends, evenings, and
holidays helping me complete my projects, providing never ending support and encouragement, and who
always made the journey memorable and fun. Lastly, I owe much gratitude to my family and friends who stood
by me every day as my biggest supporters. Most importantly, my boyfriend Matt who never fails to listen and
always makes me smile and my daughter Vienna who provided me endless support, never complained vi (too
much) about the late nights, my forgetfulness, or granola bars for dinner, and was the source of my drive and
ambition. This research was supported by grants from the National Institutes of Health (R01AI074667,
R01AI050611), VMCVM O�ce of Research and Graduate Studies, and Virginia Tech internal funds. I am
supported by a training grant from the National Institutes of Health (T32OD010430-06) vii ATTRIBUTIONS All of
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 22/156
this work would have been impossible without the contributions and dedication of many colleagues who were
an integral part of the research, writing, and editing of all projects in this dissertation. Chapters 1 through 5:
Xiang-Jin Meng, M.S., M.D., Ph.D. (Department of Biomedical Sciences) is a University Distinguished Professor
at Virginia Tech and is the corresponding author on these manuscripts. He aided in project development,
writing, and editing of all manuscripts and provided expertise throughout all projects. Chapters 2 and 5: Caitlin
M. Cossaboom,
D.V.M., M. P.H., Ph.D. was a Ph.D. student (Department of Biomedical and Veterinary
Sciences)
and a coauthor on these manuscript. She helped with writing and editing the manuscript for Chapter 2 and
helped with animal manipulation and editing of the manuscript for Chapter 5. Chapter 3: Ruediger Hauck, Ph.D.
is a coauthor on this manuscript and was a Postdoctoral Fellow at the University of California, Davis, CA
(Department of Population Health and Reproduction). He aided in writing and editing the manuscript and
provided the gross and histopathological lesion images. H.L. Shivaprasad, M.S., D.V.M., Ph.D., DACPV is a
coauthor on this manuscript and is currently a Professor of Avian Pathology with the
California Animal Health and Food Safety Lab, University of California, Davis.
He aided in writing and editing the manuscript and provided the gross and histopathological lesion images.
Chapters 4 through 5: C. Lynn Heffron, B.S. is a coauthor on these manuscripts and the current Laboratory
Manager of the Meng Lab (Department of Biomedical Sciences and Pathobiology, Virginia Tech). She helped
with project development, animal manipulation, sample collection, processing, data analysis, and editing of the
manuscripts. Scott. P. Kenney, B.S., Ph.D., is a coauthor on these manuscripts and is
an Assistant Professor (Department of Veterinary Preventive Medicine, Food Animal Health Research
Program,
Ohio State University). He helped with animal manipulation and editing of the manuscript for Chapter 4, and
animal manipulation, project development and design, and editing of the manuscripts for Chapters 5. viii
Chapter 4: Junghyun Ryu is a coauthor on this manuscript and a Ph.D. student (Department of Animal and
Poultry Science, Virginia Tech). He helped in the development and production of CRISPR/Cas9 Ig-heavy chain
knock-out piglets and aided in writing and editing the manuscript. Kyungjun Uh is a coauthor on this
manuscript and a Ph.D. student (Department of Animal and Poultry Science, Virginia Tech). He helped in the
development and production of CRISPR/Cas9 Ig-heavy chain knock-out piglets and aided in writing and editing
the manuscript. Sakthivel Subramaniam, D.V.M., Ph.D., is a coauthor on this manuscript and is currently a
Postdoctoral Associate (Department of Biomedical and Veterinary Sciences, Virginia Tech). He helped with
animal manipulation and editing of the manuscript. Shannon R. Matzinger, Ph.D., is a coauthor on this
manuscript and was a Research Scientist (Department of Biomedical and Veterinary Sciences, Virginia Tech).
She helped with animal manipulation and editing of the manuscript. Christopher Overend, Ph.D., is a coauthor
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 23/156
on this manuscript and was a Postdoctoral Associate (Department of Biomedical and Veterinary Sciences,
Virginia Tech). He helped with animal manipulation and editing of the manuscript. Dianjun Cao, D.V.M., Ph.D., is
a coauthor on this manuscript and was a Research Scientist (Department of Biomedical and Veterinary
Sciences, Virginia Tech). He helped with animal manipulation and editing of the manuscript. Harini
Sooryanarain, Ph.D., is a coauthor on this manuscript and is a Postdoctoral Associate (Department of
Biomedical and Veterinary Sciences, Virginia Tech). She helped with animal manipulation and editing of the
manuscript. Thomas Cecere, D.V.M., Ph.D., DACVP, is a coauthor on this manuscript and is currently
an Assistant Professor in Anatomic Pathology (Department of Biomedical Sciences and Pathobiology,
Virginia Tech).
He participated in the necropsies, completed the histopathological analyses, and aided in editing the
manuscript. Tanya LeRoith, D.V.M., Ph.D., DACVP, is a coauthor on this manuscript and is currently a Clinical
Professor in Anatomic Pathology (Department of Biomedical Sciences and Pathobiology, Virginia Tech). She
participated in the necropsies and aided in editing the manuscript. Lijuan Yuan, Ph.D., is a coauthor on this
manuscript and is currently
an Associate Professor in Virology and Immunology (Department of Biomedical Sciences and
Pathobiology, Virginia
Tech). She provided expertise in project development and helped edit the manuscript. Nathaniel Jue, B.S.,
D.V.M., is a coauthor on this manuscript and is currently a Masters Student and Surgical Resident (Department
of Large Animal Clinical Sciences, Virginia Tech). He helped in the animal manipulation and production of
CRISPR/Cas9 heavy-chain knock-out piglets and aided in editing the manuscript. ix Sherrie Clark-Deener,
D.V.M., Ph.D., DACT, is a coauthor on this manuscript and
an Associate Professor in Theriogenology (Department of Large Animal Clinical Sciences,
Virginia Tech). She aided in the animal manipulation, development and production of CRISPR/Cas9 heavy-
chain knock-out piglets, and aided in editing the manuscript. Kiho Lee, M.S., Ph.D., is a coauthor on this
manuscript and is currently an Assistant Professor (Department of Animal and Poultry Science, Virginia Tech).
He helped in the development and production of CRISPR/Cas9 Ig-heavy chain knock-out piglets and aided in
editing the manuscript. Chapter 5: Yao-Wei Huang, B.S., Ph.D., is a coauthor on this manuscript and was a
Research Scientist (Department of Biomedical Sciences and Pathobiology, Virginia Tech). He helped in project
development, training on assays and collection of data and aided in editing the manuscript. Amelia R.
Woolums, M.Sc., D.V.M., Ph.D., DACVIM, DACVM, is a coauthor on this manuscript and is currently a Professor
(Department of Pathobiology and Population Medicine, Mississippi State University). She provided the "Georgia
herd" samples for the project and aided in editing the manuscript. David J. Hurley, B.A., Ph.D., is a coauthor on
this manuscript and is currently a Professor
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 24/156
(Department of Large Animal Medicine, College of Veterinary Medicine, University of Georgia). He provided
the
"Georgia herd" samples for the project and aided in editing the manuscript. Linlin Li, R.N., Ph.D., is a coauthor
on this manuscript and a
Professor (Department of Family Health Care Nursing, University of California, San Francisco).
She helped in processing the samples using next generation sequencing (MiSeq) and aided in editing the
manuscript. Eric Delwart, B.Sc., M.Sc., Ph.D., is a coauthor on this manuscript and
is currently a Professor (Department of Laboratory Medicine, University of California, San Francisco).
He helped in providing expertise in project design, processed the samples using next generation sequencing
(MiSeq), and aided in editing the manuscript. Isis Kanevsky, B.S., Ph.D., is a coauthor on this manuscript and
was a Professor (Department of Dairy Science, Virginia Tech). She provided expertise in project design,
provided the "Virginia Dairy herd" for sampling, and aided in editing the manuscript. Tanja Opriessnig, BVSc.,
D.V.M., Ph.D., is a coauthor on these manuscripts and is currently a Professor at
Iowa State University (Veterinary Diagnostic Laboratory, Department of Veterinary Diagnostic and Production
Animal Medicine) and a
Professor
at the University of Edinburgh (Royal (Dick) School of Veterinary Medicine, Chair of
Infectious Disease Pathology). She provided the bovine samples from herds across the Midwestern United
States for analysis in the project for Chapter 5, helped with animal project organization, sample collection,
sample processing x DEDICATION For my daughter, Vienna. xi TABLE OF CONTENTS
ABSTRACT...................................................................................................................................ii GENERAL
AUDIENCE ABSTRACT.......................................................................................iv
ACKNOWLEDGEMENTS.........................................................................................................vi
ATTRIBUTIONS.......................................................................................................................viii
DEDICATION..............................................................................................................................xi
TABLE OF CONTENTS............................................................................................................ xii LIST OF
TABLES....................................................................................................................... xv LIST OF
FIGURES....................................................................................................................
xvi GENERAL INTRODUCTION..................................................................................................xix
REFERENCES...........................................................................................................................xxi CHAPTER I:
Hepatitis E Virus: Foodborne, Waterborne, and Zoonotic
Transmission..................................................................................................................................1
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 25/156
Abstract...................................................................................................................................2
Introduction............................................................................................................................3 HEV Classi�cation and
Biology............................................................................................3 HEV
Pathogenesis..................................................................................................................6 Epidemiology of HEV
Infection............................................................................................9 Environmental Contamination and
Waterborne Transmission......................................10 Foodborne Transmission and Food
Safety........................................................................13 Known and Potential Animal
Reservoirs...........................................................................16 Animal Handling and Zoonotic
Transmission...................................................................21
Conclusions...........................................................................................................................22
Acknowledgements...............................................................................................................23 References and
Notes...........................................................................................................25 CHAPTER II: Naturally Occurring
Animal Models of Human Hepatitis E Virus
Infection........................................................................................................................................41
Abstract.................................................................................................................................42
Introduction..........................................................................................................................43 Historical Animal
Models for Human Hepatitis E............................................................46 Naturally Occurring HEV Infections in
Animals..............................................................47 xii Naturally Occurring Animal Models for Human Hepatitis
E.........................................49 Application of Naturally Occurring Animal Models for HEV
Studies...........................56 Future
Perspectives..............................................................................................................64
Acknowledgements...............................................................................................................65
References.............................................................................................................................66
Tables.....................................................................................................................................73
Figure.....................................................................................................................................76 Chapter III: Hepatitis
Virus Infections in Poultry...................................................................77
Summary...............................................................................................................................78
Introduction..........................................................................................................................80 Avian Hepatitis E Virus
(Avian HEV) ..............................................................................80 Duck Hepatitis B Virus (DHBV)
........................................................................................86 Duck Hepatitis A Virus (DHAV-1, DHAV-2, DHAV-3)
..................................................92 Duck Hepatitis Virus (DHV II & III)
................................................................................94 Fowl Adenoviruses (FAdV)
................................................................................................97 Turkey Hepatitis Virus (THV)
.........................................................................................100
References...........................................................................................................................104
Acknowledgements.............................................................................................................113
Figures.................................................................................................................................114 Chapter IV:
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 26/156
Infection Dynamics of Hepatitis E Virus in Wild-Type and Immunoglobulin Heavy Chain Knockout JH (-/-)
Gnotobiotic Piglets...............................................................
118 Abstract...............................................................................................................................119
Importance..........................................................................................................................120
Introduction........................................................................................................................121
Results..................................................................................................................................123
Discussion............................................................................................................................130 Materials and
Methods......................................................................................................137
Acknowledgements.............................................................................................................148
References...........................................................................................................................149
Tables...................................................................................................................................155
Figures.................................................................................................................................162 xiii Chapter V:
Evidence for an Unknown Agent Antigenically Related to the Hepatitis E Virus in Dairy Cows in the United
States...........................................................................................169
Abstract...............................................................................................................................170
Introduction........................................................................................................................171 Materials and
Methods......................................................................................................172
Results..................................................................................................................................177
Discussion............................................................................................................................181
Acknowledgements.............................................................................................................184
References...........................................................................................................................186
Tables...................................................................................................................................191
Figures.................................................................................................................................195 Chapter VI: General
Conclusions............................................................................................198
References...........................................................................................................................202 xiv LIST OF TABLES
Chapter II — Table 1 (p. 73): Animals with naturally occurring HEV infections. Chapter II — Table 2 (p. 74):
Experimental susceptibility of different animal species to HEV strains. Chapter II — Table 3 (p. 75): Applications
of available animal models including naturally occurring animal models for various aspects of HEV studies.
Chapter IV — Table 1 (p. 155): Experimental infection of wild-type and immunoglobulin JH (- /-) knockout
gnotobiotic piglets with a genotype 3 human strain (US2) of hepatitis E virus. Chapter IV — Table 2 (p. 156):
E�cacy of CRISPR/Cas9 to introduce targeted modi�cations in Ig heavy chain locus during embryogenesis.
Chapter IV — Table 3 (p. 157): Phenotyping of Ig heavy-chain modi�ed piglets produced using CRISPR/Cas9
technology and retrieved by hysterectomy. Chapter IV — Table 4 (p. 158): Genotyping the Ig heavy chain
modi�ed piglets. Chapter IV — Table 5 (p. 160): Detection of HEV RNA in the serum (fecal) samples of wild-
type and Ig JH (-/-) knockout gnotobiotic piglets experimentally infected with the US2 strain of human. Chapter
IV — Table 6 (p. 161): Primers and double-stranded DNA (dsDNA) used for the development of Ig heavy-chain
knockout piglets. Chapter V — Table 1 (p. 191): Prevalence of IgG binding to HEV in cattle from different
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 27/156
geographic regions of the United States. Chapter V — Table 2 (p. 192): Serological evidence of HEV IgG in
dams and their corresponding calf from the prospective study in a university dairy herd. Chapter V — Table 3
(p. 193): Neutralizing capability of selected bovine serum samples from calves on the infectivity of a genotype
3 human HEV (Kernow P6 strain) in HepG2/C3A human liver cells. Chapter V — Supp. Table 1 (p. 194): Oligo
primers used for the detection of HEV RNA in fecal and serum samples by broad-spectrum nested RT-PCR
assays. xv LIST OF FIGURES Chapter II — Figure 1 (p. 76): A phylogenetic tree based on the full-length genomic
sequences with genotype classi�cation of known animal strains of HEV. Sequence alignment was completed
using ClustalW, MEGA version 5.2 (www.megasoftware.net) for the phylogenetic tree, and the
tree was constructed using the neighbor-joining method with the maximum composite likelihood
method
for evolutionary distances corresponding to each branch length and the units of the number of base
substitutions per site. Each of the four known genotypes (1-4) is labeled, with representative strains included
for each species, and novel strains from ferret, bat, rat, avian, and �sh identi�ed individually as separate new
putative genotypes or species. Chapter III — Figure 1 (p. 114): Enlarged and hemorrhagic liver in a 42-week-old
broiler breeder due to avian hepatitis E virus infection. Chapter III — Figure 2 (p. 114): Enlarged liver with
petechiae in a six-day-old duckling due to DHAV-1 infection. Chapter III — Figure 3 (p. 114): Histopathology of
the liver with severe diffuse necrosis of hepatocytes and hemorrhage due to DHAV–1 infection. Chapter III —
Figure 4 (p. 115): Diffusely enlarged and pale liver due to Fowl Adenovirus-1 (IBH) in a broiler chicken. Chapter
III — Figure 5 (p. 115): One diffusely enlarged and pale liver with petechiae and another liver with pale foci of
necrosis in a broiler chicken due to IBH. Chapter III — Figure 6 (p. 116): Histopathology of liver with
hepatocellular necrosis, in�ammation and intranuclear inclusion bodies in a case of IBH. Chapter III — Figure 7
(p. 116): Enlarged liver with pale foci of necrosis in a young turkey poult suffering from Turkey Viral Hepatitis.
Chapter III — Figure 8 (p. 117): Pancreas with pale patches of necrosis in a turkey poult to TVH. Chapter IV —
Figure 1 (p. 162): Ig heavy chain targeting CRISPR sequences and representative types of Ig heavy chain
mutations in this study. (A) Disruption of Ig heavy chain in pigs by CRISPR/Cas9 with a total of 4 target sites
designed using a web-based program. Bold letters indicate PAM sequence of target sites. Black arrows
indicate primers used to amplify the target region. (B) Types of genetic mutations of the Ig heavy chain in
single blastocyst. The sequencing results indicated either homozygous or biallelic mutation of Ig heavy chain
in single embryos with no wild-type alleles observed. (C) Representative genotype of Ig heavy chain knock-out
pigs. Arrows indicate sites of mutations. Chapter IV — Figure 2 (p. 163): B-lymphocyte cell counts in peripheral
blood samples of wild- type and immunoglobulin JH knockout gnotobiotic piglets experimentally-infected with
HEV. PBMCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy. Cells were xvi gated
based on CD3 and quanti�ed for the intracellular marker CD79a+ as a measure of the total B-cell population in
the peripheral blood. Asterisks indicate statistical signi�cance between designated groups determined by
Tukey’s t-test with a p value <0.001. Chapter IV — Figure 3 (p. 164): Quanti�cation of HEV RNA loads in serum,
fecal, and bile samples of wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 28/156
Viral RNAs were extracted from (A) fecal samples three times weekly, (B) intestinal contents and bile at 28
days post-inoculation (dpi), (C) as a scatterplot of fecal viral RNA, with each symbol indicating the value for an
individual piglet, and (D) serum samples at 0, 7, 14, 21, and 28 dpi for the quanti�cation of HEV RNA copy
numbers by qRT-PCR. Data are expressed as mean +/- SEM. The detection limit is 10 viral genomic copies,
which corresponds to 400 copies per 1mL sample or per gram of tissue. Titers below the reported detection
limit were considered negative. Asterisks indicate statistical signi�cance between designated groups as
determined by two-way ANOVA and p-value <0.05. Chapter IV — Figure 4 (p. 165): Circulating levels of liver
enzymes in serum samples collected weekly from HEV-infected wild-type and HEV-infected JH (-/-) knockout
gnotobiotic piglets. Serum was collected weekly from each piglet beginning with 0-week post-inoculation (wpi)
and continuing until necropsy at 4 wpi. Liver enzymes including (A) aspartate aminotransferase (AST), (B) total
bilirubin, (C) alkaline phosphatase, and (D) gamma-glutamyl transferase (GGT) were measured at the Iowa
State University Veterinary Diagnostic Lab. Normal limits were provided with the analysis based on the
laboratory’s standards for each speci�c test, which are indicated on each scatterplot graph as a dotted line.
Each sample indicates an individual piglet for each time point and are expressed as the mean +/- SEM.
Analysis was completed using two-way ANOVA. *p<0.05. Chapter IV — Figure 5 (p. 166): Histopathological
lesions in wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV. (A)
Histopathological lesions in the liver including lymphoplasmacytic hepatitis and hepatocellular necrosis.
Lymphoplasmacytic hepatitis was scored as follows:
0, no in�ammation; 1, 1- 2 focal lymphoplasmacytic in�ltrates/ 10 hepatic lobules; 2, 3- 5 focal
in�ltrates/ 10 hepatic lobules; 3, 6- 10 focal in�ltrates /10
hepatic lobules; and 4, >10 focal in�ltrates/10 hepatic lobules. Hepatocellular necrosis was characterized by
the presence of individual hepatocytes with an eosinophilic cytoplasm with or without fragmented or absent
nuclei. (B) Liver/body weight ratio: The liver weights were evaluated as a ratio of overall body weight. Asterisks
indicate statistical signi�cance as determined by two-way ANOVA.
*p<0.05, **p<0.01, ***p<0.001. Chapter IV — Figure
6 (p. 167): Frequencies of IFN-g and IL-4 intracellular cytokines in mononuclear cells isolated from spleen and
mesenteric lymph node tissues and PBMCs from peripheral blood of wild-type and JH knockout piglets
experimentally-infected with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-
inoculation (dpi) at necropsy. Cells were gated on CD3 and stained for extracellular and intracellular markers
CD4+ and IFN-g and IL- 4, respectively, after stimulation with HEV-speci�c capsid protein. The mean
frequencies of (A) IFN-g, (B) IL-4, (C) CD4+, are indicated and expressed as mean +/- SEM. All frequencies were
determined by �ow cytometry with 100,000 events per sample. *p<0.05. xvii Chapter IV — Figure 7 (p. 168):
Frequencies of TGF-b and IL-10 intracellular cytokines in mononuclear cells isolated from spleen and
mesenteric lymph node tissues and PBMCs from peripheral blood of wild-type and JH knockout piglets
experimentally-infected with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 29/156
inoculation (dpi) at necropsy. Cells were gated on CD3 and stained for extracellular and intracellular markers
CD4+, CD25+, Foxp3, and TGF-b and IL-10 respectively after stimulation with HEV-speci�c capsid protein. The
mean frequencies of (A) CD25+ Foxp3+, (B) CD25- Foxp3+, (C) TGF-b, and (D) IL-10 are indicated and
expressed as mean +/- SEM. All frequencies were determined by �ow cytometry with 100,000 events per
sample. Chapter V — Figure 1 (p. 195): Seroconversion to IgG anti-HEV in calves in a closed university dairy
herd in Virginia in a prospective study. Ten newborn calves born to both IgG anti-HEV seropositive and
seronegative dams were monitored for evidence of HEV infection from the day of birth to 6 months of age. The
weekly serum samples from all calves were tested by the commercial Wantai ELISA assay for IgG anti-HEV.
(A): Calves tested negative for IgG anti-HEV in the prospective study; (B): Calves tested positive for IgG anti-
HEV in the prospective study. The speci�c signal (individual ELISA O.D.) values were collected and plotted as
S/C.O.
(Y-axis) as a function of the ages of the
animals (days after birth) indicating when the samples were collected. The ELISA cut-off value indicating
seropositivity to IgG anti-HEV is indicated as a dotted line at 1.0 based on the commercial Wantai ELISA assay
standard. Chapter V — Figure 2 (p. 196): Serum levels of liver enzymes over time in the prospective study in
calves from the time of birth to 6 months of age. Serum samples were collected weekly from each calf
beginning with the day of birth and continuing prospectively until approximately 6 months of age. Serum levels
of liver enzymes including (A) aspartate aminotransferase (AST), (B) glutamate dehydrogenase (GLDH), and
(C) gamma-glutamyl transferase (GGT) were measured in each serum samples at the Cornell University Animal
Health Diagnostic Center. Normal limits of each enzyme were provided with the analysis based on the
diagnostic laboratory’s standards for each speci�c test, which are indicated on each scatterplot graph as a
dotted line. Each sample indicates an individual calf serum sample for each time point and are expressed as
the mean +/- SEM. Analysis was completed using two-way ANOVA. Chapter V — Figure 3 (p. 197): Correlation
between seroconversion and serum levels of GLDH in serum samples collected prospectively from calves from
the time of birth to 6 months of age. Calves (A) #5078, (B) 5082, (C) 5083, (D) 5086, and (E) 5091
seroconversion to IgG anti-HEV correlated with the elevations in serum levels of GLDH. The speci�c signal
(individual ELISA O.D.) values were plotted as S/C.O. (left
y-axis) as a function of the age of the
animal (days after birth). The ELISA cut-off value indicating seropositivity to IgG anti-HEV is indicated as a
dotted line at 1.0 based on the commercial Wantai ELISA assay standard. The serum levels of GLDH were
plotted (right
y-axis) as a function of the age of the
animal (days after birth). The upper normal limit was provided with the analysis based on the diagnostic
laboratory’s standard for GLDH in bovine species and indicated as the dotted line at 83 u/L. xviii GENERAL
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 30/156
INTRODUCTION Hepatitis E virus (HEV), the causative agent of hepatitis E, is a fecal-orally transmitted virus (1)
and an important disease of public health concern worldwide (2-4). In developing regions of the world, poor
sanitary conditions lead to acute outbreaks due to contaminated food or water (5, 6), while here in the United
States and other industrialized countries, sporadic and autochthonous cases of hepatitis E prevail (7, 8).
Mortality rates for acute infections range from 0.5-4% with the majority of immunocompetent individuals
clearing the infection with limited clinical signs (5). However, HEV-infected pregnant women may reach a
mortality rate of 28-30% and experience complications including death of the fetus and mother, abortion, and
premature birth (9, 10). Likewise, immunocompromised individuals (11) such as solid organ transplant
recipients (12-14) or those with concurrent HIV/AIDS (15), other viral hepatitis infections (16), or
lymphosarcoma (17, 18) experience progressive disease with the development of chronic HEV infections.
Recently, progressive hepatitis E disease has emerged in a new extrahepatic manifestation as a neurological
disorder (19-23). The underlying mechanisms leading to increased severity of disease and hepatic damage in
these poplulations are not well understood and necessitate the identi�cation of animal models to replicate all
outcomes of HEV infection. HEV is a single-stranded, positive-sense RNA virus classi�ed as a Hepevirus in the
family Hepeviridae (24), which consists of eight genotypes, including four genotypes affecting the human
population. The genus Orthohepevirus A includes
genotypes 1 and 2 that infecting humans (25), and genotypes 3 and 4
that are zoonotic in nature and infect humans (4, 5) and a wide range of animal species including swine (26-
29), and rabbits (30-32). Numerous animal species serve as natural hosts and reservoirs for HEV with genetic
identi�cation in rats (33, 34), wild and domestic swine (35, 36), mongoose (37), rabbits (30-32), chickens (38-
40), ferrets (41), cutthroat trout (42), xix bats (43), deer (35, 44, 45), moose (46), and camel (47), with an ever-
expanding host range. However, swine remain the primary reservoir for HEV (48, 49) and zoonotic genotype 3
HEVs are de�nitely linked to human cases through direct contact with infected animals (50-52) or consumption
of contaminated animal products (2, 53-56). Ruminant species including bovine (57- 59), sheep (60, 61), and
goats (62) have been implicated as reservoirs due to the identi�cation of IgG antibodies binding to HEV in
serum; however, the virus has not yet been de�nitively genetically identi�ed from these species. The ability to
control HEV relies on identifying all reservoir species and methods of transmission and addressing the effect
on the human food chain. Additionally, the lack of an adequate animal model to assess pathogenesis of
disease, the course of infection seen in humans infected with HEV, and immune parameters important during
infection led the focus for this dissertation. xx REFERENCES 1. Purcell R, Emerson, S.U. 2001. Hepatitis E Virus,
p 3051-3061. In
Knipe D, Howley P, Gri�n D, Lamb R, Martin M, Roizman B, Straus S
(ed), Fields Virology 4th ed. Lippincott: Williams and Wilkins, Philadelphia, PA. 2.
Meng X-J. 2013. Zoonotic and foodborne transmission of hepatitis E virus. Semin Liv Dis 33:41-49. 3. Emerson
S, Purcell R.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 31/156
2007. Hepatitis E. Pediatr Infect Dis J 26:1147-
1148. 4. Emerson S, Purcell R.
2003. Hepatitis E virus. Rev Med Virol 13:145-154.
5.
Meng XJ. 2010. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol
140:256-265.
6. Yugo DM, Meng XJ. 2013. Hepatitis E virus: foodborne, waterborne and zoonotic transmission.
Int J Environ Res Public Health 10:4507-4533. 7. Dalton H, Bendall, RP, Rashid, M, et al. 2011. Host risk factors
and autochthonous hepatitis e infection. Eur J Gastroenterol Hepatol 23:1200-1205. 8. Dalton H, Bendall R, Ijaz
S, Banks M. 2008. Hepatitis E: an emerging infection in developed countries. Lancet Infect Dis 8:698-709. 9.
Navaneethan U. 2009. Seroprevalence of hepatitis E infection in pregnancy - more questions than answers.
Indian J Med Res 130:677-679. 10. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy:
understanding the pathogenesis. Liver Int 28:1190-1199. 11. Singh A, Seth R, Gupta A, Shalimar, Nayak B,
Acharya SK, Das P. 2016. Chronic hepatitis E - an emerging disease in an immunocompromised host.
Gastroenterol Rep (Oxf) doi:10.1093/gastro/gow024.
12. Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pischke S, Chauvet C, Dumortier J, Cannesson A, Cassuto-
Viguier E, Thervet E, Conti F, Lebray P, Dalton HR, Santella R, Kanaan N, Essig M, Mousson C, Radenne S, Roque-
Afonso AM, Izopet J, Rostaing L. 2011. Factors associated with chronic hepatitis in patients with hepatitis E virus
infection who have received solid organ transplants. Gastroenterol 140:1481-1489. 13. Kamar N,
Mansuy JM, Cointault O, Selves J, Abravanel F, Danjoux M, Otal P, Esposito L, Durand D, Izopet J, Rostaing L.
2008. Hepatitis E virus-related cirrhosis in kidney- and kidney-pancreas-transplant recipients. Am J Transplant
8:1744-1748. 14. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H, Reimerink JH, Koopmans
MP. 2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-553.
15. Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. 2009. Persistent carriage of hepatitis E virus in
patients with HIV infection. N Engl J Med
361:1025-1027. 16. Péron J, Dalton H, Izopet J, Kamar N. 2011. Acute autochthonous hepatitis E in western
patients with underlying chronic liver disease: a role for ribavirin? J Hepatol 54:1323. 17. le Coutre P, Meisel H,
Hofmann J, Röcken C, Vuong G, Neuburger S, Hemmati P, Dörken B, Arnold R. 2009. Reactivation of hepatitis E
infection in a patient with acute lymphoblastic leukaemia after allogeneic stem cell transplantation. Gut
58:699-702. 18.
Ollier L, Bigaillon C, Tieulie N, Tesse S, Heudier P, Sanderson F, Giordanengo V, Nicand E, Fuzibet J-G. 2009.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 32/156
[Hepatitis E initially serologically silent with prolonged evolution in a patient treated for a lymphoma]. Presse
Med 38:1700-1704. xxi 19. McLean BN, Gulliver J, Dalton HR. 2017. Hepatitis E virus and neurological
disorders. Pract Neurol 17:282-288. 20.
Kamar N, Bendall RP, Peron JM, Cintas P, Prudhomme L, Mansuy JM, Rostaing L, Keane F, Ijaz S, Izopet J,
Dalton HR. 2011. Hepatitis E virus and neurologic disorders. Emerg Infect Dis
17:173-179. 21. Ripellino P, Norton B, van Eijk J, Dalton HR. 2018. Non-traumatic neurological injury and
hepatitis E infection. Expert Rev Anti Infect Ther 16:255-257. 22. Sanchez Azofra M, Romero Portales M,
Tortajada Laureiro L, Garcia-Samaniego J, Mora Sanz P. 2018. Hepatitis E virus in neurological disorders: a
case of Parsonage-Turner syndrome. Rev Esp Enferm Dig 110:402-403. 23. Zheng X, Yu L, Xu Q, Gu S, Tang L.
2018. Guillain-Barre syndrome caused by hepatitis E infection: case report and literature review. BMC Infect Dis
18:50. 24.
Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H, Van der Poel WHM, Smith DB, Ictv
Report C. 2017. ICTV Virus Taxonomy Pro�le: Hepeviridae. J Gen Virol 98:2645-2646. 25. Meng X, Halbur P,
Haynes J, Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental infection of pigs with the
newly identi�ed swine hepatitis E virus (swine HEV), but not with human strains of HEV. Arch Virol 143:1405-
1415. 26.
Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B,
Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci
U S A 94:9860-9865. 27. Leblanc D, Ward P, Gagne MJ, Poitras E, Muller P, Trottier YL, Simard C, Houde A. 2007.
Presence of hepatitis E virus in a naturally infected swine herd from nursery to slaughter. Int J Food Microbiol
117:160-166.
28. de Deus N, Casas M, Peralta B, Nofrarías M, Pina S, Martín M, Segalés J. 2008. Hepatitis E virus infection
dynamics and organic distribution in naturally infected pigs in a farrow-to-�nish farm. Vet Microbiol 132:19-28.
29.
Feagins A, Opriessnig T, Huang Y, Halbur P, Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free
pigs by a genotype 4 strain of human hepatitis E virus. J Med Virol 80:1379-1386. 30. Cossaboom C, Cordoba
L, Dryman B, Meng X-J. 2011. Hepatitis E virus in rabbits, Virginia, USA. Emerg Infect Dis 17:2047-2049. 31.
Izopet J, Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar N, Abravanel F, Guerin JL.
2012.
Hepatitis E virus strains in rabbits and evidence of a closely related strain in humans, France.
Emerg Infect Dis 18:1274-1281. 32. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C, Qiao Z, Fan J, Ma H, Li M, Song
A, Wang Y. 2009. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J Med Virol
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 33/156
81:1371-1379. 33. Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. 2011.
Novel hepatitis E virus genotype in Norway rats, Germany. Emerg Infect Dis 16:1452-1455. 34. Lack J, Volk K,
Van Den Bussche R. 2012.
Hepatitis E virus genotype 3 in wild rats, United States.
Emerg Infect Dis 18:1268-1273. 35. Sonoda H, Abe M, Sugimoto T, Sato Y, Bando M, Fukui E, Mizuo H,
Takahashi M, Nishizawa T, Okamoto H. 2004. Prevalence of hepatitis E virus (HEV) Infection in wild xxii boars
and deer and genetic identi�cation of a genotype 3 HEV from a boar in Japan. J Clin Microbiol 42:5371-5374.
36. Takahashi M, Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H. 2011.
Analysis of the full- length genome of a hepatitis E virus
isolate obtained from a wild boar in Japan that is classi�able into a novel genotype. J Gen Virol 92:902-908. 37.
Nidaira M, Takahashi K, Ogura G, Taira K, Okano S, Kudaka J, Itokazu K, Mishiro S, Nakamura M. 2012.
Detection and phylogenetic analysis of hepatitis E viruses from mongooses in Okinawa, Japan.
J Vet Med Sci 74:1665-1668. 38. Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. 2001. Genetic
identi�cation and characterization of a novel virus related to human hepatitis E virus from
chickens with hepatitis-splenomegaly syndrome in the United States.
J Gen Virol 82:2449-2462. 39. Huang F, Haqshenas G, Shivaprasad H, Guenette D, Woolcock P, Larsen C,
Pierson F, Elvinger F, Toth T, Meng X. 2002. Heterogeneity and seroprevalence of a newly identi�ed avian
hepatitis e virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 40. Marek
A, Bilic I, Proko�eva I, Hess M. 2010. Phylogenetic analysis of avian hepatitis E virus samples from European
and Australian chicken �ocks supports the existence of a different genus within the Hepeviridae comprising at
least three different genotypes. Vet Microbiol 145:54-61. 41. Raj V, Smits S, Pas S, Provacia L, Moorman-Roest
H, Osterhaus A, Haagmans B. 2012. Novel hepatitis E virus in ferrets, the Netherlands. Emerg Infect Dis
18:1369-1370. 42. Batts W, Yun S, Hedrick R, Winton J. 2011. A novel member of the family Hepeviridae from
cutthroat trout (Oncorhynchus clarkii). Virus Res 158:116-123. 43. Drexler J, Seelen A, Corman V, Fumie Tateno
A, Cottontail V, Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A,
Rasche A, Adam A, Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis E
virus-related viruses that form a putative novel genus within the family Hepeviridae. J Virol 86:9134-9147. 44.
Matsuura Y, Suzuki M, Yoshimatsu K, Arikawa J, Takashima I, Yokoyama M, Igota H, Yamauchi K, Ishida S,
Fukui D, Bando G, Kosuge M, Tsunemitsu H, Koshimoto C, Sakae K, Chikahira M, Ogawa S, Miyamura T, Takeda N,
Li TC. 2007. Prevalence of antibody to hepatitis E virus among wild sika deer, Cervus nippon, in Japan. Arch
Virol 152:1375-1381.
45. Tomiyama D, Inoue E, Osawa Y, Okazaki K. 2009. Serological evidence of infection with
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 34/156
hepatitis E virus among wild Yezo -deer, Cervus nippon yesoensis, in Hokkaido, Japan.
J Viral Hepat 16:524-528. 46.
Lin J, Norder H, Uhlhorn H, Belak S, Widen F. 2014. Novel hepatitis E like virus found in Swedish moose. J Gen
Virol 95:557-570.
47. Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. 2017. Hepatitis E Virus Genotypes and Evolution:
Emergence of Camel Hepatitis E Variants. Int J Mol Sci 18. 48.
Pavio N, Meng X-J, Renou C. 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res
41:46.
49. Halbur PG,
Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng
XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a
human. J Clin Microbiol 39:918-923.
xxiii
50. Bouwknegt M, Engel B, Herremans M, Widdowson M, Worm H, Koopmans M, Frankena K,
de Roda Husman A, De Jong M, Van Der Poel W. 2008. Bayesian estimation of hepatitis E virus
seroprevalence for populations with different exposure levels to swine in The Netherlands. Epidemiol Infect
136:567-576. 51.
Meng X,
Wiseman B, Elvinger F, Guenette D, Toth T, Engle R, Emerson S, Purcell R. 2002.
Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the
United States and other countries. J Clin Microbiol 40:117-
122. 52. Vulcano A, Angelucci M, Candelori E, Martini V, Patti AM, Mancini C, Santi AL, Calvani A, Casagni L,
Lamberti A. 2007. HEV prevalence in the general population and among workers at zoonotic risk in Latium
Region. Ann Ig 19:181-186.
53. Colson P, Borentain P, Queyriaux B, Kaba M, Moal V, Gallian P, Heyries L,
Raoult D, Gerolami R. 2010. Pig liver sausage as a source of hepatitis E virus transmission to humans. J Infect
Dis 202:825-834. 54. Meng X-J. 2011. From barnyard to food table: the omnipresence of hepatitis E virus and
risk for zoonotic infection and food safety. Virus Res 161:23-30.
55. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004. Routes of
transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-5052.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 35/156
56. Feagins AR, Opriessnig T, Guenette DK, Halbur PG, Meng XJ. 2007. Detection and characterization of
infectious Hepatitis E virus from commercial pig livers sold in local grocery stores in the USA. J Gen Virol
88:912-7. 57. Vitral CL, Pinto MA, Lewis-Ximenez LL, Khudyakov YE, dos Santos DR, Gaspar AM. 2005.
Serological evidence of hepatitis E virus infection in different animal species from the Southeast of Brazil.
Mem Inst Oswaldo Cruz 100:117-122. 58. Yan B,
Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang M, Xu A. 2016. Hepatitis E Virus
in Yellow Cattle, Shandong, Eastern China. Emerg Infect Dis 22:2211- 2212.
59.
Zhang W, Shen Q, Mou J, Gong G, Yang Z, Cui L, Zhu J, Ju G, Hua X. 2008. Hepatitis E virus infection among
domestic animals in eastern China. Zoonoses Public Hlth 55:291-
298. 60. Chang Y, Wang L, Geng J, Zhu Y, Fu H, Ren F, Li L, Wang X, Zhuang H. 2009.
Zoonotic risk of hepatitis E virus (HEV): A study of HEV infection in animals and humans in suburbs of Beijing.
Hepatol Res 39:1153-1158.
61.
El-Tras W, Tayel A, El-Kady N. 2012. Seroprevalence of hepatitis E virus in humans and
geographically matched food animals in Egypt. Zoonoses Public Hlth 60:244-251.
62. Sanford BJ, Emerson SU, Purcell RH, Engle RE, Dryman BA, Cecere TE, Buechner- Maxwell V, Sponenberg
DP, Meng XJ. 2012. Serological Evidence for a Hepatitis E Virus-Related Agent in Goats in the United States.
Transbound Emerg Dis 60:538-545. xxiv Chapter I: Hepatitis E Virus: Foodborne, Waterborne, and Zoonotic
Transmission Danielle M. Yugo and Xiang-Jin Meng
Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Polytechnic
Institute and State University, 1981 Kraft Drive, Blacksburg, VA 24061-0913,
U.S.A. International Journal of Environmental Research and Public Health. 2013; Sep; 10(10): 4507- 4533. ©
2013
by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed and
reprinted under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).
ABSTRACT Hepatitis E virus (HEV) is responsible for epidemics and endemics of acute hepatitis in humans
mainly through waterborne, foodborne, and zoonotic transmission routes. HEV is a single- stranded, positive-
sense RNA virus classi�ed in the family Hepeviridae and encompasses four known genotypes (1-4), at least
two new putative genotypes of mammalian HEV, and one �oating genus of avian HEV. Genotypes 1 and 2 HEVs
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 36/156
only affect humans, while genotypes 3 and 4 are zoonotic and responsible for sporadic and autochthonous
infections in both humans and several other animal species worldwide. HEV has an ever-expanding host range
and has been identi�ed in numerous animal species. Swine serve as a reservoir species for HEV transmission
to humans; however, it is likely that other animal species may also act as reservoirs. HEV poses an important
public health concern with cases of the disease de�nitively linked to handling of infected pigs, consumption of
raw and undercooked animal meats, and animal manure contamination of drinking or irrigation water.
Infectious HEV has been identi�ed in numerous sources of concern including animal feces, sewage water,
inadequately-treated water, contaminated shell�sh and produce, as well as animal meats. Many aspects of
HEV pathogenesis, replication, and immunological responses remain unknown, as HEV is an extremely
understudied but important human pathogen. This article reviews the current understanding of HEV
transmission routes with emphasis on food and environmental sources and the prevalence of HEV in animal
species with zoonotic potential in humans. Keywords: hepatitis E virus; HEV; zoonosis; animal reservoir;
foodborne transmission; zoonotic transmission; waterborne transmission 1. Introduction Hepatitis E virus
(HEV), the causative agent of hepatitis E in humans, is an important public health disease in many parts of the
world [1,2,3,4]. Transmission is primarily via fecal-oral route through contaminated food or water [5]. In
developing countries in Asia and Africa, poor sanitation conditions lead to outbreaks of acute hepatitis E;
however, sporadic and autochthonous cases of hepatitis E also occur throughout many industrialized countries
in Europe, Asia, and North America [6,7].In humans, the mortality rate ranges from 0.5–4%for
immunocompetent individuals, however, mortality in HEV-infected pregnant women can reach up to 20% and
immunocompromised individuals may develop a chronic HEV infection [8,9]. In addition to humans, HEV has
been identi�ed in numerous other animal species including wild and domestic swine, deer, chicken, mongoose,
rat, ferret, �sh, and rabbits with an ever-expanding host range [1,7,10]. Hepatitis E is now a recognized zoonotic
disease with swine and likely other animals serving as the reservoir for human infections [1,8]. Food safety
associated with HEV contamination is an important public health concern with the recent identi�cation of
infectious HEV in meat and meat products and resultant sporadic cases of foodborne hepatitis E in the human
population [3,11,12,13,14]. This review article discusses the public and environmental health concerns and
risks associated with HEV infection with an emphasis on foodborne and zoonotic transmissions. 2. HEV
Classi�cation and Biology 2.1. Classi�cation HEV belongs to the genus Hepevirus in the family Hepeviridae
and consists of four recognized genotypes and at least two putative new genotypes [5]. Genotype 1 causes
large outbreaks of acute 3 hepatitis E in humans in Asia. Genotype 2 causes outbreaks in humans and includes
one Mexican strain and several African strains. Genotype 3 is associated with sporadic, cluster, and chronic
cases of hepatitis E in humans, mostly in industrialized countries. Genotype 3 HEV is known to be zoonotic and
has also been isolated from domestic and wild swine, deer, mongoose, rats, and rabbits [12,15,16,17,18,19].
Genotype 4HEV is also zoonotic and is associated with sporadic cases of hepatitis E in humans and infects
wild and domestic swine and reportedly cattle and sheep [1,5]. Avian HEV from chickens only shares
approximately 50% nucleotide sequence identity with mammalian HEV; therefore, avian HEV likely represents a
separate genus [20].The genus Avihepevirus has recently been proposed to include all three known genotypes
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 37/156
of avian HEV in chickens (genotype 1 in Australia and Korea, genotype 2 in the United States, and genotype 3 in
Europe and China) [1,21,22]. The recently-identi�ed rat HEV shares approximately 59.9% and 49.9% sequence
identities with human and avian HEV, respectively, while the ferret HEV shares the highest sequence identity
with rat HEV at 72.3% [18,23]. The genus Orthohepevirus has recently been proposed to encompass both the
rat and ferret strains of HEV as well as a novel wild boar HEV strain recovered in Japan that differed from the
known genotypes 1-4 HEV isolates by 22.6–27.7%in nucleotide sequence identity [1,24]. A bat HEV was
recently identi�ed from African, Central American, and European bats, and due to high sequence diversi�cation
from known HEV isolates at 47% amino acid sequence identity, the bat HEV forms a novel phylogenetic clade
[25]. The genus Chiropteranhepevirus has been proposed to include all variants of the bat HEV [1]. Finally, a
strain of HEV was also identi�ed in cutthroat trout in the United States with only 13–27% sequence homology
with mammalian or avian hepeviruses leading to a proposal of another tentative genus, Piscihepevirus, within
the Hepeviridae family [1,26]. The nomenclature of HEV will need to be modi�ed in the near future as more
genetically-divergent animal strains of HEV are identi�ed. 2.2. HEV Biology The
genome of HEV is a single-stranded, positive-sense, RNA molecule of approximately 7.
2kb in size [3,4,27].The genome consists of three open reading frames (ORFs), a 5’ non-coding region (NCR),
and a 3’ NCR [10]. ORF1 encodes non-structural proteins with conserved domains functioning as a
methyltransferase, helicase, RNA-dependent RNA polymerase (RdRp), and a papain-like cysteine protease
[20,28]. In addition, a hypervariable region (HVR) within ORF1 may play a role in viral pathogenesis despite
being shown to have no in�uence on viral infectivity [29]. ORF2 encodes the immunogenic capsid protein,
which interacts with 3’viral genomic RNA for encapsidation and contains an endoplasmic reticulum signal
peptide and 3 N-glycosylation sites [30,31]. ORF3 encodes a small phosphoprotein with incompletely
understood functions; however, the association with cytoskeleton and its necessity for in vivo viral infection in
rhesus macaques suggests that ORF3 plays a role in viral replication and assembly [20,32,33]. Avian HEV is
genetically related to mammalian HEV with conserved genomic organization and function despite a 600 bp
sequence deletion [34,35,36]. The capsid protein of avian HEV contains both unique and conserved antigenic
epitopes in comparison to the human and swine HEV capsid proteins [37]. The HEV replication cycle is
currently not well understood due to a lack of an e�cient cell culture system [38].Heparin sulfate
proteoglycans (HSPGs) likely act as receptors for the attachment of the viral capsid protein, and the heat
shock cognate protein 70 may be involved in HEV entry into the cell [38]. Following uncoating in the cell, the
HEV genomic RNA is likely utilized to translate the non-structural proteins and the viral RdRp is used to
produce progeny 5 virus [38]. Both ORF2 and ORF3 are translated from a bicistronic subgenomic RNA [32,39].
The negative-sense HEV RNA indicative of virus replication is detectable in hepatic and extrahepatic tissues of
experimentally-infected rhesus macaques and swine [38,40]. Post-translational processing of proteins and
mechanisms of virus assembly and release have yet to be fully elucidated, and the viral-host interactions
leading to a disease state are also poorly understood [5,20,38]. Development of a robust cell culture system to
e�ciently propagate HEV in the future should be a priority, and will facilitate our understanding the biology of
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 38/156
this important virus. 3. HEV Pathogenesis 3.1 HEV infection in humans In humans, HEV causes an acute icteric
disease that varies in symptoms from subclinical to fulminant hepatitis [4]. The asymptomatic patient typically
clears the virus rapidly, while the symptomatic patient experiences clinical signs including anorexia,
hepatomegaly, myalgia, jaundice and sometimes abdominal discomfort, nausea, vomiting, and fever [5,41]. In
immunocompromised patients such as organ transplant recipients, lymphoma and leukemia patients, or
patients with HIV infection, the course of disease may progress to a chronic state with cirrhosis of the liver and
persistence of viral shedding [42,43,44,45,46]. Of particular concern is the ability for HEV-infected
immunocompromised individuals to develop clinical disease well after the initial exposure [44,45,46,47].
Currently, chronic HEV infection in immunocompromised individuals is an emerging and signi�cant clinical
problem. Future studies are warranted to identify the immunological correlates and host factors leading to
chronicity. The typical infection begins with an incubation period of 2 weeks to 2 months and a transient
viremia followed by viral shedding in the feces, disappearance of viremia with the onset of clinical signs, and
regression of viral shedding with potential jaundice setting in around 2-3 weeks into the infection [46]. The
severity of HEV infection is considered dose-dependent and host factors such as concurrent hepatic disease
or alcohol overuse may also contribute to the disease course [41]. In studies from France, Germany, the United
Kingdom, and the United States, middle-aged, elderly men were more likely to experience autochthonous HEV
infection; however, the underlying host factors have not been understood [48,49,50,51]. Of major concern is the
relationship between pregnancy and increased mortality rates up to 20% in HEV endemic regions; however, this
relationship appears to be geographically dependent and may be associated with other underlying factors such
as virus genotype or concurrent infections with other pathogens [4,20,52,53,54]. Complications with concurrent
HEV infection during pregnancy include death of both the mother and fetus, abortion, premature birth, and
death of the baby shortly after birth [55]. Vertical transmission from the mother to fetus was reported in 33% of
cases and HEV RNA was reportedly detected in human colostrum as well [56,57]. Unfortunately it is not
understood why pregnancy resulted in severe hepatitis E manifestation. Understanding the mechanisms of
pregnancy- associated severe hepatitis E, especially fulminant hepatitis E, in the future will help devise
effective preventive measures against this disease. Genotypes 1 and 2 HEV strains are restricted to the human
population, while genotypes 3 and 4 HEV strains infect both humans and other animals with zoonotic
transmission routes. Human to human transmission of HEV is considered rare; although, blood-borne
transmission has been reported via blood transfusion [20,58,59,60]. A comparative study of genotype 3 and 4
HEV- infected individuals in Japan revealed that genotype 4 HEV is associated with a higher level of alanine
aminotransferase (ALT), higher prevalence of clinical infection, higher level of total bilirubin, higher level of
viremia, more frequent fulminant hepatitis development, and overall a more aggressive hepatitis [48]. The
mechanisms of cross-species HEV infection remain poorly understood. Identi�cation of both the viral genetic
elements and host factors that are important for cross-species HEV infection will be the key for devising
strategies to prevent and control zoonotic HEV infections. 3.2 HEV infection in animals Natural and
experimental HEV infections in swine (genotypes 3 and 4) result in a subclinical course of infection with only
mild microscopic lesions in the liver and associated lymph nodes [61,62]. Viremia lasts 1–2 weeks with fecal
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 39/156
virus shedding lasting 3–7 weeks [7,61,62]. HEV infection in swine is age-dependent with up to 86% of the pigs
infected by 18 weeks of age [63]. Additional studies from the United Kingdom, Spain, and Japan further
demonstrated that the highest fecal virus shedding occurred by 10–12 weeks, 13–16 weeks, and 1–3 months
of age, respectively [64,65,66]. Seroconversion to HEV antibodies in swine occurs following the typical waning
in maternal antibody levels around 8–10 weeks of age �rst with IgM anti-HEV antibodies peaking in
conjunction with fecal viral shedding followed by IgG anti-HEV antibodies peaking in conjunction with
clearance of virus from the feces [20,64,65,66].Transmission between swine is fecal-oral with large amounts of
infectious HEV being shed in the feces, and direct contact between animals, with other animals’ excreta, and
with potentially contaminate and water sources in swine facilities contributes to transmission within a herd
[7,67,68,69,70]. Although HEV infection in pigs does not pose a major economical concern in swine production,
the risk of zoonotic transmission to humans is an important public health concern. Therefore, development of
an effective vaccine to immunize susceptible swine herds in the future will minimize the risk of zoonotic
infection and improve pork safety. Avian HEV genotypes 1-3 carry a slightly different course of infection with a
high level of subclinical infection in �ocks and mortality rates up to 0.3–1.0% [36,71,72]. Clinical signs may
include egg drop in some �ocks up to 20%, enlargement of the liver and spleen, and acute death of affected
birds [73]. Post-mortem evaluations show enlarged, hemorrhagic, and focally necrotic livers, in�ammatory
cellular in�ltrations in the liver tissue, serosanguinous abdominal �uid, and regressing ovaries in some affected
birds [73,74]. It appears that avian HEV does not infect humans, and thus is not a concern for food and
environmental safety. Nevertheless, more studies are needed to fully assess the potential of avian HEV cross-
species infection. 4. Epidemiology of HEV Infection HEV is considered hyperendemic in many developing
countries such as India, Bangladesh, Egypt, Mexico, and China. Hyperendemic countries carry an HEV
prevalence of 25% of all non- A, non-B, acute hepatitis cases or have experienced a major waterborne outbreak
of hepatitis E according to the Centers for Disease Control and Prevention [75]. HEV is considered endemic
where there is a prevalence of less than 25% of all reported non-A, non-B acute hepatitis [75]. Endemic
countries include much of Western Europe, the United States, New Zealand, many countries in South America,
much of Asia, and the Middle East [75,76,77]. Trends throughout the world point to continued high anti-HEV
seroprevalence and HEV infection likely due to increases in interest, awareness and surveillance efforts as well
as increased spread among known animal reservoirs and hosts [20,75,76,77,78,79,80,81].Seroprevalence
reports vary dramatically from country to country and study to study with some studies reporting overall
declines in seroprevalence over time, while other yield continued high levels of seroprevalence [80,82,83]. 9
Prevalence of anti-HEV IgG tends to increase with age especially in men [80,84,85,86,87]. Humans and other
animals excrete a considerable amount of virus early in the acute phase of HEV infection and likely contribute
to maintain the cycle of endemicity [76]. The lack of a standardized serological assay further complicated the
interpretation of the sero-epidemiological data. Therefore, development of an FDA-approved diagnostic assay
for HEV should be a priority in the future. 5. Environmental Contamination and Waterborne Transmission 5.1
HEV Transmission from Sewage and Animal Manure Run-off HEV is typically transmitted via fecal-oral route
within an animal species, from animals to humans in infectious body �uids, and from contaminated food or
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 40/156
water sources to humans and other animals. Inadequate disposal and treatment of sewage and contamination
of drinking and irrigation water lead to the many epidemics in developing countries [2,88,89]. Increased rates of
human HEV infection in Turkey and certain countries in Southeast Asia are associated with utilizing untreated
river water for everyday tasks such as bathing, drinking, and disposal of waste products [90,91,92,93].
Environmental catastrophes and annual �ooding are also associated with elevated HEV attack rates especially
in regions where river, pond, or well water use is prevalent [10,92,93,94]. In both industrialized and developing
countries, raw sewage water has been shown to contain infectious HEV strains that are closely related to the
strains circulating in humans(genotypes 1 and 2) and other animals (genotypes 3 and 4) [95,96,97,98,99]. In
the Netherlands, genotype 3 HEV RNA was detected in river water which likely originated from sewage
[100].Run-offs from animal facilities such as hog operations have been implicated in human HEV infections
with the detection of infectious genotype 3 HEV in the animal manure and wastewater [100,101]. Professionals
working in close proximity to swine, swine manure, or sewage may become infected with HEV during
occupational activities [70,100,102,103,104]. For example, swine workers in Valencia, Spain were found to be
5.4 times more likely to be positive for anti-HEV IgG than those not exposed to swine [104]. Utilizing a Bayesian
model to account for imperfections in sero-assays leading to differences in the interpretation of serology
results, Bouwknegt et al [103] found that approximately 11% of swine veterinarians, 6% of non-swine
veterinarians, and 2% of the general population were positive for anti-HEV antibodies. Variation in assays,
validity of serologic tests for determining HEV prevalence, the lack of standardized diagnostic tools, the
potential for multiple routes of transmission, and incompletely understood transmission routes particularly in
small de�ned populations lead to di�culty in assessing the exact risk factors for HEV infection [105,106]. For
example, Vulcano et al [107] identi�ed male housekeepers and speci�c pig breeders as carrying a higher
prevalence of IgG anti-HEV seropositivity than previously identi�ed in Italy and found a 5.5% seropositivity in
subjects from Rieti in comparison to 2.5% from Rome, despite an overall lack of association with swine
contact. In addition, pig farmers and the general population in Sweden were found to have 13% and 9%
seropositivity respectively, which was higher than previously reported for populations in Europe (1-9%) and
contributes to uncertainty in our current knowledge of transmission routes and risk factors for HEV infection
[108]. Again, standardized serological and molecular diagnostic tests are in critical need for the study of HEV
transmission and prevalence. During natural contact routes of transmission, HEV RNA is also detectable in the
urine of infected swine, which likely contributes to the ease of spread in con�ned swine operations and may
pose as an alternate route of exposure for humans [109]. Contaminated water and sewage may serve as
sources for HEV infection in both humans and other animals. Current research indicates the potential for
transmission through these sources; however, further analysis of these sources in regards to all genotypes of
HEV will better assess the overall public health risk. 5.2 Surface Water Contamination and Transmission of
HEV Surface water is easily contaminated by stable fecal-shed viruses such as HEV and acts as a public health
hazard [110]. The quality of surface water directly affects populations utilizing the source since drinking water,
and intensive farming practices lead to higher detection rates of viruses within these sources [110,111]. In
Canada, HEV genotype 3 detected from �eld-grown strawberries shared 99% nucleotide sequence identity with
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 41/156
local swine HEV strains [112,113]. In Slovenia, genotype 3 HEV was recovered from surface waters as well as
from 20% of fecal samples in local pig farms [114]. Typical irrigation practices allow HEV and other enteric and
hepatic viruses to impact surface water quality and elevate the potential for human exposure to pathogens
[115,116]. Contaminated produce may serve as a source for autochthonous HEV cases in non-endemic regions
[112,117]. In all cases of HEV detection in water or produce, the contamination levels were not assessed for
further infectivity of humans or animals. The ability to recover infectious virus both from the local pig farms,
the surface waters, and from produce receiving contaminated water would indicate that the virus is stable
enough to be transmitted in these sources. Therefore, further infectivity studies should be done to assess the
ability to transmit and cause infection especially in cases where the virus contamination levels are low. 5.3
Coastal Water Contamination and Transmission of HEV Coastal waters may also be contaminated by HEV
leading to accumulation of the virus in the digestive tissues of shell�sh, which poses a risk of human infection
through ingestion. Most often, mussels, cockles, and oysters are eaten raw or slightly cooked, and HEV is
stable in both alkaline and acidic environments, frozen for more than 10 years, and remains infectious at up to
60C, suggesting that a raw, rare-cooked, or slightly steamed contaminated seafood may transmit HEV to
consumers [118,119]. Shell�sh have been implicated in an outbreak of HEV occurring aboard a cruise ship in
European waters and HEV has been identi�ed in commercial mussels obtained from three European countries
(Finland, Greece, and Spain) [120,121]. In Scotland, 92% of bivalve mussels collected were tested positive for
HEV RNA with the viral sequences clustering with genotype 3 human and swine HEV [122]. Case reports of
hepatitis E in England, Italy, and France reveal shell�sh consumption as a common source risk factor for HEV
infection [79,123,124]. In addition, genotype 3 swine HEV has been detected in shell�sh in Korea and Japan
[125,126,127]. Travelers to hyperendemic and endemic regions of the world are at an increased risk of
acquiring HEV infection from contaminated water and seafood, but industrialized countries are not exempt
[77]. 6. Foodborne Transmission and Food Safety The meat products from HEV-infected reservoir animal
species are capable of transmitting HEV to humans and are a public health concern [75,76,88]. HEV primarily
replicates in the liver of infected animals; however, extra-hepatic sites of HEV replication have also been
demonstrated in the gastrointestinal tissues, mesenteric and hepatic lymph nodes, and spleen [20].In addition
to the liver tissues, HEV RNA has been detected from the stomach, kidney, salivary glands, tonsils, lungs, and
multiple muscle masses of pigs and chickens when inoculated intravenously [128,129,130]. Consumption of
undercooked or raw organs or tissues from infected swine has been linked to numerous cases of hepatitis E
worldwide. For example, three cases of hepatitis E in Japan were associated with the consumption of
undercooked or raw pork presumably from the same barbeque restaurant [131]. Nine of ten clinical cases of
hepatitis E from 2001 to 2002 had a history of consuming undercooked pork 2-8 weeks before the onset of
clinical signs and 1.9% of pig livers tested from local groceries in Hokkaido, Japan were positive for genotype 3
or 4 HEV RNA [13]. Consumption of pig liver or intestines is considered as a risk factor for HEV infection [131].
Cases of hepatitis E in Japan were also linked to the consumption of contaminated wild boar meat
[132,133,134,135].Wild boar populations in Italy and South-eastern France had detectable levels of HEV RNA in
2.5% of liver samples and 25% of bile samples, respectively [136,137]. Boar meat consumption was positively
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 42/156
associated with HEV infection in a case-control study in Germany [138]. Cases of acute hepatitis E associated
with genotype 4 HEV have been con�rmed in South Korea, presumably due to the consumption of raw wild
boar bile juice [139]. Human patients with acute HEV infections in France were linked to the consumption of
�gatellu sausage (Corsican raw pig liver dish). The HEV sequences recovered from the �gatellu products in
local grocery stores were essentially indistinguishable from the viral sequences recovered from the human
patients, thus providing compelling evidence for foodborne HEV transmission [11,140]. The HEV present in the
pig liver sausage from manufacturers in France was shown to be infectious utilizing a 3D HEV cell-culture
system [141]. Commercial pig livers tested in the United States, Germany, and the Netherlands also carried
detectable levels of HEV RNA in 11%, 4%, and 6.5% of the samples tested, respectively [142,143,144]. At
slaughterhouses in Bavaria, Germany, 68.6% of the serum samples and 67.6% of meat juice samples were
tested seropositive for HEV antibody, indicating animal exposures to HEV prior to slaughter [145]. In Italy, an
overall 87% anti-HEV seropositivity was detected in slaughterhouse swine and 64.6% were positive for HEV
RNA indicating both a high level of exposure to HEV and a similarly high level of active virus infection at the
time of slaughter [146]. Similar investigations of pork production chains in the Czech Republic, Spain, and the
United Kingdom revealed detectable, infectious HEV at both processing locations and point of sale
[147].Genotype 4 HEV has also been identi�ed in a small percentage of pig livers collected from markets in
India and carry a 90–91% nucleotide sequence identity with the local swine HEV isolates [148]. Other reports
identify Indian strains of genotype 4 swine HEV as genetically distinct from genotype 1 human HEV strains
circulating in the region further convoluting the route of transmission [149]. Human consumption of genotype 4
HEV- contaminated pork livers leading to disease has not yet been reported in India, which may be due to
differing culinary habits [11,140]. It is likely that the genotype 4 swine HEV in India does cause sporadic cases
of acute hepatitis E in humans through zoonotic infection, although such rare and sporadic cases of genotype
4 hepatitis E may be masked by the more prevalent and explosive form of genotype 1 hepatitis E in India. In
addition to pork, game meats such as deer have also been implicated as sources for HEV transmission to
humans following the detection of near identical HEV sequences from leftover Sika deer meat and four
hepatitis E patients in Japan who previously consumed the deer meat as sushi [14,20,150]. A locally caught
wild deer carried a nearly identical HEV isolate that was later con�rmed in local wild boar populations in Japan
as well [150]. Sashimi style deer meat is usually consumed in Japan where a case-control study attributed raw
deer meat as a risk factor for anti- HEV seropositivity after identifying a positive association between deer
meat consumption and a previous case of hepatitis E [14,151]. Elevated risks indicate that within this de�ned
case-control population, those who consumed raw deer meat were more likely to be positive for HEV
antibodies indicating exposure to the virus, while those who did not consume the deer meat had a lower level
of exposure based on seropositivity [14,151]. Consumption of game meats including wild boar, deer, and hare
was independently associated with HEV infection in organ transplant recipients in France with an odds ratio of
2.32 [152]. Combined, these studies clearly identify wild and domestic pork products and game meats as
sources for human HEV infection and implicate foodborne transmission as a common route for HEV infection.
7. Known and Potential Animal Reservoirs A number of animals are known to serve as the natural hosts and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 43/156
reservoirs for HEV. HEV has been genetically identi�ed from rat, wild boar, domestic swine, mongoose, rabbits,
chickens, ferrets, cutthroat trout, bats, and deer [17,18,19,23,25,26,34,61,139,153
].Anti-HEV antibodies have been detected in a number of other animal species including
cattle, sheep, and goats with the potential to carry novel strains of HEV [1,154]. With the advance of modern
molecular biology techniques such as metagenomics and pyrosequencing, it is expected that the host range of
HEV will expand and novel strains of HEV will be identi�ed from other animal species in the near future. 7.1
HEV in Avian Species Avian HEV was identi�ed as such in 2001 from
chickens with Hepatitis-Splenomegaly (HS) syndrome in the United States
[34]. Likewise, Big Liver and Spleen Disease virus (BLSV) in Australia presented similarly with an approximately
80%nucleotide sequence identity to avian HEV [34,73]. These two previously identi�ed syndromes (HS and
BLS) are assumed to be caused 16 by variant strains of the same virus, avian HEV, which now encompasses
three distinct, but related genotypes worldwide [24,73,155,156]. In the United States, an estimated 71% of
chicken �ocks and 30% of individual chickens are positive for avian HEV [36]. Avian HEV infection in chickens
is age-dependent with 17% of seropositive chickens under 18 weeks of age and 36% of seropositive adult
chickens [36,157]. Avian HEV has been shown to cross species barriers and infect turkeys [71]. It is currently
unknown, however, whether avian HEV is capable of transmission to humans or other mammalian species;
although, rhesus monkeys and mice are not susceptible to infection by avian HEV under experimental
conditions [1,73]. 7.2 HEV in Domestic and Wild Swine Species Since its discovery in domestic swine in the
United States in 1997, swine HEV strains have been identi�ed worldwide in both domestic and wild swine with
widely variable prevalence [11,61]. Studies of prevalence across Japan revealed that anti-HEV antibody is
present in 93% of all domestic swine farms tested and that all swine HEV isolates belong to either genotype 3
or 4 [24,48,158,159]. Prevalence of anti-HEV antibodies in wild boars in Japan is also widely variable ranging
from 4.5% to 34.3% based on geographic regions with genotype 3 or 4 HEV RNA detection rates ranging from
1.1% to 13.3% [48]. In the Netherlands, domestic swine farms carried a prevalence of 55% for HEV RNA in the
feces, while 86.2% and 47.1% of 18-week-old pigs in Canada shed HEV virus in feces and serum, respectively,
with a declination as the pigs aged [63,160]. In Spain, the prevalence of anti-HEV antibodies on commercial
swine farms reached 98%, while the anti-HEV prevalence in New Zealand, Laos and Brazil is90%, 46% and 81%,
respectively [20,161,162,163,164]. The anti-HEV seropositivity in wild boars varied from 17-50.3% with HEV
RNA detected in up to 25% of samples in Germany, Italy, Spain, Australia, and Hungary
[15,136,137,165,166,167]. In the United States, swine HEV infection in pig farms is 17 also widespread, and the
majority of pigs became seropositive to HEV antibodies at approximately 3 months of age [61]. It appears that
genotype 3 or 4 HEV infection in pigs is widespread in the pig population worldwide, thus raising a concern for
zoonotic infection and pork safety. 7.3 HEV in Deer Deer have been implicated both acting as animal reservoirs
for HEV and acting as vehicles for human infection [12,14,20,150]. The Sika and Yezo deer in Japan carried a
3% and 35% anti-HEV seroprevalence respectively, with a positive association with HEV infection in humans
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 44/156
and nearly identical nucleotide sequence identity with HEV strains from local wild boars [7,14,150,168]. In
Hungary, the European roe deer was implicated as a reservoir species for HEV, and in the Netherlands 5% of
red deer were also found positive for antibodies to HEV [165,167,169]. White- tailed deer in Northern Mexico
carried a 62.7% anti-HEV seropositivity [170].Increasing management of deer including feeding, watering,
movement of groups, and fencing for hunting purposes in Mexico offers the ability for pathogens such as HEV
to transfer between groups of deer and humans readily and may serve to disseminate pathogens to animals
within the United States [170]. Sharing of habitats between wild boar and deer may play a role in the ability to
harbor and transmit HEV to humans. However, without additional direct evidence of transmission within the
deer species, it is di�cult to determine whether deer acts as incidental or natural hosts to HEV infection
[1,20,76]. 7.4 HEV in Ruminants Ruminant (cattle, sheep and goat) strains of HEV have yet to be uncovered;
however, multiple studies of anti-HEV seroprevalence indicated the possibility of their existence [7,165]. In
Egypt, 11% of cows, 14% of buffalo, 4.4% of sheep, and 9.4% of goats were tested positive for HEV 18
antibodies [171]. Approximately 4.4–6.9% of cows and 0% of goats in India, 1.4% of cows and 0% of sheep and
goats in Brazil were reportedly tested positive for anti-HEV antibodies [172,173]. Reports of anti-HEV
seropositivity from China varied drastically from 6-93% of cattle and 10- 12% of sheep [174,175,176,177]. A
short sequence (189 bp) of a genotype 4 HEV has been reportedly identi�ed in bovid species, although
independent con�rmation of this unsubstantiated report is still lacking [1,7,76]. Despite the abundant
serological evidence for an HEV-related agent in ruminants, de�nitive genetic identi�cation of HEV from
ruminants is still lacking. It is possible that the strain carried by ruminants is very divergent genetically from the
known HEV strains thus leading to failure to genetically identify the virus based upon current techniques. The
serological data from ruminants is based upon cross-reaction of the ruminant serum samples with known HEV
proteins such as ORF2 [7,165,171,172]. The validity of such serological data has been questioned due to the
fact that the assays may not be speci�c, they do not identify the actual virus, and they may allow cross-
reactivity with non-viral proteins that share a certain level of sequence homology. Research in this area must
continue to better address these concerns and con�rm the source of anti-HEV seropositivity in ruminants.
Given the wide use of cattle, sheep, and goats in the human food chain, the genetic identi�cation of these
ruminant strains of HEV would be of a potential public health concern. 7.5 HEV in Rats The rat strain of HEV
was identi�ed in wild Norway rats from Hamburg, Germany with 59.9% and 49.9% nucleotide sequence identity
with known human and avian HEV strains, respectively [18]. Rats in the United States, Germany, Indonesia,
China, and Japan are also tested seropositive for HEV antibodies in several studies with variable prevalence
[18,178,179,180,181]. 19 Overall, 44% of rats in Louisiana, 77% in Maryland, 90% in Hawaii, 59.7% of rats of the
genus Rattus from across the United States, 32% of Norway rats in Japan, and 13% of black rats in Japan were
tested positive for antibodies to HEV [178,179,182,183]. Most recently in China, 23.3% of rats were positive for
anti-HEV IgG with the highest prevalence of 45.3% from rats caught at garbage dump sites [180]. In Indonesia,
18.1% of rats were tested positive for anti-HEV antibodies and 14.7% positive for HEV RNA [181]. Recently,
genotype 3 rat HEV strains have been genetically detected from wild rats in the United States, suggesting the
potential for zoonotic transmission and the genetic variability of rat HEV [1,182]. Further studies are warranted
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 45/156
to independently con�rm the existence of genotype 3 HEV in rats, especially since, under experimental
condition, laboratory rats are not susceptible to experimental infection by genotype 3 HEV [184]. 7.6 HEV in
Rabbits Rabbits may serve as reservoir hosts for HEV transmission to humans given the genetic identi�cation
of zoonotic genotype 3 strains of HEV from rabbits in China, the United States, and France [17,153,174,185].
Rabbits are susceptible to experimental infection by genotype 4 human HEV, and the infected rabbits
developed viremia, seroconversion to anti-HEV, and fecal virus shedding [153,185]. The rabbit HEV is
genetically and antigenically closely related to other mammalian HEV. The capsid protein of the genotype 3
rabbit strain of HEV was capable of cross- reacting with antibodies from other strains of HEV including rat,
swine, human, and chicken [1,185,186]. The prevalence of HEV antibodies in farmed rabbits is reportedly 57%
in the Gansu province in China, 54.6% in Beijing, China, and 36.5% in two rabbit farms in Virginia, USA, while
HEV RNA has been identi�ed in 7.5%, 7.0%, 16.5%, and 15.3% of the rabbits, respectively [17,153,174]. In
France, HEV RNA was also identi�ed from 7.0% of farmed rabbits, 20 while 23.0% of wild rabbits were also
positive for HEV RNA [185]. It appears that rabbits could be an important reservoir for HEV infection in
humans, and in-depth studies of its ability to infect across species barriers and associated zoonotic risks in the
future are needed. 7.7 HEV in Other Species Other known animal strains of HEV genetically identi�ed thus far
include mongoose, ferret, bat, and �sh [1,23,25,26,187,188]. Wild mongoose in Okinawa, Japan carried
genotype 3 HEV strains and the prevalence of anti-HEV seropositivity varied from8 to21% [187,188]. In the
Netherlands, ferrets carried a strain of HEV that shared a 72.3% nucleotide sequence identity with that of the
rat HEV [23]. The cutthroat trout in the United States also carried a unique strain of HEV with only 13 to 27%
sequence identity with known mammalian and avian HEV strains [26]. The zoonotic potentials of these novel
animal strains of HEV are not altogether understood, but the ever-expanding host range and high levels of anti-
HEV seropositivity among mammalian species suggests transmission is common and thus may pose a
potential public health concern. 8. Animal Handling and Zoonotic Transmission Contact exposure to infected
animals leads to an elevated risk for HEV transmission in humans. Swine veterinarians in the United States
were shown to have a27% seropositivity to genotype 3 swine HEV in comparison to 16% of the normal blood
donors [189]. Individuals from states in which swine production plays a key role were more likely to be
seropositive to HEV than other non-major swine states [189]. Incidents such as needle sticks while working
with swine were found to be1.9 times more likely positive for HEV antibodies in swine veterinarians [189]. Pig
handlers such as veterinarians, breeders, and farmers in China, Thailand, the Netherlands, Sweden, Moldova,
and the United States were also more likely seropositive to swine 21 HEV [103,108,190,191,192]. In Sweden,
13% of pig breeders were positive for antibodies to HEV [190]. In the Netherlands, 11% of swine veterinarians
were positive in comparison to 6% of non-swine veterinarians and 2% of the general population [108]. In North
Carolina, swine handlers carried a 4.5 times higher rate of seropositivity in comparison to non-swine workers
[191]. In Moldova, 51% of swine farmers were positive in comparison to 25% of non-swine occupations [103].
Taken together, swine are a major reservoir for HEV and occupational contact with infected swine is a risk
factor for zoonotic HEV transmission in humans. Contact with swine is the most widely recognized route for
occupational exposure to HEV; however, the multitude of novel strains of HEV in wildlife and other domestic
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 46/156
animal species suggest additional mechanisms of transmission. For example, �eld workers at the Iowa
Department of Natural Resources who work with a variety of wildlife species had a higher prevalence for HEV
antibodies in comparison to normal blood donors [193]. While exposure to HEV, identi�ed by the presence of
anti-HEV antibodies in these populations does not in itself indicate a disease, it does identify a route of
transmission and exposure that should be further assessed and acknowledged as a preventive measure
against this important disease. Examination of these additional mechanisms is vital to understanding the full-
spectrum of public health risk associated with HEV infection. 9. Conclusions The zoonotic risk of HEV is well
established; however, the ever-expanding host range and identi�cation of new animal reservoir species poses a
signi�cant public health concern. Seroprevalence in human and other animal species varies drastically
between studies and countries with no clear understanding of the overall problem, and this is largely due to the
lack of an established FDA-approved serological diagnostic assay. Numerous animal species were tested 22
seropositive for IgG anti-HEV, although HEV was not genetically identi�ed from all seropositive animal species.
Detection of HEV in sewage, water sources, coastal and surface waters, and produce poses environmental
safety concerns even in industrialized countries where waterborne origins of human hepatitis E cases were
previously considered rare. Foodborne cases of hepatitis E in humans are increasingly common and likely
underestimated in the medical community. Sporadic and cluster cases of hepatitis E occur after consumption
of undercooked or raw animal meats. Prevention of foodborne HEV transmission relies on avoiding
consumption of undercooked animal meats especially when immunocompromised, following good hygiene
practices, and being aware of increased risks when traveling to endemic or hyperendemic regions of the world.
Despite the clear risk, prevention strategies are currently minimally implemented. A vaccine against HEV has
recently become available in China but not in other countries. Surveillance, vaccination, de- contamination of
sewage and water sources, and public education will help prevent current and future endemics or epidemics
lowering the human burden. The development of a vaccine against the zoonotic swine HEV would reduce
foodborne and swine contact cases in humans as well as diminish the spread of the virus between animal
species. Control of animal waste, run-off, and decontaminated sewage is key to limiting the spread of HEV to
coastal and surface waters and in turn reducing concomitant contamination of shell�sh. Acknowledgments
The authors’ research on HEV is supported by grants from the National Institutes of Health (R01AI074667, and
R01AI050611).D.M.Y. is supported by a training grant from the National Institutes of Health (T32OD010430-
06). This review article encompasses a comprehensive literature review with a focus on food and
environmental safety and zoonotic risk of HEV. Due to the narrow scope of the topic and space 23 constraints,
many important articles regarding HEV may be unintentionally excluded from this review. We have attempted
to include the most recent publications including review articles in order to provide the reader with up to date
and comprehensive information on the topic.
Con�ict of Interest The authors declare no con�ict of interest.
References and Notes 1. Meng, X.J. Zoonotic and foodborne transmission of hepatitis E virus. Semin. Liver.
Dis. 2013, 33, 41–49. 2. 3. Emerson, S.; Purcell, R. Hepatitis E. Pediatr. Infect. Dis. J. 2007, 26, 1147–1148.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 47/156
Sanford, B.; Dryman, B.; Huang, Y.-W.; Feagins, A.; Leroith, T.; Meng, X.-J. Prior infection of pigs with a genotype
3 swine hepatitis E virus (HEV) protects against subsequent challenges with homologous and heterologous
genotypes 3 and 4 human HEV. Virus Res. 2011, 159, 17–22. 4. 5. Emerson, S.; Purcell, R.
Hepatitis E virus. Rev Med Virol 2003, 13, 145-154.
Meng, X.J.
Hepatitis E virus: animal reservoirs and zoonotic risk. Vet. Microbiol. 2010, 140,
256–265. 6. Dalton, H.; Bendall, R.; Ijaz, S.; Banks, M. Hepatitis E: an emerging infection in developed countries.
Lancet Infect. Dis. 2008, 8, 698–709. 7. Meng, X.J. From barnyard to food table: the omnipresence of hepatitis
E virus and risk for zoonotic infection and food safety. Virus Res. 2011, 161, 23–30. 8. Purcell, R.; Emerson, S.
Hepatitis E: an emerging awareness of an old disease. J. Hepatol. 2008, 48, 494–503.
9. Péron, J.; Dalton, H.; Izopet, J.; Kamar, N. Acute autochthonous hepatitis E in western patients with
underlying chronic liver disease: a role for ribavirin? J. Hepatol. 2011, 54, 1323. 10. Kumar, S.; Subhadra, S.;
Singh, B.; Panda, B. Hepatitis E virus: the current scenario. Int. J. Infect. Dis. 2013, 17, 33. 11. Colson, P.;
Borentain, P.; Queyriaux, B.; Kaba, M.; Moal, V.r.; Gallian, P.; Heyries, L.; Raoult, D.; Gerolami, R. Pig liver sausage
as a source of hepatitis E virus transmission to humans. J Infect. Dis. 2010, 202, 825-834. 12.
Tei, S.; Kitajima, N.; Takahashi, K.; Mishiro, S. Zoonotic transmission of hepatitis E virus from deer to human
beings. Lancet 2003, 362, 371-
373. 13. Yazaki, Y.; Mizuo, H.; Takahashi, M.; Nishizawa, T.; Sasaki, N.; Gotanda, Y.; Okamoto, H. Sporadic acute
or fulminant hepatitis E in Hokkaido, Japan, may be food-borne, as suggested by the presence of hepatitis E
virus in pig liver as food. J. Gen. Virol. 2003, 84, 2351-2357 14.
Takahashi, K.; Kitajima, N.; Abe, N.; Mishiro, S. Complete or near-complete nucleotide sequences of
hepatitis E virus genome recovered from a wild boar, a deer, and four patients who ate the deer. Virology 2004,
330, 501-
505. 15. de Deus, N.; Peralta, B.; Pina, S.; Allepuz, A.; Mateu, E.; Vidal, D.; Ruiz-Fons, F.; Martín, M.; Gortazar, C.;
Segales, J. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain.
Vet. Microbiol. 2008, 129, 163-170. Zhao, C.; Ma, Z.; Harrison, T.J.; Feng, R.; Zhang, C.; Qiao, Z.; Fan, J.; Ma, H.;
Li, M.; Song, A.; Wang, Y. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J. Med.
Virol. 2009, 81, 1371-1379. 17. Cossaboom, C.; Córdoba, L.; Dryman, B.; Meng, X.J. Hepatitis E virus in rabbits,
Virginia, USA. Emerg. Infect. Dis. 2012, 17, 2047–2049. 18. Johne, R.; Heckel, G.; Plenge-Bönig, A.; Kindler, E.;
Maresch, C.; Reetz, J.; Schielke, A.; Ulrich, R. Novel hepatitis E virus genotype in Norway rats, Germany. Emerg.
Infect. Dis. 2011, 16, 1452–1455. 19. Nidaira, M.; Takahashi, K.; Ogura, G.; Taira, K.; Okano, S.; Kudaka, J.;
Itokazu, K.; Mishiro, S.; Nakamura, M.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 48/156
Detection and phylogenetic analysis of hepatitis E viruses from mongooses in Okinawa, Japan.
J. Vet. Med. Sci. 2012, 74, 1665-1668. 20.
Pavio, N.; Meng, X.J.; Renou, C. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet. Res.
2010, 41, 46. 21. Marek, A.; Bilic, I.; Proko�eva, I.; Hess, M. Phylogenetic analysis of avian hepatitis E virus
samples from European and Australian chicken �ocks supports the existence of a different genus within the
Hepeviridae comprising at least three different genotypes. Vet. Microbiol. 2010, 145, 54–61. 22. Kwon, H.;
Sung, H.; Meng, X.J. Serological prevalence, genetic identi�cation, and characterization of the �rst strains of
avian hepatitis E virus from chickens in Korea. Virus Genes 2012, 45, 237–245. 23. Raj, V.; Smits, S.; Pas, S.;
Provacia, L.; Moorman-Roest, H.; Osterhaus, A.; Haagmans, B. Novel hepatitis E virus in ferrets, the
Netherlands. Emerg. Infect. Dis. 2012, 18, 1369–1370. 24. Takahashi, M.; Nishizawa, T.; Sato, H.; Sato, Y.;
Jirintai; Nagashima, S.; Okamoto, H.
Analysis of the full- length genome of a hepatitis E virus
isolate obtained from a wild boar in Japan that is classi�able into a novel genotype. J. Gen. Virol. 2011, 92,
902–908. 25. Drexler, J.; Seelen, A.; Corman, V.; Fumie Tateno, A.; Cottontail, V.; Melim Zerbinati, R.; Gloza-
Rausch, F.; Klose, S.; Adu-Sarkodie, Y.; Oppong, S.; Kalko, E.; Osterman, A.; Rasche, A.; Adam, A.; Müller, M.;
Ulrich, R.; Leroy, E.; Lukashev, A.; Drosten, C. Bats worldwide carry hepatitis E virus-related viruses that form a
putative novel genus within the family Hepeviridae. J. Virol. 2012, 86, 9134–9147. 26. Batts, W.; Yun, S.;
Hedrick, R.; Winton, J. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus clarkii).
Virus Res. 2011, 158, 116–123. 27. Emerson, S.; Nguyen, H.;
Torian, U.; Mather, K.; Firth, A. An essential RNA element resides in a central region of hepatitis E virus
ORF2. J. Gen. Virol. 2013, 94, 1468-76.
28. Koonin, E.; Gorbalenya, A.; Purdy, M.; Rozanov, M.; Reyes, G.; Bradley, D.
Computer- assisted assignment of functional domains in the nonstructural polyprotein of hepatitis E virus:
delineation of an additional group of positive-strand RNA plant and animal viruses. P. Natl. Acad. Sci.
U.S.A. 1992, 89, 8259–8263. Pudupakam, R.; Huang, Y.; Opriessnig, T.; Halbur, P.; Pierson, F.; Meng, X.J.
Deletions of the hypervariable region (HVR) in open reading frame 1 of hepatitis E virus do not abolish virus
infectivity: evidence for attenuation of HVR deletion mutants in vivo. J. Virol. 2009, 83, 384–395. 30.
Surjit, M.; Jameel, S.; Lal, S. Cytoplasmic localization of the ORF2 protein of hepatitis E virus is dependent
on its ability to undergo retrotranslocation from the endoplasmic reticulum. J. Virol.
2007, 81, 3339–3345. 31.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 49/156
Graff, J.; Zhou, Y.-H.; Torian, U.; Nguyen, H.; St Claire, M.; Yu, C.; Purcell, R.; Emerson, S. Mutations
within potential glycosylation sites in the capsid protein of hepatitis E virus prevent the formation of infectious
virus particles. J. Virol. 2008, 82, 1185–1194.
32. Graff, J.; Nguyen, H.; Kasorndorkbua, C.; Halbur, P.; St Claire, M.; Purcell, R.; Emerson, S. In vitro and in vivo
mutational analysis of the 3'-terminal regions of hepatitis e virus genomes and replicons. J. Virol. 2005, 79,
1017–1026. 33. Graff, J.; Nguyen, H.; Yu, C.; Elkins, W.; St Claire, M.; Purcell, R.; Emerson, S. The open reading
frame 3 gene of hepatitis E virus contains a cis-reactive element and encodes a protein required for infection of
macaques. J. Virol. 2005, 79, 6680–6689. 34.
Haqshenas, G.; Shivaprasad, H.; Woolcock, P.; Read, D.; Meng, X.J. Genetic identi�cation and
characterization of a novel virus related to human hepatitis E virus from chickens with hepatitis-splenomegaly
syndrome in the United States. J. Gen. Virol. 2001, 82, 2449– 2462. 35. Huang, F.; Sun,
Z.; Emerson, S.; Purcell, R.; Shivaprasad, H.; Pierson, F.; Toth, T.; Meng, X.J.
Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and
attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 2004, 85, 1609–
1618. 36. Huang, F.F.; Haqshenas, G.; Shivaprasad, H.L.; Guenette, D.K.; Woolcock, P.R.; Larsen, C.T.; Pierson,
F.W.; Elvinger, F.; Toth, T.E.; Meng, X.J. Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e
virus from chickens
in the United States. J. Clin. Microbiol. 2002, 40,
4197–4202. 37. Bouquet, J.; Cherel, P.; Pavio, N. Genetic characterization and codon usage bias of full- length
Hepatitis E virus sequences shed new lights on genotypic distribution, host restriction and genome evolution.
Infect. Genet. Evol. 2012, 12, 1842–1853. 38. Cao, D.; Meng, X.J. Molecular biology and replication of hepatitis
E virus. Emerg. Microbe. Infect. 2012, 1, e17; doi:10.1038/emi.2012.7 39. Graff, J.; Torian, U.; Nguyen, H.;
Emerson, S. A bicistronic subgenomic mRNA encodes both the ORF2 and ORF3 proteins of hepatitis E virus. J.
Virol. 2006, 80, 5919–5926. 40. Meng, X.J.; Halbur, P.; Shapiro, M.; Govindarajan, S.; Bruna, J.; Mushahwar, I.;
Purcell, R.; Emerson, S. Genetic and experimental evidence for cross-species infection by swine hepatitis E
virus. J. Virol. 1998, 72, 9714–9721. Purcell, R.E., S.U., Hepatitis E Virus. In Fields Virology 4th ed.; Knipe, D.,
Howley, P., Gri�n, D., Lamb,R., Martin, M., Roizman, B., et al., Ed. Lippincott: Williams and Wilkins: Philadelphia,
PA, 2001; pp 3051–3061. 42. Kamar, N.; Selves, J.; Mansuy, J.-M.; Ouezzani, L.; Péron , J.-M.; Guitard, J.l.;
Cointault, O.; Esposito, L.; Abravanel, F.; Danjoux, M.; Durand, D.; Vinel, J.-P.; Izopet, J.; Rostaing, L.
Hepatitis E virus and chronic hepatitis in organ-transplant recipients. New Engl. J.
Med. 2008, 358, 811–817. 43. le Coutre, P.; Meisel, H.; Hofmann, J.; Röcken, C.; Vuong, G.; Neuburger, S.;
Hemmati, P.; Dörken, B.; Arnold, R. Reactivation of hepatitis E infection in a patient with acute lymphoblastic
leukaemia after allogeneic stem cell transplantation. Gut 2009, 58, 699–702. 44. Ollier, L.; Bigaillon, C.; Tieulie,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 50/156
N.; Tesse, S.; Heudier, P.; Sanderson, F.; Giordanengo, V.; Nicand, E.; Fuzibet, J.-G. Hepatitis E initially
serologically silent with prolonged evolution in a patient treated for a lymphoma. Presse. Med. 2009, 38, 1700–
1704. 45. Dalton, H.R.; Bendall, R.P.; Keane, F.E.; Tedder, R.S.; Ijaz, S. Persistent carriage of hepatitis E virus in
patients with HIV infection. N. Engl. J. Med. 2009, 361, 1025–1027. 46. Haagsma, E.; van den Berg, A.; Porte,
R.; Benne, C.; Vennema, H.; Reimerink, J.; Koopmans, M. Chronic hepatitis E virus infection in liver transplant
recipients. Liver Transplant. 2008, 14, 547–553. 47.
Teshale, E.H.; Hu, D.J.; Holmberg, S.D. The two faces of hepatitis E virus. Clin. Infect. Dis.
2010, 51, 328-334. 48.
Takahashi, M.; Okamoto, H. Features of hepatitis E virus infection in humans and animals in Japan.
Hepatol. Res. 2013, in press.
doi: 10.1111/hepr.12175. 49. Mansuy, J.M.;
Abravanel, F.; Miedouge, M.; Mengelle, C.; Merviel, C.; Dubois, M.;
Kamar, N.; Rostaing, L.; Alric, L.; Moreau, J.; Peron, J.M.; Izopet, J.
Acute hepatitis E in south-west France over a 5-year period. J. Clin. Virol. 2009, 44, 74–
77. 50. Dalton, H., Bendall, RP, Rashid, M, et al. Host risk factors and autochthonous hepatitis e infection. Eur. J.
Gastroenterol. Hepatol. 2011, 23, 1200–1205. 51. Brost, S.; Wenzel, J.J.; Ganten, T.M.; Filser, M.;
Flechtenmacher, C.; Boehm, S.; Astani, A.; Jilg, W.; Zeier, M.; Schnitzler, P.
Sporadic cases of acute autochthonous hepatitis E virus infection in Southwest Germany. J.
Clin. Virol. 2010, 47, 89–92. 52. Hussaini, S.; Skidmore, S.; Richardson, P.; Sherratt, L.; Cooper, B.; O'Grady, J.
Severe hepatitis E infection during pregnancy. J. Viral. Hepatitis 1997, 4, 51–54. 53. Khuroo, M.; Kamili, S.;
Jameel, S. Vertical transmission of hepatitis E virus. Lancet 1995, 345, 1025–1026. 54. Renou, C.; Pariente, A.;
Nicand, E.; Pavio, N. Pathogenesis of Hepatitis E in pregnancy. Liver Int. 2008, 28, 1465. 55. Mushahwar, I.
Hepatitis E virus: molecular virology, clinical features, diagnosis, transmission, epidemiology, and prevention. J.
Med. Virol. 2008, 80, 646–658. Kumar, A.; Beniwal, M.; Kar, P.; Sharma, J.; Murthy, N. Hepatitis E in pregnancy.
Int. J. Gynecol. Obstet. 2004, 85, 240–244. 57. Chibber, R.; Usmani, M.; Al-Sibai, M. Should HEV infected
mothers breast feed? Arch. Gynecol. Obstet. 2004, 270, 15–20. 58.
Matsubayashi, K.; Kang, J.-H.; Sakata, H.; Takahashi, K.; Shindo, M.; Kato, M.; Sato, S.; Kato, T.; Nishimori, H.;
Tsuji, K.; Maguchi, H.; Yoshida, J.-I.; Maekubo, H.; Mishiro, S.; Ikeda, H. A case of transfusion-transmitted
hepatitis E caused by blood from a donor infected with hepatitis E virus via zoonotic food-borne route.
Transfusion 2008, 48, 1368–1375.
59.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 51/156
Boxall, E.; Herborn, A.; Kochethu, G.; Pratt, G.; Adams, D.; Ijaz, S.; Teo, C.G. Transfusion- transmitted
hepatitis E in a 'nonhyperendemic' country. Transfus. Med. 2006, 16, 79–83.
60. Arankalle, V.; Chobe, L. Retrospective analysis of blood transfusion recipients: evidence for post-transfusion
hepatitis E. Vox Sang. 2000, 79, 72–74. 61. Meng, X.J.; Purcell, R.; Halbur, P.; Lehman, J.; Webb, D.; Tsareva, T.;
Haynes, J.; Thacker, B.; Emerson, S.
A novel virus in swine is closely related to the human hepatitis E virus. P. Natl. Acad. Sci. U.S.A. 1997, 94,
9860–
9865. 62.
Halbur, P.; Kasorndorkbua, C.; Gilbert, C.; Guenette, D.; Potters, M.; Purcell, R.; Emerson, S.; Toth, T.; Meng, X.J.
Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a human. J. Clin.
Microbiol.
2001, 39, 918–923. 63. Leblanc, D.; Ward, P.; Gagné , M.-J.e.; Poitras, E.; Müller , P.; Trottier, Y.-L.; Simard, C.;
Houde, A. Presence of hepatitis E virus in a naturally infected swine herd from nursery to slaughter. Int. J. Food
Microbiol. 2007, 117, 160–166. 64.
de Deus, N.; Casas, M.; Peralta, B.; Nofrarías , M.; Pina, S.; Martín, M.; Segalés, J. Hepatitis E virus infection
dynamics and organic distribution in naturally infected pigs in a farrow-to- �nish farm. Vet. Microbiol.
2008, 132, 19–28. 65. McCreary, C.; Martelli, F.; Grierson, S.; Ostanello, F.; Nevel, A.; Banks, M. Excretion of
hepatitis E virus by pigs of different ages and its presence in slurry stores in the United Kingdom. Vet. Rec.
2008, 163, 261–265. 66.
Nakai, I.; Kato, K.; Miyazaki, A.; Yoshii, M.; Li, T.-C.; Takeda, N.; Tsunemitsu, H.; Ikeda, H. Different fecal
shedding patterns of two common strains of hepatitis E virus at three Japanese swine farms. Am. J.
Trop. Med. Hyg. 2006, 75, 1171–1177. 67. Kasorndorkbua, C.; Opriessnig, T.; Huang, F.; Guenette, D.; Thomas,
P.; Meng, X.J.; Halbur, P. Infectious swine hepatitis E virus is present in pig manure storage facilities on United
States farms, but evidence of water contamination is lacking. Appl. Environ. Microb. 2005, 71, 7831–7837. 68.
Feagins, A.; Opriessnig, T.; Huang, Y.; Halbur, P.; Meng, X.J. Cross-species infection of speci�c-pathogen-free
pigs by a genotype 4 strain of human hepatitis E virus. J. Med. Virol. 2008, 80, 1379–1386. Kasorndorkbua, C.;
Guenette, D.K.; Huang, F.F.; Thomas, P.J.; Meng, X.J.; Halbur, P.G. Routes of transmission of swine
hepatitis E virus in pigs. J. Clin. Microbiol. 2004, 42,
5047– 5052. 70. Bouwknegt, M.; Frankena, K.; Rutjes, S.; Wellenberg, G.; de Roda Husman, A.; van der Poel, W.;
de Jong, M. Estimation of hepatitis E virus transmission among pigs due to contact- exposure. Vet. Res. 2008,
39, 40. 71. Sun, Z.; Larsen, C.; Dunlop, A.; Huang, F.; Pierson, F.; Toth, T.; Meng, X.J. Genetic identi�cation of
avian hepatitis E virus (HEV) from healthy chicken �ocks and characterization of the capsid gene of 14 avian
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 52/156
HEV isolates from chickens with hepatitis- splenomegaly syndrome in different geographical regions of the
United States. J. Gen. Virol. 2004, 85, 693–700. 72. Peralta, B.; Biarnés, M.; Ordóñez, G.; Porta, R.n.; Martín, M.;
Mateu, E.; Pina, S.; Meng, X.J. Evidence of widespread infection of avian hepatitis E virus (avian HEV) in
chickens from Spain. Vet. Microbiol. 2009, 137, 31–36. 73. Meng, X.J.,
Shivaprasad, HL., Payne, C., Hepatitis E Virus infections. In Diseases of Poultry, 12th Edition ed.; Saif,
M., et al, Ed. Blackwell Publishing Press: 2008; pp 443–452. 74. Billam, P.; Huang, F.; Sun, Z.; Pierson, F.;
Duncan, R.; Elvinger, F.; Guenette, D.; Toth, T.; Meng, X.J. Systematic pathogenesis and replication of avian
hepatitis E virus in speci�c- pathogen-free adult chickens. J. Virol. 2005, 79, 3429–3437. 75. Teo, C. Hepatitis
E. In:
Center for Disease Control and Prevention. CDC Health Information for International Travel
2010. US
Department of Health and Human Services: Public Health Service:
Atlanta, GA, 2009; pp 335–337. 76. Teo, C.
Much meat, much malady: changing perceptions of the epidemiology of hepatitis E. Clin. Microbiol. Infect.
2010, 16, 24–32.
77. Zuckerman, J.
Hepatitis E and the traveler. Travel Med. Infect. Dis. 2003, 1, 73–
76. 78. Buti, M.; Dominguez, A.; Plans, P.; Jardi, R.; Schaper, M.; Espunes, J.; Cardenosa, N.; Rodriguez-Frias, F.;
Esteban, R.; Plasencia, A.; Salleras, L. Community-based seroepidemiological survey of hepatitis E virus
infection in Catalonia, Spain. Clin. Vaccine Immunol. 2006, 13, 1328-1332 79.
Ijaz, S.; Arnold, E.; Banks, M.; Bendall, R.P.; Cramp, M.E.; Cunningham, R.;
Dalton, H.R.; Harrison, T.J.; Hill, S.F.; Macfarlane, L.; Meigh, R.E.; Sha�, S.; Sheppard, M.J.; Smithson, J.; Wilson,
M.P.; Teo, C.G. Non-travel-associated hepatitis E in England and Wales: demographic, clinical, and molecular
epidemiological characteristics. J. Infect. Dis. 2005, 192, 1166-1172. 80. Fukuda, S.; Ishikawa, M.; Ochiai, N.;
Suzuki, Y.; Sunaga, J.; Shinohara, N.; Nozawa, K.; Tsuda, F.; Takahashi, M.; Okamoto, H. Unchanged high
prevalence of antibodies to hepatitis E virus (HEV) and HEV RNA among blood donors with an elevated alanine
aminotransferase level in Japan during 1991-2006. Arch. Virol. 2007, 152, 1623-1635. Mansuy, J.M.; Bendall, R.;
Legrand-Abravanel, F.; Saune, K.; Miedouge, M.; Ellis, V.; Rech, H.; Destruel, F.; Kamar, N.; Dalton, H.R.; Izopet, J.
Hepatitis E virus antibodies in blood donors, France. Emerg. Infect. Dis. 2011, 17, 2309-2312. 82. Christensen,
P.B.; Engle, R.E.; Hjort, C.; Homburg, K.M.; Vach, W.; Georgsen, J.; Purcell, R.H. Time trend of the prevalence of
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 53/156
hepatitis E antibodies among farmers and blood donors: a potential zoonosis in Denmark. Clin. Infect. Dis.
2008, 47, 1026-1031. 83. Purdy, M.A.; Khudyakov, Y.E.
Evolutionary history and population dynamics of hepatitis E virus. PloS One 2010, 5, e14376.
84.
Takahashi, M.; Nishizawa, T.; Gotanda, Y.; Tsuda, F.; Komatsu, F.; Kawabata, T.; Hasegawa, K.; Altankhuu, M.;
Chimedregzen, U.; Narantuya, L.; Hoshino, H.; Hino, K.; Kagawa, Y.; Okamoto, H. High prevalence of
antibodies to hepatitis A and E viruses and viremia of hepatitis B, C, and D viruses among apparently healthy
populations in Mongolia. Clin. Diagn. Lab. Immun. 2004, 11, 392-398.
85. Li, R.C.; Ge, S.X.; Li, Y.P.; Zheng, Y.J.; Nong, Y.; Guo, Q.S.; Zhang, J.; Ng, M.H.; Xia, N.S. Seroprevalence of
hepatitis E virus infection, rural southern People's Republic of China. Emerg. Infect. Dis. 2006, 12, 1682-1688.
86. Wong, K.H.; Liu, Y.M.; Ng, P.S.; Young, B.W.; Lee, S.S.
Epidemiology of hepatitis A and hepatitis E infection and their determinants in adult Chinese community in
Hong Kong. J. Med. Virol. 2004, 72, 538-
544. 87. Arankalle, V.A.; Chadha, M.S.; Chitambar, S.D.; Walimbe, A.M.; Chobe, L.P.; Gandhe, S.S.
Changing epidemiology of hepatitis A and hepatitis E in urban and rural India (1982- 98). J. Viral Hepat.
2001, 8, 293-303.
88. Aggarwal, R.; Naik, S. Epidemiology of hepatitis E: current status. J. Gastroenterol. Hepatol. 2009, 24, 1484-
1493. 89. Fu, H.; Li, L.; Zhu, Y.; Wang, L.; Geng, J.; Chang, Y.; Xue, C.; Du, G.; Li, Y.; Zhuang, H. Hepatitis E virus
infection among animals and humans in Xinjiang, China: possibility of swine to human transmission of
sporadic hepatitis E in an endemic area. Am. J. Trop. Med. Hyg. 2010, 82, 961-966. 90. Toole, M.;
Claridge, F.; Anderson, D.; Zhuang, H.; Morgan, C.; Otto, B.; Stewart, T.
Hepatitis E virus infection as a marker for contaminated community drinking water sources in Tibetan villages.
Am. J. Trop. Med. Hyg. 2006, 74, 250–254. 91. Sedyaningsih-Mamahit, E.; Larasati, R.; Laras, K.; Sidemen, A.;
Sukri, N.; Sabaruddin, N.; Didi, S.; Saragih, J.; Myint, K.; Endy, T.; Sulaiman, A.; Campbell, J.; Corwin, A. First
documented outbreak of hepatitis E virus transmission in Java, Indonesia. T. Roy. Soc. Trop. Med. H. 2002, 96,
398–404. 92. Corwin, A.; Tien, N.; Bounlu, K.; Winarno, J.; Putri, M.; Laras, K.; Larasati, R.; Sukri, N.; Endy, T.;
Sulaiman, H.; Hyams, K. The unique riverine ecology of hepatitis E virus transmission in South-East Asia. T. Roy.
Soc. Trop. Med. H. 1999, 93, 255–260.
Ceylan, A.; Ertem, M.; Ilcin, E.; Ozekinci, T. A special risk group for hepatitis E infection: Turkish agricultural
workers who use untreated waste water for irrigation. Epidemiol. Infect. 2003,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 54/156
131, 753–756. 94. Bile, K.; Isse, A.; Mohamud, O.; Allebeck, P.; Nilsson, L.; Norder, H.; Mushahwar, I.; Magnius, L.
Contrasting roles of rivers and wells as sources of drinking water on attack and fatality rates in a hepatitis E
epidemic in Somalia. Am. J. Trop. Med. Hyg. 1994, 51, 466– 474. 95.
Clemente-Casares, P.; Pina, S.; Buti, M.; Jardi, R.; MartIn, M.; Bo�ll-Mas, S.l.; Girones,
R. Hepatitis E virus epidemiology in industrialized countries. Emerg. Infect. Dis. 2003, 9, 448– 454. 96.
Ippagunta, S.K.; Naik, S.; Sharma, B.; Aggarwal, R. Presence of hepatitis E virus in sewage in Northern India:
frequency and seasonal pattern. . Med. Virol. 2007, 79, 1827–1831. 97. Jothikumar, N.; Aparna, K.;
Kamatchiammal, S.; Paulmurugan, R.; Saravanadevi, S.; Khanna, P. Detection of hepatitis E virus in raw and
treated wastewater with the polymerase chain reaction. Appl. Environ. Microbiol. 1993, 59, 2558–2562. 98.
Pina, S.; Buti, M.; Cotrina, M.; Piella, J.; Girones, R. HEV identi�ed in serum from humans with acute
hepatitis and in sewage of animal origin in Spain. J. Hepatol. 2000, 33, 826–
833. 99. Vaidya, S.; Tilekar, B.; Walimbe, A.; Arankalle, V. Increased risk of hepatitis E in sewage workers from
India. J. Occup. Environ. Med. 2003, 45, 1167–1170. 100. Rutjes, S.; Lodder, W.; Lodder-Verschoor, F.; van den
Berg, H.; Vennema, H.; Duizer, E.; Koopmans, M.; de Roda Husman, A. Sources of hepatitis E virus genotype 3 in
The Netherlands. Emerg. Infect. Dis. 2009, 15, 381–387. 101.
Borgen, K.; Herremans, T.; Duizer, E.; Vennema, H.; Rutjes, S.; Bosman, A.; de Roda Husman, A.M.; Koopmans,
M. Non-travel related Hepatitis E virus genotype 3 infections in the Netherlands; a case series 2004 - 2006. BMC
Infect. Dis. 2008, 8, 61.
102. El-Esnawy, N.A. Examination for hepatitis E virus in wastewater treatment plants and workers by nested
RT-PCR and ELISA. J. Egypt. Public Health Assoc. 2000, 75, 219–231. 103.
Bouwknegt, M.; Engel, B.; Herremans, M.; Widdowson, M.; Worm, H.; Koopmans, M.; Frankena,
K.; de Roda Husman, A.; De Jong, M.; Van Der Poel, W. Bayesian estimation of hepatitis E virus
seroprevalence for populations with different exposure levels to swine in The Netherlands. Epidemiol. Infect.
2008, 136, 567-576. 104. Galiana, C.; Fernandez-Barredo, S.; Garcia, A.; Gomez, M.T.; Perez-Gracia, M.T.
Occupational exposure to hepatitis E virus (HEV) in swine workers. Am. J. Trop. Med. Hyg. 2008, 78, 1012-
1015. 105. Bendall, R.; Ellis, V.; Ijaz, S.; Ali, R.; Dalton, H. A comparison of two commercially available anti-HEV
IgG kits and a re-evaluation of anti-HEV IgG seroprevalence data in developed countries. J Med Virol 2010, 82,
799-805. 106. Baylis, S.A.; Blumel, J.; Mizusawa, S.; Matsubayashi, K.; Sakata, H.; Okada, Y.; Nubling, C.M.;
Hanschmann, K.M.; Group, H.E.V.C.S. World Health Organization International Standard to harmonize assays
for detection of hepatitis E virus RNA. Emerg. Infect. Dis. 2013, 19, 729-735. 107. Vulcano, A.; Angelucci, M.;
Candelori, E.; Martini, V.; Patti, A.M.; Mancini, C.; Santi, A.L.; Calvani, A.; Casagni, L.; Lamberti, A. HEV prevalence
in the general population and among workers at zoonotic risk in Latium Region. Ann. Ig. 2007, 19, 181-186.
108. Olsen, B.; Axelsson-Olsson, D.; Thelin, A.; Weiland, O. Unexpected high prevalence of IgG-antibodies to
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 55/156
hepatitis E virus in Swedish pig farmers and controls. Scand. J. Infect. Dis. 2006, 38, 55-58. 109.
Kasorndorkbua, C.; Opriessnig, T.; Huang, F.F.; Guenette, D.K.; Thomas, P.J.; Meng, X.J.; Halbur, P.G. Infectious
swine hepatitis E virus is present in pig manure storage facilities on United States farms, but evidence of water
contamination is lacking. Appl. Environ. Microbiol. 2005, 71, 7831–7837. 110.
Rodriguez-Lazaro, D.; Cook, N.; Ruggeri, F.M.; Sellwood, J.; Nasser, A.; Nascimento, M.S.; D'Agostino, M.;
Santos, R.; Saiz, J.C.; Rzezutka, A.; Bosch, A.; Girones, R.; Carducci, A.; Muscillo, M.; Kovac, K.; Diez-Valcarce, M.;
Vantarakis, A.; von Bonsdorff, C.H.; de Roda Husman, A.M.; Hernandez, M.; van der Poel, W.H. Virus hazards from
food, water and other contaminated environments. FEMS Microbiol. Rev.
2012, 36, 786–814. 111. Jimenez-Clavero, M.A.; Escribano-Romero, E.; Mansilla, C.; Gomez, N.; Cordoba, L.;
Roblas, N.; Ponz, F.; Ley, V.; Saiz, J.C. Survey of bovine enterovirus in biological and environmental samples by a
highly sensitive real-time reverse transcription-PCR. Appl. Environ. Microbiol. 2005, 71, 3536–3543. 112.
Brassard, J.; Gagné, M.J.; Généreux, M.; Côté , C. Detection of human food-borne and zoonotic viruses on
irrigated, �eld-grown strawberries. Appl. Environ. Microbiol. 2012, 78, 3763–3766. 113. Ward, P.; Muller, P.;
Letellier, A.; Quessy, S.; Simard, C.; Trottier, Y.L.; Houde, A.; Brassard, J.
Molecular characterization of hepatitis E virus detected in swine farms in
the province of Quebec. Can. J. Vet. Res. 2008, 72, 27–31. 114.
Steyer, A.; Naglič , T.; Močilnik, T.; Poljšak-Prijatelj, M.; Poljak, M. Hepatitis E virus in domestic pigs and surface
waters in Slovenia: prevalence and molecular characterization of a novel genotype 3 lineage. Infect. Genet. Evol.
2011, 11, 1732–1737.
115.
Tyrrel, S.F.; Quinton, J.N. Overland �ow transport of pathogens from agricultural land receiving faecal wastes.
J. Appl. Microbiol. 2003, 94 Suppl, 87S-93S.
116. Ziemer, C.;
Bonner, J.; Cole, D.; Vinjé, J.; Constantini, V.; Goyal, S.; Gramer, M.; Mackie,
R.; Meng, X.J.; Myers, G.; Saif, L. Fate and transport of zoonotic, bacterial, viral, and parasitic pathogens during
swine manure treatment, storage, and land application. J. Anim. Sci. 2010, 88, 94. 117. Lewis, H.C.;
Wichmann, O.; Duizer, E. Transmission routes and risk factors for autochthonous hepatitis E virus infection in
Europe: a systematic review.
Epidemiol. Infect. 2010, 138, 145–166. 118.
Namsai, A.; Louisirirotchanakul, S.; Wongchinda, N.; Siripanyaphinyo, U.; Virulhakul, P.; Puthavathana, P.; Myint,
K.; Gannarong, M.; Ittapong, R. Surveillance of hepatitis A and E viruses contamination in shell�sh in Thailand.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 56/156
Lett. Appl. Microbiol. 2011,
53, 608–613. 119.
Emerson, S.; Arankalle, V.; Purcell, R. Thermal stability of hepatitis E virus. J. Infect. Dis.
2005, 192, 930–933. 120.
Said, B.; Ijaz, S.; Kafatos, G.; Booth, L.; Thomas, H.; Walsh, A.;
Ramsay, M.; Morgan, D.; Hepatitis, E.I.I.T.
Hepatitis E outbreak on cruise ship. Emerg. Infect. Dis.
2009, 15, 1738– 1744. 121.
Diez-Valcarce, M.; Kokkinos, P.; Söderberg, K.; Bouwknegt, M.; Willems, K.; de Roda-
Husman, A.; von Bonsdorff, C.-H.; Bellou, M.; Hernández, M.; Maunula, L.; Vantarakis, A.; Rodríguez-Lázaro, D.
Occurrence of human enteric viruses in commercial mussels at retail level in three European countries. Food
Environ. Virol. 2012, 4, 73–80. 122. Crossan, C.; Baker, P.; Craft, J.; Takeuchi, Y.; Dalton, H.; Scobie, L. Hepatitis E
virus genotype 3 in shell�sh, United Kingdom. Emerg. Infect. Dis. 2012, 18, 2085–2087. 123.
Cacopardo, B.; Russo, R.; Preiser, W.; Benanti, F.; Brancati, G.; Nunnari, A. Acute hepatitis E in Catania (eastern
Sicily) 1980– 1994. The role of hepatitis E virus. Infection
1997, 25, 313–316. 124.
Renou, C.; Moreau, X.; Pariente, A.; Cadranel, J.F.; Maringe, E.; Morin, T.; Causse, X.;
Payen, J.L.; Izopet, J.; Nicand, E.; Bourliere, M.; Penaranda, G.; Hardwigsen, J.; Gerolami, R.; Peron, J.M.; Pavio,
N.; Angh, F. A national survey of acute hepatitis E in France. Aliment. Pharmacol. Ther. 2008, 27, 1086–1093.
125. Song, Y.J.; Jeong, H.J.; Kim, Y.J.; Lee, S.W.; Lee, J.B.; Park, S.Y.; Song, C.S.; Park, H.M.; Choi, I.S.
Analysis of complete genome sequences of swine hepatitis E virus
and possible risk factors for transmission of HEV to humans in Korea. J. Med. Virol. 2010, 82, 583-591. 126. Li,
T.C.; Miyamura, T.; Takeda, N. Detection of
hepatitis E virus RNA from the bivalve Yamato-Shijimi (Corbicula japonica) in Japan. Am. J.
Trop. Med. Hyg. 2007, 76, 170-172 127.
Kamar, N.; Bendall, R.; Legrand-Abravanel, F.; Xia, N.S.; Ijaz, S.; Izopet, J.; Dalton, H.R. Hepatitis E.
Lancet 2012, 379, 2477-2488.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 57/156
128. Billam, P.; Pierson, F.; Li, W.; LeRoith, T.; Duncan, R.; Meng, X.J. Development and validation of a negative-
strand-speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus:
identi�cation of nonliver replication sites. J. Clin. Microbiol. 2008, 46, 2630–2634. 129. Bouwknegt, M.; Rutjes,
S.A.; Reusken, C.B.; Stockhofe-Zurwieden, N.; Frankena, K.; de Jong, M.C.; de Roda Husman, A.M.; Poel, W.H.
The course of hepatitis E virus infection in pigs after contact-infection and intravenous inoculation. BMC Vet.
Res. 2009, 5, 7. 130. Williams, T.; Kasorndorkbua, C.; Halbur, P.; Haqshenas, G.; Guenette, D.; Toth, T.; Meng, X.
Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J. Clin. Microbiol. 2001,
39, 3040-3046. 131.
Miyashita, K.; Kang, J.-H.; Saga, A.; Takahashi, K.; Shimamura, T.; Yasumoto, A.;
Fukushima, H.; Sogabe, S.; Konishi, K.; Uchida, T.; Fujinaga, A.; Matsui, T.; Sakurai, Y.; Tsuji, K.; Maguchi, H.;
Taniguchi, M.; Abe, N.; Fazle Akbar, S.; Arai, M.; Mishiro, S. Three cases of acute or fulminant hepatitis E caused
by ingestion of pork meat and entrails in Hokkaido, Japan: Zoonotic food-borne transmission of hepatitis E
virus and public health concerns. Hepatol. Res. 2012, 42, 870–878. 132.
Li, T.-C.; Chijiwa, K.; Sera, N.; Ishibashi, T.; Etoh, Y.; Shinohara, Y.; Kurata, Y.; Ishida, M.; Sakamoto, S.;
Takeda, N.; Miyamura, T.
Hepatitis E virus transmission from wild boar meat. Emerg. Infect. Dis.
2005, 11, 1958-1960. 133.
Matsuda, H.; Okada, K.; Takahashi, K.; Mishiro, S. Severe hepatitis E virus infection after ingestion of uncooked
liver from a wild boar. J. Infect. Dis. 2003, 188, 944.
134.
Tamada, Y.; Yano, K.; Yatsuhashi, H.; Inoue, O.; Mawatari, F.; Ishibashi, H. Consumption of wild boar linked to
cases of hepatitis E. J. Hepatol. 2004, 40, 869-
870 135. Hijioka, S.; Sato, Y.; Iwashita, Y.; Indou, Y. [A case of acute hepatitis E who had a history of frequent
ingestion of raw meat and viscera from wild deer and boars]. Nihon Shokakibyo Gakkai zasshi 2005, 102, 723-
728. 136. Martelli, F.; Caprioli, A.; Zengarini, M.; Marata, A.; Fiegna, C.; Di Bartolo, I.; Ruggeri, F.; Delogu, M.;
Ostanello, F. Detection of hepatitis E virus (HEV) in a demographic managed wild boar (Sus scrofa scrofa)
population in Italy. Vet. Microbiol. 2008, 126, 74–81. 137. Kaba, M.; Davoust, B.; Marié J.-L.; Colson, P. Detection
of hepatitis E virus in wild boar (Sus scrofa) livers. Vet. J. 2010, 186, 259–261. 138. Wichmann, O.; Schimanski,
S.; Koch, J.; Kohler, M.; Rothe, C.; Plentz, A.; Jilg, W.; Stark, K. Phylogenetic and case-control study on hepatitis E
virus infection in Germany. J. Infect. Dis. 2008, 198, 1732–1741. 139. Sonoda, H.; Abe, M.; Sugimoto, T.; Sato,
Y.; Bando, M.; Fukui, E.; Mizuo, H.; Takahashi, M.; Nishizawa, T.; Okamoto, H. Prevalence of hepatitis E virus
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 58/156
(HEV) Infection in wild boars and deer and genetic identi�cation of a genotype 3 HEV from a boar in Japan. J.
Clin. Microbiol. 2004, 42, 5371–5374. 140. Christou, L.; Kosmidou, M.
Hepatitis E virus in the Western world-a pork-related zoonosis.
Clin. Microbiol. Infect. 2013, 19, 600–604. 141. Berto, A.; Grierson, S.; Hakze-van der Honing, R.; Martelli, F.;
Johne, R.; Reetz, J.; Ulrich, R.; Pavio, N.; Van der Poel, W.; Banks, M. Hepatitis E virus in pork liver sausage,
France. Emerg. Infect. Dis. 2013, 19, 264–266. 142. Wenzel, J.J.; Preiss, J.; Schemmerer, M.; Huber, B.; Plentz,
A.; Jilg, W. Detection of hepatitis E virus (HEV) from porcine livers in Southeastern Germany and high sequence
homology to human HEV isolates. J. Clin. Virol. 2011, 52, 50–54. 143. Bouwknegt, M.; Lodder-Verschoor, F.; van
der Poel, W.; Rutjes, S.; de Roda Husman, A. Hepatitis E virus RNA in commercial porcine livers in The
Netherlands. J. Food. Protect. 2007, 70, 2889–2895. 144. Feagins, A.R.; Opriessnig, T.; Guenette, D.K.; Halbur,
P.G.; Meng, X.J. Detection and characterization of infectious Hepatitis E virus from commercial pig livers sold
in local grocery stores in the USA. J. Gen. Virol. 2007, 88, 912–917. 145. Wacheck, S.; Werres, C.; Mohn, U.;
Dorn, S.; Soutschek, E.; Fredriksson-Ahomaa, M.; Märtlbauer, E. Detection of IgM and IgG against hepatitis E
virus in serum and meat juice samples from pigs at slaughter in Bavaria, Germany. Foodborne Pathog. Dis.
2012, 9, 655– 660. 146.
Di Bartolo, I.; Ponterio, E.; Castellini, L.; Ostanello, F.; Ruggeri, F .M. Viral and antibody HEV prevalence
in swine at slaughterhouse in Italy. Vet. Microbiol.
2011, 149, 330–338. 147.
Di Bartolo, I.; Diez-Valcarce, M.; Vasickova, P.; Kralik, P.; Hernandez, M.; Angeloni, G.;
Ostanello, F.; Bouwknegt, M.; Rodríguez-Lázaro, D.; Pavlik, I.; Ruggeri, F. Hepatitis E virus in pork production
chain in Czech Republic, Italy, and Spain, 2010. Emerg. Infect. Dis. 2010, 18, 1282–1289. 148. Kulkarni, M.A.;
Arankalle, V.A. The detection and characterization of hepatitis E virus in pig livers from retail markets of India.
J. Med. Virol. 2008, 80, 1387–1390. 149. Shukla, P.; Chauhan, U.K.; Naik, S.; Anderson, D.; Aggarwal, R. Hepatitis
E virus infection among animals in northern India: an unlikely source of human disease. J. Viral Hepat. 2007,
14, 310-317 150. Tomiyama, D.; Inoue, E.; Osawa, Y.; Okazaki, K. Serological evidence of infection with
hepatitis E virus among wild Yezo -deer, Cervus nippon yesoensis, in Hokkaido, Japan.
J. Viral Hepat. 2009, 16, 524–528. 151. Tei, S.; Kitajima, N.; Ohara, S.; Inoue, Y.; Miki, M.; Yamatani, T.; Yamabe,
H.; Mishiro, S.; Kinoshita, Y. Consumption of uncooked deer meat as a risk factor for hepatitis E virus infection:
an age- and sex-matched case-control study. J. Med. Virol. 2004, 74, 67–70. 152. Legrand-Abravanel, F.; Kamar,
N.; Sandres-Saune, K.; Garrouste, C.; Dubois, M.; Mansuy, J.-M.; Muscari, F.; Sallusto, F.; Rostaing, L.; Izopet, J.
Characteristics of autochthonous hepatitis E virus infection in solid-organ transplant recipients in France. J.
Infect. Dis. 2010, 202, 835–844. 153. Geng, Y.; Zhao, C.; Song, A.; Wang, J.; Zhang, X.; Harrison, T.; Zhou, Y.;
Wang, W.; Wang, Y. The serological prevalence and genetic diversity of hepatitis E virus in farmed rabbits in
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 59/156
China. Infect. Genet. Evol. 2011, 11, 476–482. 154. Sanford, B.; Emerson, S.; Purcell, R.; Engle, R.; Dryman, B.;
Cecere, T.; Buechner-Maxwell, V.; Sponenberg, D.; Meng, X.J. Serological Evidence for a Hepatitis E Virus-
Related Agent in Goats in the United States. Transbound. Emerg. Dis. 2012. 155. Haqshenas, G.; Huang, F.F.;
Fenaux, M.; Guenette, D.K.; Pierson, F.W.; Larsen, C.T.; Shivaprasad, H.L.; Toth, T.E.; Meng, X.J. The putative
capsid protein of the newly identi�ed avian hepatitis E virus shares antigenic epitopes with that of swine and
human hepatitis E viruses and chicken big liver and spleen disease virus. J. Gen. Virol. 2002, 83, 2201–2209.
156. Bilic, I.; Jaskulska, B.; Basic, A.; Morrow, C.; Hess, M. Sequence analysis and comparison of avian hepatitis
E viruses from Australia and Europe indicate the existence of different genotypes. J. Gen. Virol. 2009, 90, 863–
873. 157. Huang, F.F.; Sun, Z.F.; Emerson, S.U.; Purcell, R.H.; Shivaprasad, H.L.; Pierson, F.W.; Toth, T.E.; Meng,
X.J. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and
attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 2004, 85, 1609–1618. 158. Sato, Y.; Sato, H.;
Naka, K.; Furuya, S.; Tsukiji, H.; Kitagawa, K.; Sonoda, Y.; Usui, T.; Sakamoto, H.; Yoshino, S.; Shimizu, Y.;
Takahashi, M.; Nagashima, S.; Jirintai; Nishizawa, T.; Okamoto, H. A nationwide survey of hepatitis E virus
(HEV) infection in wild boars in Japan: identi�cation of boar HEV strains of genotypes 3 and 4 and
unrecognized genotypes. Arch. Virol. 2011, 156, 1345–1358. 159. Takahashi, M.; Nishizawa, T.; Tanaka, T.;
Tsatsralt-Od, B.; Inoue, J.; Okamoto, H. Correlation between positivity for immunoglobulin A antibodies and
viraemia of swine hepatitis E virus observed among farm pigs in Japan. J. Gen. Virol. 2005, 86, 1807–1813.
160. Rutjes, S.A.; Lodder, W.J.; Bouwknegt, M.; de Roda Husman, A.M. Increased hepatitis E virus prevalence on
Dutch pig farms from 33 to 55% by using appropriate internal quality controls for RT-PCR. J. Virol. Methods
2007, 143, 112–116. 161. Seminati, C.; Mateu, E.; Peralta, B.; de Deus, N.; Martin, M. Distribution of hepatitis E
virus infection and its prevalence in pigs on commercial farms in Spain. Vet. J. 2008, 175, 130– 132. 162.
Garkavenko, O.; Obriadina, A.; Meng, J.; Anderson, D.A.; Benard, H.J.; Schroeder, B.A.; Khudyakov, Y.E.; Fields,
H.A.; Croxson, M.C.
Detection and characterisation of swine hepatitis E virus in New Zealand. J. Med. Virol. 2001, 65, 525–
529. 163. Blacksell, S.D.; Myint, K.S.; Khounsy, S.; Phruaravanh, M.; Mammen, M.P., Jr.; Day, N.P.; Newton, P.N.
Prevalence of hepatitis E virus antibodies in pigs: implications for human infections in village-based
subsistence pig farming in the Lao PDR. Trans. Roy. Soc. Trop. Med. Hyg. 2007, 101, 305–307. 164.
dos Santos, D.R.; Vitral, C.L.; de Paula, V.S.; Marchevsky, R.S.; Lopes, J.F.; Gaspar, A.M.; Saddi, T.M.; Junior,
N.C.; Guimaraes Fde, R.; Junior, J.G.; Ximenes, L.L.; Souto, F.J.; Pinto, M.A. Serological and molecular evidence of
hepatitis E virus in swine in Brazil. Vet. J.
2009, 182, 474–480. 165. Reuter, G.b.; Fodor, D.; Forgách , P.; Kátai, A.; Szucs, G. Characterization and zoonotic
potential of endemic hepatitis E virus (HEV) strains in humans and animals in Hungary. J. Clin. Virol. 2009, 44,
277–281. 166. Schielke, A.; Sachs, K.; Lierz, M.; Appel, B.; Jansen, A.; Johne, R. Detection of hepatitis E virus in
wild boars of rural and urban regions in Germany and whole genome characterization of an endemic strain.
Virol. J. 2009, 6, 58. 167. Forgach, P.; Nowotny, N.; Erdelyi, K.; Boncz, A.; Zentai, J.; Szucs, G.; Reuter, G.; Bakonyi,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 60/156
T. Detection of hepatitis E virus in samples of animal origin collected in Hungary. Vet. Microbiol. 2010, 143,
106-116. 168.
Matsuura, Y.; Suzuki, M.; Yoshimatsu, K.; Arikawa, J.; Takashima, I.; Yokoyama, M.; Igota,
H.; Yamauchi, K.; Ishida, S.; Fukui, D.; Bando, G.; Kosuge, M.; Tsunemitsu, H.; Koshimoto, C.; Sakae, K.; Chikahira,
M.; Ogawa, S.; Miyamura, T.; Takeda, N.; Li, T.C. Prevalence of antibody to hepatitis E virus among wild sika
deer, Cervus nippon, in Japan. Arch. Virol. 2007, 152, 1375-1381. 169. Rutjes, S.A.; Lodder-Verschoor, F.; Lodder,
W.J.; van der Giessen, J.; Reesink, H.; Bouwknegt, M.; de Roda Husman, A.M. Seroprevalence and molecular
detection of hepatitis E virus in wild boar and red deer in The Netherlands. J. Virol. Methods 2010, 168, 197-
206. 170.
Medrano, C.; Boadella, M.; Barrios, H.; Cantu, A.; Garcia, Z.; de la Fuente, J.; Gortazar, C. Zoonotic
pathogens among white-tailed deer, northern Mexico, 2004-2009. Emerg. Infect. Dis.
2012, 18, 1372-1374. 171. El-Tras, W.; Tayel, A.; El-Kady, N. Seroprevalence of hepatitis E virus in humans and
geographically matched food animals in Egypt. Zoonoses Public Hlth. 2012, 60, 244-251. 172. Arankalle, V.;
Joshi, M.; Kulkarni, A.; Gandhe, S.; Chobe, L.; Rautmare, S.; Mishra, A.; Padbidri, V. Prevalence of anti-hepatitis E
virus antibodies in different Indian animal species. J. Viral Hepat. 2001, 8, 223-227. 173. Vitral, C.L.; Pinto, M.A.;
Lewis-Ximenez, L.L.; Khudyakov, Y.E.; dos Santos, D.R.; Gaspar, A.M. Serological evidence of hepatitis E virus
infection in different animal species from the Southeast of Brazil. Mem. Inst. Oswaldo Cruz 2005, 100, 117-
122. 174. Geng, Y.; Wang, C.; Zhao, C.; Yu, X.; Harrison, T.J.; Tian, K.; Wang, Y. Serological prevalence of hepatitis
E virus in domestic animals and diversity of genotype 4 hepatitis E virus in China. Vector-borne Zoonot. 2010,
10, 765-770. 175. Yu, Y.; Sun, J.; Liu, M.; Xia, L.; Zhao, C.; Harrison, T.J.; Wang, Y. Seroepidemiology and genetic
characterization of hepatitis E virus in the northeast of China. Infect. Genet. Evol. 2009, 9, 554-561. 176.
Zhang, W.; Shen, Q.; Mou, J.; Gong, G.; Yang, Z.; Cui, L.; Zhu, J.; Ju, G.; Hua, X. Hepatitis E virus infection
among domestic animals in eastern China. Zoonoses Public Hlth.
2008, 55, 291-298. 177. Meng, X.
Swine hepatitis E virus: cross-species infection and risk in xenotransplantation. Curr. Top. Microbiol.
2003, 278, 185-216. 178. Kabrane-Lazizi, Y.; Fine, J.B.; Elm, J.; Glass, G.E.; Higa, H.; Diwan, A.; Gibbs, C.J., Jr.;
Meng, X.J.; Emerson, S.U.; Purcell, R.H. Evidence for widespread infection of wild rats with hepatitis E virus in
the United States. Am. J. Trop. Med. Hyg. 1999, 61, 331-335. 179. Hirano, M.; Ding, X.; Li, T.C.; Takeda, N.;
Kawabata, H.; Koizumi, N.; Kadosaka, T.; Goto, I.; Masuzawa, T.; Nakamura, M.; Taira, K.; Kuroki, T.; Tanikawa, T.;
Watanabe, H.; Abe, K. Evidence for widespread infection of hepatitis E virus among wild rats in Japan. Hepatol.
Res. 2003, 27, 1-5. 180. Li, W.; Guan, D.; Su, J.; Takeda, N.; Wakita, T.; Li, T.C.; Ke, C.W. High prevalence of rat
hepatitis E virus in wild rats in China. Vet. Microbiol. 2013, 165, 275–280. 181. Mulyanto; Depamede, S.N.;
Sriasih, M.; Takahashi, M.; Nagashima, S.; Jirintai, S.; Nishizawa, T.; Okamoto, H. Frequent detection and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 61/156
characterization of hepatitis E virus variants in wild rats (Rattus rattus) in Indonesia. Arch. Virol. 2013, 158, 87–
96. 182. Lack, J.; Volk, K.; Van Den Bussche, R.
Hepatitis E virus genotype 3 in wild rats, United States.
Emerg. Infect. Dis. 2012, 18, 1268–1273. 183. Favorov, M.O.; Kosoy, M.Y.; Tsarev, S.A.; Childs, J.E.; Margolis,
H.S. Prevalence of antibody to hepatitis E virus among rodents in the United States. J. Infect. Dis. 2000, 181,
449–455. 184. Li, T.C.; Ami, Y.; Suzaki, Y.; Takeda, N.; Takaji, W. No evidence for hepatitis e virus genotype 3
susceptibility in rats. Emerg. Infect. Dis. 2013, 19(8), 1343-5. 185. Izopet, J.; Dubois, M.; Bertagnoli, S.; Lhomme,
S.; Marchandeau, S.; Boucher, S.; Kamar, N.; Abravanel, F.; Guerin, J.L.
Hepatitis E virus strains in rabbits and evidence of a closely related strain in humans, France.
Emerg. Infect. Dis. 2012, 18, 1274–1281. 186. Cossaboom, C.M.; Cordoba, L.; Sanford, B.J.; Pineyro, P.; Kenney,
S.P.; Dryman, B.A.; Wang, Y.; Meng, X.J. Cross-species infection of pigs with a novel rabbit, but not rat, strain of
hepatitis E virus isolated in the United States. J. Gen. Virol. 2012, 93, 1687–1695. 187. Li, T.C.; Saito, M.; Ogura,
G.; Ishibashi, O.; Miyamura, T.; Takeda, N. Serologic evidence for hepatitis E virus infection in mongoose. Am. J.
Trop. Med. Hyg. 2006, 74, 932–936. 188.
Nakamura, M.; Takahashi, K.; Taira, K.; Taira, M.; Ohno, A.; Sakugawa, H.;
Arai, M.; Mishiro, S. Hepatitis E virus infection in wild mongooses of Okinawa, Japan: Demonstration of anti-
HEV antibodies and a full-genome nucleotide sequence. Hepatol. Res. 2006, 34, 137–140. 189. Meng, X.J.;
Wiseman, B.; Elvinger, F.; Guenette, D.; Toth, T.; Engle, R.; Emerson, S.; Purcell, R.
Prevalence of antibodies to hepatitis E virus in veterinarians working with swine and in normal blood donors in the
United States and other countries. J. Clin. Microbiol.
2002, 40, 117–122. 190. Meng, X.J.; Dea, S.; Engle, R.E.; Friendship, R.; Lyoo, Y.S.; Sirinarumitr, T.; Urairong, K.;
Wang, D.; Wong, D.; Yoo, D.; Zhang, Y.; Purcell, R.H.; Emerson, S.U. Prevalence of antibodies to the hepatitis E
virus in pigs from countries where hepatitis E is common or is rare in the human population. J. Med. Virol.
1999, 59, 297–302. 191. Withers, M.; Correa, M.; Morrow, M.; Stebbins, M.; Seriwatana, J.; Webster, W.; Boak, M.;
Vaughn, D. Antibody levels to hepatitis E virus in North Carolina swine workers, non-swine workers, swine, and
murids. Am. J. Trop. Med. Hyg. 2002, 66, 384–388. 192.
Drobeniuc, J.; Favorov, M.; Shapiro, C.; Bell, B.; Mast, E.; Dadu, A.; Culver, D.; Iarovoi, P.;
Robertson, B.; Margolis, H. Hepatitis E virus antibody prevalence among persons who work with swine. J.
Infect. Dis.
2001, 184, 1594–1597. 193. Karetnyi, Y.V.; Gilchrist, M.J.; Naides, S.J. Hepatitis E virus infection prevalence
among selected populations in Iowa. J. Clin. Virol. 1999, 14, 51–55. Chapter II: Naturally Occurring Animal
Models of Human Hepatitis E Virus Infection Danielle M. Yugo, Caitlin M. Cossaboom, and Xiang-Jin Meng
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 62/156
Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Polytechnic
Institute and State University, 1981 Kraft Drive, Blacksburg, VA 24061-0913,
U.S.A. ILAR Journal. 2014; April; 5(1): 187-199.
This is a pre- copyedited, author-produced PDF of an article accepted for publication in ILAR Journal
following peer review. The version
of record
[Yugo, DM, Cossaboom, CM, and Meng, XJ. Naturally occurring animal models of human hepatitis E virus
infection, ILAR,
2014 April; 5(1): 187-199.] is available online at: https://doi.org/10.1093/ilar/ilu007. Abstract
Hepatitis E virus (HEV) is a single-stranded, positive-sense RNA virus
in the family Hepeviridae. Hepatitis E caused by HEV is a clinically important global disease. There are
currently four well-characterized genotypes of HEV in mammalian species, although numerous novel strains of
HEV likely belonging to either new genotypes or species have recently been identi�ed from several other
animal species. HEV genotypes 1 and 2 are limited to infection in humans, while genotypes 3 and 4 infect an
expanding host range of animal species, and are zoonotic to humans. Historical animal models include various
species of non-human primates which have been indispensable for the discovery of human HEV and for
understanding its pathogenesis and course of infection. With the genetic identi�cation and characterization of
animal strains of HEV, a number of naturally-occurring animal models such as swine, chicken and rabbit have
recently been developed for various aspects of HEV research including vaccine trials, pathogenicity, cross-
species infection, mechanism of virus replication, and molecular biology studies. Unfortunately, the current
available animal models for HEV are still inadequate for certain aspects of HEV research. For instances, an
animal model is still lacking to study the underlying mechanism of severe and fulminant hepatitis E during
pregnancy. Also, an animal model that can mimic chronic HEV infection is critically needed to study the
mechanism leading to chronicity in immunocompromised individuals. Genetic identi�cation of additional novel
animal strains of HEV may lead to the development of better naturally-occurring animal models for HEV. This
article reviews the current understanding of animal models of HEV infection in both the natural and
experimental infection setting and identi�es key research needs and limitations. Keywords: Hepatitis E virus
(HEV); Animal models; Cross-species infection; Rabbit; Swine; Chicken Introduction Hepatitis E virus (HEV)
HEV is classi�ed in
the genus Hepevirus of the family Hepeviridae (Meng et al. 2012) The mammalian HEV
is comprised of four recognized genotypes and at least two putative genotypes that are distinct in geographic
locale as well as host. Genotype 1 HEV causes the majority of outbreaks of hepatitis E in humans in Asia.
Genotype 2 HEV includes one Mexican strain and multiple African strains and causes large outbreaks in
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 63/156
humans. In addition to humans, genotype 3 HEV has been isolated from a wide variety of animal species
including wild and domestic swine (de Deus et al. 2008; Meng et al. 1997; Takahashi et al. 2004), deer
(Takahashi et al. 2004), mongoose (Nakamura et al. 2006), rats (Lack et al. 2012), and rabbits (Cossaboom et
al. 2011; Zhao et al. 2009) and is associated with zoonotic transmission causing sporadic, cluster, and chronic
cases of hepatitis E in humans (Meng 2010). Genotype 4 HEV infects humans as well as wild and domestic
swine with zoonotic transmission to humans causing sporadic cases of hepatitis E (Meng 2013). (Table 1) In
addition to the zoonotic genotypes 3 and 4 HEV strains mentioned above, genetically divergent strains of HEV
have also been identi�ed from several other animal species including chicken (Haqshenas et al. 2001; Marek et
al. 2010; Payne et al. 1999), bat (Drexler et al. 2012), �sh (Batts et al. 2011), rat (Johne et al. 2011), ferret (Raj
et al. 2012), and wild boar (Takahashi et al. 2011) . Additionally, antibodies to HEV have been reportedly
detected from horses (Saad et al. 2007) and ruminant species including cattle, sheep, and goats (Sanford et al.
2012a); although the source of seropositivity in these species remains unknown (Meng 2013). The animal host
range of HEV has expanded dramatically over the past decade from the initial identi�cation of HEV in swine in
1997 (Meng et al. 1997) and chickens in 2001 (Haqshenas et al. 2001), to a multitude of animal species acting
as both reservoir and host more recently. Further research will likely expand the host range of the virus to
include additional novel strains from many more other animal species. Reclassi�cation and nomenclature
changes for HEV are eminent with the recent identi�cation of several novel strains (Table 1). Hepatitis E HEV is
transmitted via fecal-oral route through contaminated food or water and typically causes an acute icteric
disease known as hepatitis E (Meng 2010; Purcell 2001). The majority of patients experience an asymptomatic
course of disease in which the virus is quickly cleared with no major complication (Meng 2010). Symptomatic
patients experience a range of symptoms including anorexia, jaundice, darkened urine coloration,
hepatomegaly, myalgia, elevated ALT levels in the blood, and occasionally abdominal pain, nausea, vomiting,
and fever (Purcell 2001). Acute HEV infection in humans begins with a typical incubation period of 2 weeks to
2 months, a transient viremia period with viral shedding in the feces, a symptomatic phase lasting days to
weeks, and jaundice apparent 2-3 weeks into the course of infection (Purcell 2001). The severity of HEV
infection is considered dose-dependent with alcohol use or other concurrent hepatic diseases as contributing
factors (Purcell 2001). Immunocompromised individuals infected with HEV such as organ transplant recipients
are at a high risk of developing chronic hepatitis E (Kamar et al. 2013; Kamar et al. 2008). Pregnancy
associated complications with concurrent HEV infection include death of both the mother and fetus, abortion,
premature birth, and death of the baby shortly after birth with no known mechanism for the severe hepatitis E
manifestation (Navaneethan et al. 2008). The mortality rate ranges from 0.5-4% in immune competent
individuals and concurrent pregnancy attributed to increases in mortality up to 20% (Aggarwal 2011) . Hepatitis
E affects humans in both industrialized and developing countries worldwide. Industrialized countries
experience sporadic and cluster cases of hepatitis E associated with ingestion of contaminated animal meats,
shell�sh, and contact with infected animals (Meng 2013; Teo 2010). Developing countries such as Bangladesh,
Egypt, Mexico, China, India, and parts of Africa experience large waterborne outbreaks due to poor sanitation
conditions and a hyperendemic status in the population (Teo 2010). Genotypes 1 and 2 HEV strains are limited
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 64/156
to the human population, while genotypes 3 and 4 strains are zoonotic and infect humans and other animals.
Human to human transmission of HEV is considered rare; however, transmission through blood products by
transfusion has been reported (Pavio et al. 2010). Animal models of human hepatitis E virus Several animal
species serve as useful models for human HEV due to their susceptibility to infection by human HEV strains
(Table 2). Cynomolgus and rhesus monkeys are susceptible to genotypes 1-4 HEV and serve as the primary
model for genotypes 1 and 2 human HEV strains (Meng 2010; Purcell and Emerson 2001). Swine serve as a
reservoir for genotypes 3 and 4 human HEV and a natural animal host for HEV infection (Halbur et al. 2001).
Despite production of e�cient virus replication, both the non-human primate and swine models have
limitations in reproducing clinical aspects of hepatitis with minimal elevations in serum levels of liver enzymes
and moderate pathological liver lesions present (Halbur et al. 2001; Meng 2010). Rabbit HEV recently identi�ed
in China (Zhao et al. 2009), the United States (Cossaboom et al. 2011), and France (Izopet et al. 2012) likely
serves as a useful model of genotype 3 human HEV infection with successful transmission of the virus to
cynomolgus monkeys (Liu et al. 2013) and pigs (Cossaboom et al. 2012) thereby demonstrating the potential
for cross-species infection (Table 2). Historical Animal Models for Human Hepatitis E In 1983, an experimental
transmission study to a human volunteer as well as cynomolgus monkeys identi�ed virus-like-particles (VLP) in
stool by immune electron microscopy that became what is now HEV (Balayan et al. 1983). After ingestion of
the stool samples collected from Afghan patients with signs consistent with viral hepatitis, the human
volunteer developed clinical symptoms consistent with acute viral hepatitis with a non-A, non-B hepatitis
etiology and VLPs were identi�ed in the volunteer’s stool samples (Balayan et al. 1983). In addition,
cynomolgus macaques inoculated with fecal samples containing the VLPs responded similarly with elevations
of serum liver enzymes, histopathologic liver lesions, excretion of VLPs in feces, and antibody responses with
con�rmed reaction to the VLPs (Bradley et al. 1987). Anti-viral antibodies were con�rmed in serum samples
obtained from patients involved in outbreaks of non- A, non-B, acute hepatitis in various other countries,
con�rming an association between the identi�ed virus and human infections (Khuroo 2011; Purcell and
Emerson 2001). Non-human primates such as rhesus macaque and chimpanzee have served as important
animal models for HEV. Following the initial infection of cynomolgus monkeys with fecal samples containing
VLPs, various species of non-human primates were utilized in an attempt to better characterize the then
unknown virus (Balayan et al. 1983; Bradley et al. 1987). Macaques developed clinical signs consistent with
acute viral hepatitis, occasionally excreted the VLPs in feces, and developed antiviral antibodies (Arankalle et
al. 1995; Tsarev et al. 1993a). Chimpanzees and tamarins were inconsistently infected in these initial attempts
(Arankalle et al. 1988; Bradley et al. 1987; McCaustland et al. 2000). Subsequent attempts to infect other non-
human primate species have yielded mixed results with tamarins occasionally developing infection, but
chimpanzees (Arankalle et al. 1988), pig-tailed macaques (Tsarev et al. 1993b), vervets (Tsarev et al. 1993b),
owl monkeys (Ticehurst et al. 1992), squirrel monkeys (Tsarev et al. 1993b), and patas monkeys were all
susceptible through experimental infection. Rhesus and cynomolgus monkeys both in captivity and wild-
caught had serological evidence of natural exposure to HEV and the seroprevalence was age-dependent with
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 65/156
the majority positive for anti-HEV antibodies at 1 year and older for both species (Arankalle et al. 1994; Purcell
and Emerson 2001; Tsarev et al. 1993a). Based on the transmission studies, chimpanzees (Arankalle
et al. 1988), rhesus (Arankalle et al. 1995), and cynomolgus monkeys (Bradley et al.
1988; Tsarev et al. 1993a) were the most susceptible to both human strains of HEV (genotypes 1-4) and animal
strains of HEV (genotypes 3 and 4) and are considered suitable models for HEV studies (Purcell and Emerson
2001) (Table 2). However, the restricted procedures, limited animal resources and ethical concerns have
limited the widespread use of these historical non-human primate models in HEV research today. Naturally
Occurring HEV Infections in Animals Known animal strains of HEV The ever-expanding host range for HEV
currently includes a variety of animal species that serve as both reservoirs for human infections as well as
hosts of genetically diverse but related viruses (Table 1). The most well-characterized animal strains of HEV
include genotypes 3 and 4 swine HEV from domestic and wild pigs (Meng et al. 1997), and avian HEV
genotypes 1-3 (Haqshenas et al. 2001; Huang et al. 2002). Rabbit HEV has recently been identi�ed and
genetically characterized as a genotype 3 from rabbits in China (Zhao et al. 2009), the United States
(Cossaboom et al. 2011), and France (Izopet et al. 2012). Rats (Johne et al. 2011) and ferrets (Raj et al. 2012)
each carry HEV-related strains genetically distinct from other mammalian and avian HEV and cluster together
as a new putative genus proposed as Orthohepevirus (Meng 2013). Cutthroat trout virus (Batts et al. 2011)
resembles mammalian HEV in its genomic organization despite low nucleotide sequence identity and likely
represents a putative genus proposed as Piscihepevirus (Meng 2013). Genotype 3 HEV has also been isolated
from wild mongooses in Japan (Nakamura et al. 2006). Recently, a novel phylogenetic clade of HEV obtained
from Western African, Central American, and European bat species was identi�ed, although evidence for
transmission from bats to humans was lacking (Drexler et al. 2012). Deer have been implicated in foodborne
transmission of genotype 3 HEV to humans and share high nucleotide sequence identity to genotype 3 wild
boar HEV in Japan (Takahashi et al. 2004). The genetic identi�cation of these diverse animal strains of HEV
provided opportunities for developing new and useful naturally-occurring animal models for HEV in the future.
Animal species with only serological evidence of HEV infection The presence of anti-HEV antibodies in serum
indicates the exposure to and potential infection by HEV. Ruminant species including goats (Sanford et al.
2012a), cattle, and sheep have been reported as seropositive to anti-HEV antibodies without de�nitive genetic
identi�cation of HEV (Meng 2013). Horses were reportedly a potential reservoir of HEV by the presence of anti-
HEV antibodies and viral RNA; however, the close-relatedness of virus from horses to human HEV strains in
Cairo (97-100% nucleotide sequence identity) raises questions about the authenticity of these sequences as
true virus from horses (Saad et al. 2007). Anti-HEV antibodies have also been reportedly detected in both dogs
and cats with no detection of HEV-related sequences (Pavio et al. 2010). De�nitive genetic identi�cation of the
sources for anti-HEV seropositivity in these animal species will discover new animal strains of HEV, and thus
leading to the potential development of additional naturally-occurring animal models for HEV in the future.
Naturally Occurring Animal Models for Human Hepatitis E Swine model Discovery and prevalence of swine
HEV in pigs. Discovered from pigs in the United States in 1997, swine HEV became the �rst known animal
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 66/156
strain of HEV (Meng et al. 1997) and has since been identi�ed in domestic and wild swine worldwide. Swine
HEV was initially discovered via identi�cation of anti-HEV seropositive adult pigs followed by a prospective
study on piglets from a herd in Illinois that lead to the recovery of a novel virus (Meng et al. 1997). The novel
virus was successfully transmitted to speci�c-pathogen-free (SPF) pigs and the same virus was recovered
from the experimentally infected SPF pigs, thereby satisfying Koch’s postulates (Meng 2010). Swine serve as a
major reservoir for zoonotic genotypes 3 and 4 HEV (Meng 2010). Serological and molecular prevalence
studies of swine HEV yield widely variable results in both domestic and wild swine species in essentially all
swine-producing countries. In the United States, the majority of pigs develop seropositivity to HEV by 3 months
of age with dispersion of the virus in most herds
(Meng et al. 1997). In Canada (Leblanc et al. 2007),
Japan (Takahashi and Okamoto 2013), many European countries (Pavio et al. 2010; Rutjes et al. 2009), and
China (Meng et al. 1999), swine HEV infection is highly prevalent in both domestic and wild swine species
irrespective of the human population. Swine HEV is equally dispersed in developing and industrialized
countries worldwide. Pathogenesis and course of infection of swine HEV in the pig model. Following the
subclinical course of HEV infection, swine develop only mild microscopic lesions in the liver and associated
lymph nodes (Meng et al. 1997). Microscopic lesions include mild to moderate multifocal and periportal
lymphoplasmacytic hepatitis and mild focal hepatocellular necrosis (Halbur et al. 2001). A prospective study of
four piglets naturally infected by swine HEV identi�ed no apparent gross lesions in 19 different tissues
during necropsy, but characteristic microscopic lesions of hepatitis and lymphoplasmacytic enteritis
in all as well as multifocal lymphoplasmacytic interstitial nephritis in three of the four (Meng et al. 1997). Under
experimental conditions, pigs infected with swine HEV developed no clinical abnormalities, but were consistent
in microscopic liver lesions as the naturally infected pigs, and HEV RNA was detectable in feces, liver tissues,
and bile (Halbur et al. 2001). Pathological lesions in wild boars have not been investigated; however, the
similarity between domestic and wild swine strains leads to speculation that clinical and pathologic effects are
likely similar. Domestic pigs are typically infected by HEV at 2-4 months of age with a transient viremia lasting
1-2 weeks and fecal viral shedding lasting 3-7 weeks (de Deus et al. 2008). By 18 weeks of age, up to 86% of
pigs are naturally infected (Leblanc et al. 2007). The source of infection is thought to be virus shed in large
amounts in feces with transmission via fecal-oral route most common (Meng 2011). Naïve pigs acquire and
spread the virus through direct contact between pigs as well as fecally-contaminated feed and water sources
in their environment. Following the waning of maternal antibodies around 8 weeks of age, piglets become
infected by swine HEV and seroconvert �rst with IgM anti-HEV antibodies that peak in conjunction with peak
fecal viral shedding followed by seroconversion of IgG anti-HEV antibodies with subsequent clearance of the
virus from the feces (de Deus et al. 2008; Leblanc et al. 2007). Genotypes 3 and 4 HEV infections carry a
subclinical course in both naturally and experimentally infected swine with no observable clinical disease or
elevation in liver enzymes (Halbur et al. 2001). Experimentally, swine are readily infected via intravenous
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 67/156
inoculation; however, oral route of inoculation is ine�cient (Meng 2011). Wild boars are assumed to be a
natural reservoir for HEV as well due to the recovery of nearly genetically identical strains of HEV in deer
cohabiting forestry land in Japan (Takahashi et al. 2004). As a model for human HEV infections, swine
e�ciently produce infection with genotypes 3 and 4 HEV and act as the main reservoir for foodborne and
zoonotic HEV transmission to humans. Therefore, this naturally-occurring swine model is very useful for the
study of various aspects of HEV replication, pathogenesis and cross-species infection (Meng 2010) (Table 2).
The major drawback of the naturally-occurring swine HEV model is that it does not reproduce a hepatic
disease with overt clinical signs, thus limiting its usefulness in pathogenicity studies. Chicken model Discovery
and prevalence of avian HEV in chickens. Avian HEV was identi�ed in the United States in 2001 from chickens
with Hepatitis-Splenomegaly syndrome (HSS) (Haqshenas et al. 2001). Big Liver and Spleen Disease Virus
(BLSV) presented similarly in chickens in Australia with approximately 80% nucleotide sequence identity to
avian HEV (Marek et al. 2010; Payne et al. 1999). These two syndromes (HSS and BLS) are now known to be
caused by variants of the same virus within the avian HEV clade. Avian HEV currently consists of at least three
genotypes (1-3) throughout the world and shares approximately 60% nucleotide sequence identity with human
HEV strains (Marek et al. 2010), but is not known to infect humans. Avian HEV infection in chickens affects
approximately 71% of chicken �ocks and 30% of individuals overall within the United States (Huang et al.
2002). Avian HEV transmits most likely via fecal-oral route and spreads easily between and within chicken
�ocks (Meng et al. 2008). The infection in chickens is age-dependent affecting 17% of chickens under 18
weeks of age but 36% of adults were positive for anti-HEV antibodies (Huang et al. 2002). Pathogenesis and
course of infection of avian HEV in the chicken model. Following avian HEV infection, few birds show clinical
signs prior to death. Post-mortem evaluations reveal regressive ovaries, serosanguinous abdominal �uid,
enlarged, hemorrhagic, and necrotic livers, and enlarged spleens (Meng et al. 2008). Microscopic evaluations
identify in�ammatory cellular in�ltrations within the liver parenchyma (Billam et al. 2005). Likewise,
experimentally infected birds consistently present with lymphocytic periphlebitis and phlebitis in the liver at
microscopic evaluation with enlarged and hemorrhagic livers in approximately 25% of the infected birds at
gross evaluation (Meng et al. 2008). Avian HEV has
been shown to successfully cross species barrier and infect turkeys
(Sun et al. 2004); however, attempts to experimentally infect rhesus macaques (Huang et al. 2004) and mice
were unsuccessful (Meng et al. 2008). Avian HEV genotypes 1-3 correspond with mortality rates in chickens
ranging from 0.3- 1.0% of the overall �ock and a high level of subclinical infection. Typical clinical signs include
egg drop, hepato-splenomegaly, and acute death of birds. In �ocks displaying signs of avian HEV infection, up
to 20% of hens present egg drop signi�cantly reducing production (Meng et al. 2008). In an age-dependent
fashion, broiler breeders and laying hens of 30-72 weeks of age display the highest level of mortality (Huang et
al. 2002). As a model for HEV infection in humans, avian HEV genotypes 1-3 are far more limited in their host
range, but this naturally-occurring chicken model offers a unique hepatic disease model (HSS) that can be
used to study at least some aspects of human hepatitis E disease (Table 2). Rabbit model Discovery and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 68/156
prevalence of rabbit HEV in rabbits. Farmed rabbits from the Gansu Province in China were tested positive for
anti-HEV antibodies and full-length genomic sequences of HEV were determined and found to be most closely
related to the zoonotic genotype 3 HEV (Zhao et al. 2009). Subsequently, studies on farmed and wild rabbits in
the United States (Cossaboom et al. 2011) and France (Izopet et al. 2012) con�rmed the presence of rabbit
HEV related to genotype 3. Anti-HEV antibody presence in rabbits is highly prevalent with 57%, 54.6%, and
34.6% of farmed rabbits in the Gansu province of China, Beijing, and Virginia, USA testing positive respectively
(Cossaboom et al. 2011; Zhao et al. 2009). The detection of rabbit HEV RNA in fecal and serum samples also
indicate a widespread infection of the virus with 7.5%, 7.0%, and 15.9% of respective farmed rabbits positive
(Cossaboom et al. 2011; Zhao et al. 2009). A study in France identi�ed a similar proportion of farmed rabbits
positive for HEV RNA at 7.0%, while 23.0% of wild rabbits were also positive (Izopet et al. 2012). Pathogenesis
and course of infection of rabbit HEV in the rabbit model. The rabbit likely acts as a reservoir for HEV since the
rabbit HEV belongs to the zoonotic genotype 3 that infects humans. The close genetic and antigenic
relationship to other mammalian HEV strains indicates the potential of rabbit HEV infection in rabbits to serve
as a useful naturally-occurring animal model for human HEV study. Experimentally, rabbits are susceptible to
infection by human HEV genotype 4, and rabbit HEV has been successfully transmitted to pigs (Cossaboom et
al. 2012) and cynomolgus macaques (Liu et al. 2013). Anti-HEV antisera from rat, swine, human, and chicken
strains of HEV cross-react with the rabbit HEV capsid protein (Cossaboom et al. 2012). Experimental infection
studies in rabbits indicate the ability to produce local hepatocellular necrosis on microscopic evaluation;
however, rabbits respond subclinically to experimental infection with HEV with little to no overt signs of
disease. Following experimental infection, rabbits shed virus in their feces, seroconvert, and show elevations in
serum alanine aminotransferase levels, indicating acute liver damage (Ma et al. 2010). More in depth studies
on pathogenicity and cross-species infections are warranted to further characterize the usefulness of rabbit
HEV as a naturally-occurring model for human HEV. Other potential naturally-occurring animal models of
hepatitis E Rat model. A rat strain of HEV was identi�ed in Hamburg, Germany in 2009 from Norway rats
collected in sewers (Johne et al. 2011). The strain shared 59.9% and 49.9% nucleotide sequence identity with
human and avian HEV strains indicating a putative new mammalian genotype. Studies from Japan, China,
Indonesia, the United States, and Germany also indicate the presence of a rat strain of HEV based upon the
presence of anti-HEV antibodies, and in addition to Germany, rat HEV has been genetically identi�ed from rats
in a number of other countries including the United States (Purcell et al.
2011) and Japan. In the United States, a variable prevalence of anti- HEV antibodies in rats of the genus Rattus
exists ranging from 44%-90% in different states, and in addition to the rat HEV (Purcell et al., 2011), a genotype
3 HEV RNA has been reportedly detected in wild rats in the United States (Lack et al. 2012), although
independent con�rmation of this report is still lacking . Naturally infected rats had no overt signs of illness
related to HEV infection. In experimental studies on laboratory rats infected with rat HEV, seroconversion and
fecal shedding of virus were detected; however, no clinical signs were apparent (Li et al. 2013). Histopathologic
evaluation of hepatic tissues from the infected laboratory rats identi�ed mild portal in�ammation, parenchymal
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 69/156
foci of necrosis, and aggregates of lymphocytes and Kupffer cells within the lobules indicating evidence of
mild hepatitis consistent with acute HEV infection (Purcell et al. 2011). As a potential model for human HEV
infection, inoculation of rats with mammalian HEV genotypes 1, 2, and 4 failed to produce an e�cient infection
and rat HEV failed to infect rhesus monkeys (Purcell et al. 2011) (Table 2). In a separate report, Wistar rats
were not susceptible to experimental infection by genotypes 1, 3, or 4 HEV, while rat HEV elicited evidence of
infection as expected (Li et al. 2013). Additionally, both swine HEV and avian HEV also failed to elicit a
productive infection in rats further demonstrating the limited utility of rats as a naturally-occurring model or an
experimental model of human HEV infection (Krawczynski et al. 2011; Purcell et al. 2011). Ferret. A ferret strain
of HEV was genetically identi�ed in the Netherlands in 2010. Phylogenetic analysis revealed its clustering with
the rat HEV (Raj et al. 2012). Nucleotide sequence identity with known genotypes 1-4, rabbit, and avian strains
of HEV ranged from 54.5% to 60.5% with the highest sequence identity to rat HEV at 72.3% (Raj et al. 2012).
Little is known about the ferret HEV and the current knowledge relies on one set of samples obtained from
household pets with no known illness (Raj et al. 2012). Whether ferret HEV can serve as a useful model for
HEV is unclear, however, given the close genetic relatedness of the ferret HEV to rat HEV, the usefulness of
ferret HEV as a naturally-occurring animal model for HEV is likely limited. Application of Naturally Occurring
Animal Models for HEV Studies Vaccine studies The mouse models have been used for identi�cation of
immunogenic properties of HEV antigen and preliminary immunization trials in HEV vaccine development
(Table 3). However, the mice species were non-permissive for HEV infection and were unable to be used for
HEV challenge studies (Krawczynski et al. 2011). Therefore, the mouse models are mainly used for preliminary
assessment of HEV vaccine antigen immunogenicity studies. HEV DNA vaccine constructs, puri�ed VLPs, and
recombinant subunit capsid protein all lead to the development of immune responses in the mouse model
(Krawczynski et al. 2011). Rhesus and cynomolgus monkeys were utilized in the vaccine preclinical and
challenge studies to identify potential candidate vaccines that elicit protective immunity against known HEV
genotypes (Krawczynski et al. 2011). The HEV capsid-based recombinant vaccine candidates elicit protective
immune responses. A recombinant vaccine proved to be e�cacious in phase II clinical trials in young men with
95% protection against HEV genotype 1 in Nepal (Shrestha et al. 2007). Another recombinant vaccine proved to
be e�cacious in phase II and III clinical trials in the general population (ages 16-65 years) and in pregnant
women for human HEV genotypes 1 and 4 with 100% protection (Zhu et al. 2010). E�cacy was achieved with
both 2 and 3-dose regimens with no serious adverse events and minimal side effects (Shrestha et al. 2007; Zhu
et al. 2010). Rhesus monkeys immunized with the candidate vaccines were subsequently challenged by
intravenous inoculation of human HEV genotypes 1, 2 and 3 for evaluation of protective immunity (Krawczynski
et al. 2011). In both cases, the macaques were protected against homologous and heterologous challenge by
HEV strains (Krawczynski et al. 2011). The large-scale clinical trial of a capsid-based recombinant vaccine
involving 11,165 individuals (Zhu et al. 2010) has led to the approval of the �rst commercial HEV vaccine in
China (Pro�tt 2012). Pigs have been used as a model for HEV vaccine trials and assessment of cross-
protective potentials of recombinant HEV antigens, which is essential for the development of vaccines that
protect against the zoonotic genotypes 3 and 4 strains of HEV. Pigs vaccinated with truncated recombinant
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 70/156
capsid antigens derived from three different animal strains of HEV speci�cally induce strong anti-HEV IgG
responses, and these responses are partially cross-protective against a genotype 3 mammalian HEV (Sanford
et al. 2012b). In addition, prior infection of pigs with a genotype 3 swine HEV induces protective immunity
enabling resistance against challenge by heterologous and homologous strains of genotypes 3 and 4 HEV
(Sanford et al. 2011), further demonstrating that swine are a good naturally-occurring animal model for HEV
vaccine research. Chicken has also been used as a model for HEV vaccine studies. Immunization of chickens
with avian HEV capsid protein induces protective immunity against avian HEV challenge (Guo et al. 2007), thus
con�rming the role of HEV capsid protein in eliciting protective immunity. The identi�cation of B-cell epitopes
within the
avian HEV capsid protein that are unique to avian, swine, or human
strains of HEV are useful for future diagnostic immunoassays as well as vaccine design (Guo et al. 2006). In
chickens
immunized with KLH (keyhole limpet hemocyanin)- conjugated capsid peptides, protection against
avian HEV
challenge was not achieved. In contrast, in chickens immunized with recombinant avian HEV capsid antigen,
complete protective immunity against avian HEV challenge was obtained, indicating that the immunodominant
epitopes in avian HEV capsid are not protective (Guo et al. 2008). Rabbits may also be useful for HEV vaccine
challenge and e�cacy trials with further characterization of the course of infection and disease (Cheng et al.
2012). Pathogenesis studies Historically, primates served as the main animal model for HEV pathogenicity
studies; however, due to ethical concerns, availability of animals, restrictions on their use, and di�culty in
assessing clinical relevance since primates are not the natural host for HEV, additional naturally- occurring
animal models have recently been used for pathogenicity studies (Billam et al. 2005; Purcell and Emerson
2001) (Table 3). Rhesus (Arankalle et al. 1995) and cynomolgus monkeys (Aggarwal et al. 2001; Bradley et al.
1987; Tsarev et al. 1993a) have been widely used to study HEV infection and pathogenesis; however,
differences in liver enzyme elevations, virus excretion, serologic, and histopathologic results between species
and in relation to a human host exist. The chimpanzee model has also been useful in analyzing the course of
human infections and pathogenicity with genotype 1 and 2 human HEV, and host gene responses to HEV;
although, the use of chimpanzees in HEV study is currently less frequent and more restricted (Arankalle et al.
1988; McCaustland et al. 2000). The mechanisms leading to a chronic course of HEV infection in
immunocompromised individuals as well as elevated mortality rates in pregnant women of up to 25% are
largely unknown due to the inability to identify an appropriate animal model (Meng 2013). Inoculation of
pregnant rhesus monkeys with genotype 1 HEV failed to identify a difference with non-pregnant monkeys and
was unsuccessful in reproducing the elevated mortality rates seen in pregnant women or the development of
the reported severe and fulminant hepatitis E (Tsarev et al. 1995). With the discovery of swine HEV, domestic
swine became a potential model for HEV pathogenicity study; although such studies are limited due to the fact
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 71/156
that swine infected by swine or human HEV develop only subclinical infection with mild-to-moderate pathologic
lesions of hepatitis (Meng 2003; Meng et al. 1997). Experimental infections of pigs with HEV are also limited
by the inability to produce a natural course of infection via natural oral route of inoculation. Even using high
titers of infectious HEV stocks, many experiments have failed to initiate a productive infection via the oral route
in swine (Kasorndorkbua et al. 2004). However, intravenous route of inoculation of swine HEV and human HEV
in the pig model produced characteristic pathological liver lesions; although, clinical sign of hepatitis is lacking
(Halbur et al. 2001). To assess the enhanced pathogenic effect of HEV infection during pregnancy observed in
humans, pregnant gilts were inoculated with swine HEV (Kasorndorkbua et al. 2003). While the gilts developed
active HEV infection, the offspring remained seronegative, and no clinical disease was noted (Kasorndorkbua
et al. 2003), further con�rming the results from the pregnant monkey study. Therefore, the naturally-occurring
swine model is limited for HEV pathogenicity studies, although this model has been useful for various other
aspects of HEV research (Feagins et al. 2008; Huang et al. 2005). Avian HEV infection in chickens leads to
Hepatitis-Splenomegaly Syndrome including egg drop, regressive ovaries, and serosanguinous abdominal �uid
(Meng et al. 2008). The presence of liver gross abnormalities in the chicken model shares similarities with the
course of HEV infection and disease in humans allowing a better characterization of HEV pathogenesis in this
naturally-occurring chicken model (Billam et al. 2005). Additionally, the chicken model affords the opportunity
to mimic the natural route of HEV infection with oronasal delivery of virus inocula (Billam et al. 2005). While the
route of virus inoculation affects the timing of seroconversion (i.v. develops earlier than oronasal), the patterns
of seroconversion, viremia, and development of clinical and pathologic lesions are similar to those seen in HEV
infection in humans (Billam et al. 2005). In a comparative pathogenicity study utilizing a strain of avian HEV
(HEV-VA strain) obtained from a clinically healthy chicken and the prototype avian HEV strain recovered from a
diseased chicken, no signi�cant differences were seen in pathogenicity indicating that other unknown factors
may also be involved in the HEV pathogenesis (Billam et al. 2009). In another study, avian HEV-VA was capable
of inducing histopathologic liver lesions despite failing to elicit a clinical disease in the chicken model (Kwon et
al. 2011). With chickens being a naturally- occurring animal model mimicking certain aspects of the human
disease, identi�cation of viral and host factors that determine pathogenicity in chickens would serve as a
baseline for identifying these same factors in HEV infection in humans. A major drawback for this model is
that chickens are not susceptible to infection by mammalian HEV strains. Rabbits inoculated with human HEV
genotypes 1 and 4 failed to produce clinical disease, elevated liver enzymes, or signi�cant histopathologic
lesions as seen in rabbits inoculated with rabbit HEV (Ma et al. 2010). Genotype 4 human HEV was capable of
infecting only 2 of 9 rabbits, thus con�rming the ability for cross-species infection but at an ine�cient level (Ma
et al. 2010). Genotype 1 human HEV was incapable of eliciting any markers of HEV infection in rabbits, and
thus the usefulness of the rabbit model for HEV pathogenicity study remains to be determined. Molecular
biology and virus replication studies Experimental infections of rhesus and cynomolgus monkeys have been
widely used for infectivity and replication studies through intravenous and intrahepatic inoculations (Aggarwal
et al. 2001; Krawczynski et al. 2011; Tsarev et al. 1993a) (Table 3). Hepatic expression of HEV antigens
indicating viral replication in conjunction with the detection of HEV RNA in bile and feces were identi�ed in
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 72/156
rhesus macaques prior to appearance of gross lesions within the liver parenchyma (Krawczynski et al. 2011).
Chimpanzees and rhesus macaques have been successfully used to determine the infectivity of infectious
cDNA clones of HEV via intrahepatic inoculation of RNA transcripts synthesized from cloned cDNA genome of
HEV (Emerson et al., 2001). The non-human primate model has been indispensable in studying HEV replication
especially during the early days after the virus discovery. The naturally-occurring swine model has played
important roles in understanding the molecular mechanism of HEV replication. By using the swine model, a
genotype 3 swine HEV infectious clone was established without the need of an in vitro cell culture system
(Huang et al. 2005; Krawczynski et al. 2011). Intrahepatic inoculation of pigs with capped RNA transcripts from
HEV infectious clones provided a unique means to study the effect of in vitro genetic manipulation of HEV
genome on virus replication and pathogenicity (Huang et al. 2005). The identi�cation of an attenuated mutant
HEV (pSHEV-1) led to the characterization of speci�c amino acid residues (F51L, T59A, and S390L) in the
capsid protein that are important for virus attenuation in the swine model (Cordoba et al. 2011). Both the T59A
and S390L mutations drastically lowered viral RNA loads in intestinal contents, bile, and liver, and shortened
the duration of fecal viral shedding (Cordoba et al. 2011). The hypervariable region (HVR) in ORF1 of HEV
varies considerably between different HEV genotypes and among HEV strains. By using the swine model, it
was demonstrated that the HVR of HEV is dispensable for HEV infectivity, although a near complete deletion of
the HVR attenuated the virus (Pudupakam et al. 2009). By using the chicken model, the impact of complete
HVR deletion on virus infectivity was further tested using an avian HEV mutant with a complete HVR deletion.
Although the HVR deletion mutant was still replication competent in LMH chicken cells in vitro, the complete
HVR-deletion mutant resulted in a loss of avian HEV infectivity in the chicken model (Pudupakam et al. 2011).
The small ORF3 protein of HEV is multifunctional and involved in virus replication in vivo (Huang et al. 2007;
Kenney et al. 2012). Using a homologous naturally-occurring pig model, the authentic initiation site for HEV
ORF3 translation was identi�ed as the third in-frame AUG codon in the junction region (Huang et al. 2007). A
mutant virus with a mutation in the third in- frame AUG completely abolished the virus infectivity in the pig
model, whereas mutations in the �rst and second in-frame AUG codons in the junction region did not affect the
virus infectivity in pigs (Huang et al. 2007). Furthermore, by utilizing the naturally-occurring chicken model, it
was demonstrated that the PSAP motif in the ORF3 of avian HEV is involved in particle release from the cell
and viral fecal shedding (Kenney et al. 2012). Taken together, in the absence of an e�cient cell culture system
for HEV, these naturally-occurring swine and chicken models are important for studying the molecular
mechanisms of HEV replication. Cross-species HEV infection studies Rhesus monkeys are widely used in HEV
cross-species infection studies due to the ability to be infected by all four genotypes of human HEV and
development of virologic, pathologic, and serologic characteristics consistent with HEV infection (Krawczynski
et al. 2011) (Table 3). Two rhesus monkeys and one chimpanzee were successfully infected with a genotype 3
swine HEV resulting in acute viral hepatitis, seroconversion to anti-HEV antibodies, fecal virus shedding,
viremia, and slight elevations in ALT, thus serving as experimental surrogates for human HEV infections (Meng
et al. 1998). Rhesus macaques were also successfully infected with an Indian strain of genotype 4 swine HEV
as evidenced by viremia and seroconversion to anti-HEV antibodies (Arankalle et al. 2006). In addition,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 73/156
cynomolgus monkeys were readily infected with rabbit HEV with the development of viremia, elevated liver
enzymes, presence of fecal virus shedding, and seroconversion to HEV antibodies indicating that, similar to
other genotype 3 HEV strains, the rabbit HEV may likely infect humans (Liu et al. 2013). The swine model has
been used to study the cross-species infection and susceptibility of human HEV. Speci�c-pathogen-free pigs
are readily infected by the genotypes 3 and 4 strains of human HEV (Cordoba et al. 2012; Feagins et al. 2008;
Meng 2003). In infected pigs, seroconversion occurred by 28 dpi and fecal viral shedding and viremia occurred
by 7-56 dpi indicating that swine serve as an excellent model for human HEV infection (Feagins et al. 2008). By
using the swine model, it was demonstrated that intergenotypic chimeric
HEVs with the genotype 4 human HEV capsid gene cloned in the backbone of
genotype 3 swine HEV are infectious in pigs, furthering con�rming the zoonotic nature of genotypes 3 and 4
HEV (Feagins et al. 2011). Swine were also shown to be susceptible to infection by rabbit HEV, but resistant to
infection with the rat HEV (Cossaboom et al. 2012). The pig model will be important in identifying the genetic
elements in the virus genome that determine the cross-species HEV infection between humans and swine.
Under experimental conditions, avian HEV from chickens has been demonstrated to cross species barriers and
infect turkeys (Sun et al. 2004); however, attempts to infect rhesus monkeys with avian HEV were unsuccessful
(Huang et al. 2004), suggesting that avian HEV has a limited host range and is not zoonotic. Turkeys inoculated
with avian HEV seroconverted by 4-6 weeks post-infection, viremia was detected by 2-6 weeks, and a control
negative turkey became infected by direct contact (Sun et al. 2004) indicating that the infection is readily
transmissible in a new host. Rodents including Balb/c nude mice (Huang et al. 2009), C57BL/6 mice (Li et al.
2008), Wistar rats (Li et al. 2013), and Mongolian gerbils (Li et al. 2009) may potentially serve as animal
models for some aspects of HEV study; however, few transmission studies in these species resulted in
productive infections, and some of these reports have not yet been independently con�rmed. Rabbits serve as
a natural host for genotype 3 HEV and are susceptible experimentally to infection by human HEV genotype 4
(Liu et al. 2013). Experimental HEV inoculations in rabbits yield viremia with fecal virus shedding,
seroconversion, and mild hepatic lesions consistent with HEV infection (Ma et al. 2010). The rabbit strain of
HEV was shown capable of infecting swine and rhesus monkeys indicating the ability of rabbit HEV to infect
across species barrier (Cossaboom et al. 2012). The susceptibility to cross-species infection of rabbits by
human HEV genotypes 3 and 4 indicated the potential use of rabbits as an alternate model for human HEV.
Future Perspectives Despite recent advances in the genetic identi�cation of novel animal strains of HEV,
characterization of the course of infection and disease in a variety of animal hosts, the underlying molecular
mechanisms of HEV replication, pathogenesis and cross-species infection remain largely unknown in part due
to the lack of an e�cient cell culture and a practical animal model for HEV. Several naturally-occurring animal
models such as swine, chicken and rabbit have recently been developed and shown to be useful for various
aspects of HEV studies. However, there still lacks a reproducible hepatic disease animal model for the study of
human HEV pathogenesis. For examples, the observed severe and fulminant hepatitis E in pregnant women
could not be reproduced in pregnant pigs or pregnant rhesus monkeys. Such an animal model will be critical in
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 74/156
identifying the underlying mechanisms of fulminant hepatitis E during pregnancy. Currently, chronic and
persistent HEV infection is an emerging and signi�cant clinical problem in immunocompromised individuals
such as organ transplant recipients. Unfortunately, a useful animal model that can mimic chronic HEV infection
is still lacking, and thus hindering our understanding the mechanism for progression into chronicity and the
progress of developing effective antivirals against chronic hepatitis E. Clearly, identifying additional animal
models that can more adequately mimic the course of HEV infection and outcomes of disease in humans are
important for future HEV research. The expanding host range of HEV offers the opportunities to identify
potential new animal strains of HEV that could lead to the development of better naturally- occurring animal
model(s) for HEV. Therefore, genetic identi�cation and characterization of additional novel animal strains of
HEV are warranted, and development of an e�cient cell line to propagate different strains of HEV in vitro will
be the key for future development of a cost- effective modi�ed live-attenuated vaccine against HEV.
Acknowledgements The author’s research on HEV is supported by grants from the National Institutes of Health
(R01AI074667, and
R01AI050611). D.M.Y. is supported by a training grant from the National Institutes of Health (T32OD010430-
06). We thank Dr. Dianjun Cao for his expert help in the construction of the phylogenetic tree. References
Aggarwal R. 2011. Clinical presentation of hepatitis e. Virus Res 161(1):15-22. Aggarwal R, Kamili S, Spelbring
J, Krawczynski K.
2001. Experimental studies on subclinical hepatitis e virus infection in cynomolgus macaques. J Infect Dis
184(11):1380-
1385.
Arankalle VA, Chadha MS, Chobe LP, Nair R, Banerjee K. 1995. Cross-challenge studies in rhesus monkeys
employing different indian isolates of hepatitis e virus. J Med Virol 46(4 ):358-
363. Arankalle VA, Chobe LP, Chadha MS. 2006. Type-iv indian swine hev infects rhesus monkeys. J Viral Hepat
13(11):742-745. Arankalle VA, Goverdhan MK,
Banerjee K. 1994. Antibodies against hepatitis e virus in old world monkeys. J Viral Hepat 1(2):
125-129. Arankalle VA, Ticehurst J, Sreenivasan MA, Kapikian AZ, Popper H, Pavri KM, Purcell RH.
1988. Aetiological association of a virus-like particle with enterically transmitted non-a, non-b hepatitis. Lancet
1 (8585):
550-554.
Balayan MS, Andjaparidze AG, Savinskaya SS, Ketiladze ES, Braginsky DM, Savinov AP, Poleschuk VF. 1983.
Evidence for a virus in non-a, non-b hepatitis transmitted via the fecal-oral route. Intervirology 20(1 ):23-31.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 75/156
Batts W, Yun S, Hedrick R, Winton J. 2011. A novel member of the family hepeviridae from cutthroat trout
(oncorhynchus clarkii). Virus Res 158(1-2):116-123. Billam P, Huang F, Sun Z, Pierson F, Duncan R, Elvinger F,
Guenette D, Toth T, Meng XJ. 2005. Systematic pathogenesis and replication of avian hepatitis e virus in
speci�c- pathogen-free adult chickens. J Virol 79(6):3429-3437. Billam P, LeRoith T, Pudupakam RS, Pierson
FW, Duncan RB, Meng XJ. 2009. Comparative pathogenesis in speci�c-pathogen-free chickens of two strains
of avian hepatitis e virus recovered from a chicken with hepatitis-splenomegaly syndrome and from a clinically
healthy chicken. Vet Microbiol 139(3-4):253-261. Bradley D, Andjaparidze A, Cook EH, Jr., McCaustland K,
Balayan M, Stetler H, Velazquez O, Robertson B, Humphrey C, Kane M, et al. 1988. Aetiological agent of
enterically transmitted non-a, non-b hepatitis. J Gen Virol 69 ( Pt 3):731-738. Bradley DW, Krawczynski K, Cook
EH, Jr., McCaustland KA, Humphrey CD, Spelbring JE, Myint H, Maynard JE. 1987. Enterically transmitted non-a,
non-b hepatitis: Serial passage of disease in cynomolgus macaques and tamarins and recovery of disease-
associated 27- to 34-nm viruslike particles. Proc Natl Acad Sci U S A 84(17):6277-6281. Cheng X, Wang S, Dai
X, Shi C, Wen Y, Zhu M, Zhan S, Meng J. 2012.
Rabbit as a novel animal model for hepatitis e virus infection and vaccine evaluation.
PLoS One 7(12):e51616. Cordoba L, Feagins AR, Opriessnig T, Cossaboom CM, Dryman BA, Huang YW, Meng
XJ. 2012. Rescue of a genotype 4 human hepatitis e virus from cloned cdna and characterization of
intergenotypic chimeric viruses in cultured human liver cells and in pigs. J Gen Virol 93(Pt 10):2183-2194.
Cordoba L, Huang YW, Opriessnig T, Harral KK, Beach NM, Finkielstein CV, Emerson SU, Meng XJ. 2011. Three
amino acid mutations (f51l, t59a, and s390l) in the capsid protein of the hepatitis e virus collectively contribute
to virus attenuation. J Virol 85(11):5338- 5349. Cossaboom C, Cordoba L, Dryman B, Meng X-J. 2011. Hepatitis
e virus in rabbits, virginia, USA. Emerg Infect Dis 17(11):2047-2049. Cossaboom CM, Cordoba L, Sanford BJ,
Pineyro P, Kenney SP, Dryman BA, Wang Y, Meng XJ. 2012. Cross-species infection of pigs with a novel rabbit,
but not rat, strain of hepatitis e virus isolated in the united states. J Gen Virol 93(Pt 8):1687-1695.
de Deus N, Casas M, Peralta B, Nofrarías M, Pina S, Martín M, Segalés J. 2008. Hepatitis e virus infection
dynamics and organic distribution in naturally infected pigs in a farrow-to- �nish farm. Vet Microbiol 132(
1-2):19-28. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V, Melim Zerbinati R, Gloza- Rausch F,
Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A, Müller M, Ulrich R, Leroy E,
Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis e virus-related viruses that form a putative novel
genus within the family hepeviridae. J Virol 86(17):9134-9147. Feagins A, Opriessnig T, Huang Y, Halbur P,
Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free pigs by a genotype 4 strain of human
hepatitis e virus. J Med Virol 80(8):1379-1386. Feagins AR, Cordoba L, Sanford BJ, Dryman BA, Huang YW,
LeRoith T, Emerson SU, Meng XJ. 2011. Intergenotypic chimeric hepatitis e viruses (hevs) with the genotype 4
human hev capsid gene in the backbone of genotype 3 swine hev are infectious in pigs. Virus Res 156(1-
2):141-146.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 76/156
Guo H, Zhou EM, Sun ZF, Meng XJ. 2007. Protection of chickens against avian hepatitis e virus (avian
hev) infection by immunization with recombinant avian hev capsid protein. Vaccine 25(15 ):2892-2899. Guo
H, Zhou EM, Sun ZF, Meng XJ.
2008.
Immunodominant epitopes mapped by synthetic peptides on the capsid protein of avian hepatitis e virus are
non-protective. Viral Immunol
21(1):61-67.
Guo H, Zhou EM, Sun ZF, Meng XJ, Halbur PG. 2006. Identi�cation of b-cell epitopes in the capsid protein
of avian hepatitis e virus (avian hev) that are common to human and swine hevs or unique to avian hev. J Gen
Virol 87 (Pt 1):217-
223. Halbur PG,
Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng
XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis e viruses recovered from a pig and a
human. J Clin Microbiol 39(
3):918-923. Haqshenas G, Shivaprasad H, Woolcock P, Read D, Meng XJ. 2001. Genetic identi�cation and
characterization of a novel virus related to human hepatitis e virus from
chickens with hepatitis-splenomegaly syndrome in the united states.
J Gen Virol 82(Pt 10):2449-2462. Huang F, Sun Z, Emerson S, Purcell R, Shivaprasad H, Pierson F, Toth T, Meng
XJ. 2004. Determination and analysis of the complete genomic sequence of avian hepatitis e virus (avian hev)
and attempts to infect rhesus monkeys with avian hev. J Gen Virol 85(Pt 6):1609-1618. Huang F, Zhang W,
Gong G, Yuan C, Yan Y, Yang S, Cui L, Zhu J, Yang Z, Hua X. 2009.
Experimental infection of balb/c nude mice with hepatitis e virus. BMC Infect Dis 9 :93.
Huang FF, Haqshenas G, Shivaprasad HL, Guenette DK, Woolcock PR, Larsen CT, Pierson FW, Elvinger F, Toth
TE, Meng XJ. 2002. Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e virus from
chickens in the united states. J Clin Microbiol 40(11):4197-4202. Huang YW, Haqshenas G, Kasorndorkbua C,
Halbur PG, Emerson SU, Meng XJ. 2005. Capped rna transcripts of full-length cdna clones of swine hepatitis e
virus are replication competent when transfected into huh7 cells and infectious when intrahepatically
inoculated into pigs. J Virol 79(3):1552-1558. Huang YW, Opriessnig T, Halbur PG, Meng XJ. 2007. Initiation at
the third in-frame aug codon of open reading frame 3 of the hepatitis e virus is essential for viral infectivity in
vivo. J Virol 81(6):3018-3026. Izopet J, Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar
N, Abravanel F, Guerin JL. 2012.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 77/156
Hepatitis e virus strains in rabbits and evidence of a closely related strain in humans, france.
Emerg Infect Dis 18(8):1274-1281. Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke
A, Ulrich R. 2011. Novel hepatitis e virus genotype in norway rats, germany. Emerg Infect Dis 16(9):1452- 1455.
Kamar N, Rostaing L, Izopet J. 2013. Hepatitis e virus infection in immunosuppressed patients: Natural history
and therapy. Semin Liver Dis 33
(1):62-70. Kamar N, Selves J, Mansuy JM,
Ouezzani L, Peron JM, Guitard J, Cointault O, Esposito L, Abravanel F, Danjoux M, Durand D, Vinel JP, Izopet J,
Rostaing L. 2008.
Hepatitis e virus and chronic hepatitis in organ-transplant recipients. N Engl J
Med 358(8):811-817. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004. Routes of
transmission of swine hepatitis e virus in pigs. J Clin Microbiol 42(11):5047-5052. Kasorndorkbua C, Thacker
BJ, Halbur PG, Guenette DK, Buitenwerf RM, Royer RL, Meng XJ.
2003. Experimental infection of pregnant gilts with swine hepatitis e virus. Can J Vet Res 67(4):303-
306. Kenney SP, Pudupakam RS, Huang YW, Pierson FW, LeRoith T, Meng XJ. 2012. The psap motif within the
orf3 protein of an avian strain of the hepatitis e virus is not critical for viral infectivity in vivo but plays a role in
virus release. J Virol 86(10):5637-5646. Khuroo MS. 2011. Discovery of hepatitis e: The epidemic non-a, non-b
hepatitis 30 years down the memory lane. Virus Res 161(1):3-14. Krawczynski K, Meng X-J, Rybczynska J.
2011. Pathogenetic elements of hepatitis e and animal models of hev infection. Virus Res 161(1):78-83. Kwon
HM, LeRoith T, Pudupakam RS, Pierson FW, Huang YW, Dryman BA, Meng XJ. 2011. Construction of an
infectious cdna clone of avian hepatitis e virus (avian hev) recovered from a clinically healthy chicken in the
united states and characterization of its pathogenicity in speci�c-pathogen-free chickens. Vet Microbiol 147(3-
4):310-319. Lack J, Volk K, Van Den Bussche R. 2012.
Hepatitis e virus genotype 3 in wild rats, united states.
Emerg Infect Dis 18(8):1268-1273.
Leblanc D, Ward P, Gagne MJ, Poitras E, Muller P, Trottier YL, Simard C, Houde A. 2007. Presence of
hepatitis e virus in a naturally infected swine herd from nursery to slaughter. Int J Food Microbiol 117(2):
160-166. Li TC, Suzaki Y, Ami Y, Tsunemitsu H, Miyamura T, Takeda N. 2008. Mice are not susceptible to
hepatitis e virus infection. J Vet Med Sci 70(12):1359-1362. Li TC, Yoshizaki S, Ami Y, Suzaki Y, Yasuda SP,
Yoshimatsu K, Arikawa J, Takeda N, Wakita T. 2013. Susceptibility of laboratory rats against genotypes 1, 3, 4,
and rat hepatitis e viruses. Vet Microbiol 163(1-2):54-61. Li WG, Sun Q, She RP, Wang DC, Duan XH, Yin J, Ding
Y. 2009. Experimental infection of mongolian gerbils by a genotype 4 strain of swine hepatitis e virus. J Med
Virol 81(9):1591-1596. Liu P, Bu QN, Wang L, Han J, Du RJ, Lei YX, Ouyang YQ, Li J, Zhu YH, Lu FM, Zhuang H.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 78/156
2013. Transmission of hepatitis e virus from rabbits to cynomolgus macaques. Emerg Infect Dis 19(4):559-
565. Ma H, Zheng L, Liu Y, Zhao C, Harrison TJ, Ma Y, Sun S, Zhang J, Wang Y. 2010. Experimental infection of
rabbits with rabbit and genotypes 1 and 4 hepatitis e viruses. PLoS One 5(2):e9160. Marek A, Bilic I, Proko�eva
I, Hess M. 2010. Phylogenetic analysis of avian hepatitis e virus samples from european and australian chicken
�ocks supports the existence of a different genus within the hepeviridae comprising at least three different
genotypes. Vet Microbiol 145(1-2):54-61. McCaustland KA, Krawczynski K, Ebert JW, Balayan MS, Andjaparidze
AG, Spelbring JE, Cook EH, Humphrey C, Yarbough PO, Favorov MO, Carson D, Bradley DW, Robertson BH. 2000.
Hepatitis e virus infection in chimpanzees: A retrospective analysis. Arch Virol 145(9):1909-1918. Meng X-J.
2011. From barnyard to food table: The omnipresence of hepatitis e virus and risk for zoonotic infection and
food safety. Virus Res 161(1):23-30. Meng X-J. 2013. Zoonotic and foodborne transmission of hepatitis e virus.
Semin Liv Dis 33(1):41-49.
Meng XJ. 2003. Swine hepatitis e virus: Cross-species infection and risk in xenotransplantation. Curr Top
Microbiol
Immunol 278:185-216.
Meng XJ. 2010. Hepatitis e virus: Animal reservoirs and zoonotic risk. Vet Microbiol 140(3- 4 ):256-
265.
Meng XJ, Anderson DA, Arankalle VA, Emerson SU, Harrison TJ, Jameel S, Okamoto H. 2012. Hepeviridae.
London, United Kingdom. Meng XJ, Dea S, Engle RE, Friendship R, Lyoo YS, Sirinarumitr T, Urairong K, Wang D,
Wong D, Yoo D, Zhang Y, Purcell RH, Emerson SU. 1999. Prevalence of antibodies to the hepatitis e virus in pigs
from countries where hepatitis e is common or is rare in the human population. J Med Virol 59(3):297-302.
Meng XJ, Halbur P, Shapiro M, Govindarajan S, Bruna J, Mushahwar I, Purcell R, Emerson S. 1998. Genetic and
experimental evidence for cross-species infection by swine hepatitis e virus. J Virol 72(12):9714-9721.
Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B,
Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis e virus. Proc Natl Acad Sci
U S A 94(18):9860-9865.
Meng XJ, Shivaprasad H, Payne CJ. 2008. Hepatitis e virus infections.
In: Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE, editors. Diseases of
Poultry.
13th ed. Ames, Iowa: Blackwell Publishing Press. p. 443-452.
Nakamura M, Takahashi K, Taira K, Taira M, Ohno A, Sakugawa H,
Arai M, Mishiro S. 2006.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 79/156
Hepatitis e virus infection in wild mongooses of okinawa, japan: Demonstration of anti- hev antibodies and a
full-genome nucleotide sequence. Hepatol Res 34(3 ):137-
140. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis e and pregnancy: Understanding the
pathogenesis. Liver Int 28(9):1190-1199.
Pavio N, Meng X-J, Renou C. 2010. Zoonotic hepatitis e: Animal reservoirs and emerging risks. Vet Res 41(
6):46. Payne CJ, Ellis TM, Plant SL, Gregory AR, Wilcox GE. 1999. Sequence data suggests big liver and spleen
disease virus (blsv) is genetically related to hepatitis e virus. Vet Microbiol 68(1-2):119-125. Pro�tt A. 2012.
First hev vaccine approved. Nat Biotech 30(4):300. Pudupakam RS, Huang YW, Opriessnig T, Halbur PG,
Pierson FW, Meng XJ. 2009. Deletions of the hypervariable region (hvr) in open reading frame 1 of hepatitis e
virus do not abolish virus infectivity: Evidence for attenuation of hvr deletion mutants in vivo. J Virol 83(1):384-
395. Pudupakam RS, Kenney SP, Cordoba L, Huang YW, Dryman BA, Leroith T, Pierson FW, Meng XJ. 2011.
Mutational analysis of the hypervariable region of hepatitis e virus reveals its involvement in the e�ciency of
viral rna replication. J Virol 85(19):10031-10040. Purcell R, Engle R, Rood M, Kabrane-Lazizi Y, Nguyen H,
Govindarajan S, St Claire M, Emerson S. 2011.
Hepatitis e virus in rats, los angeles, california, USA. Emerg Infect Dis 17(
12):2216-2222. Purcell RE, S.U. 2001. Hepatitis e virus. In: Knipe D, Howley P, Gri�n D, Lamb R, Martin M,
Roizman B, al. e, editors. Fields Virology 4th ed. Philadelphia, PA: Lippincott: Williams and Wilkins. p. 3051-
3061. Purcell RH, Emerson SU.
2001. Animal models of hepatitis a and e. ILAR J 42(2):
161-177. Raj V, Smits S, Pas S, Provacia L, Moorman-Roest H, Osterhaus A, Haagmans B. 2012. Novel hepatitis
e virus in ferrets, the netherlands. Emerg Infect Dis 18(8):1369-1370. Rutjes S, Lodder W, Lodder-Verschoor F,
van den Berg H, Vennema H, Duizer E, Koopmans M, de Roda Husman A. 2009. Sources of hepatitis e virus
genotype 3 in the netherlands. Emerg Infect Dis 15(3):381-387.
Saad MD, Hussein HA, Bashandy MM, Kamel HH, Earhart KC, Fryauff DJ, Younan M, Mohamed AH. 2007.
Hepatitis e virus infection in work horses in egypt. Infect Genet Evol 7(3):368-373.
Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection of
pigs with a genotype 3 swine hepatitis e virus (hev) protects against subsequent challenges with homologous
and heterologous genotypes 3 and 4 human hev. Virus Res 159(1):17-22. Sanford BJ, Emerson SU, Purcell RH,
Engle RE, Dryman BA, Cecere TE, Buechner-Maxwell V, Sponenberg DP, Meng XJ. 2012a. Serological evidence
for a hepatitis e virus-related agent in goats in the united states. Transbound Emerg Dis 60(6):538-545. Sanford
BJ, Opriessnig T, Kenney SP, Dryman BA, Cordoba L, Meng XJ. 2012b. Assessment of the cross-protective
capability of recombinant capsid proteins derived from pig, rat, and avian hepatitis e viruses (hev) against
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 80/156
challenge with a genotype 3 hev in pigs. Vaccine 30(44):6249-6255. Shrestha MP, Scott RM, Joshi DM,
Mammen MP, Jr., Thapa GB, Thapa N, Myint KS, Fourneau M, Kuschner RA, Shrestha SK, David MP, Seriwatana
J, Vaughn DW, Safary A, Endy TP, Innis BL. 2007. Safety and e�cacy of a recombinant hepatitis e vaccine. N
Engl J Med 356(9):895-903. Sun ZF, Larsen CT, Huang FF, Billam P, Pierson FW, Toth TE, Meng XJ. 2004.
Generation and infectivity titration of an infectious stock of avian hepatitis e virus (hev) in chickens and cross-
species infection of turkeys with avian hev. J Clin Microbiol 42(6):2658-2662.
Takahashi K, Kitajima N, Abe N, Mishiro S. 2004. Complete or near-complete nucleotide sequences of
hepatitis e virus genome recovered from a wild boar, a deer, and four patients who ate the deer. Virology 330(2
):501-
505. Takahashi M, Nishizawa T, Sato H, Sato Y, Jirintai, Nagashima S, Okamoto H. 2011.
Analysis of the full- length genome of a hepatitis e virus
isolate obtained from a wild boar in japan that is classi�able into a novel genotype. J Gen Virol 92(Pt 4):902-
908.
Takahashi M, Okamoto H. 2013. Features of hepatitis e virus infection in humans and animals in japan.
Hepatol Res. Teo C. 2010.
Much meat, much malady: Changing perceptions of the epidemiology of hepatitis e. Clin Microbiol Infect
16(1):24-32.
Ticehurst J, Rhodes LL, Jr., Krawczynski K, Asher LV, Engler WF, Mensing TL, Caudill JD, Sjogren MH, Hoke CH,
Jr., LeDuc JW, et al. 1992. Infection of owl monkeys (aotus trivirgatus) and cynomolgus monkeys (macaca
fascicularis) with hepatitis e virus from mexico. J Infect Dis 165(5):835-845.
Tsarev SA, Emerson SU, Tsareva TS, Yarbough PO, Lewis M, Govindarajan S, Reyes GR, Shapiro M, Purcell RH.
1993a. Variation in course of hepatitis e in experimentally infected cynomolgus monkeys. J Infect Dis
167(6):1302-1306. Tsarev SA, Tsareva TS, Emerson SU,
Kapikian AZ, Ticehurst J, London W, Purcell RH. 1993b. Elisa for antibody to hepatitis e virus (hev) based on
complete open-reading frame-2 protein expressed in insect cells: Identi�cation of hev infection in primates. J
Infect Dis 168(2):369-378. Tsarev SA, Tsareva TS, Emerson SU, Rippy MK, Zack P, Shapiro M, Purcell RH. 1995.
Experimental hepatitis e in pregnant rhesus monkeys: Failure to transmit hepatitis e virus (hev) to offspring and
evidence of naturally acquired antibodies to hev. J Infect Dis 172(1):31-37. Zhao C, Ma Z, Harrison TJ, Feng R,
Zhang C, Qiao Z, Fan J, Ma H, Li M, Song A, Wang Y. 2009. A novel genotype of hepatitis e virus prevalent
among farmed rabbits in china. J Med Virol 81(8):1371-1379.
Zhu FC, Zhang J, Zhang XF, Zhou C, Wang ZZ, Huang SJ, Wang H, Yang CL, Jiang HM, Cai
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 81/156
JP, Wang YJ, Ai X, Hu YM, Tang Q, Yao X, Yan Q, Xian YL, Wu T, Li YM, Miao J, Ng MH, Shih JW, Xia NS. 2010.
E�cacy and safety of a recombinant hepatitis e vaccine in healthy adults: A large-scale, randomised, double-
blind placebo-controlled, phase 3 trial. Lancet 376(9744):895-902. TABLES Table 1: Animals with Naturally
Occurring HEV Infections Species HEV Genotype Genetically con�rmed infection Domestic Swine 3, 4 Wild
boar 3, 4, unclassi�ed new genotype Deer 3 Chicken Avian HEV genotypes 1, 2, 3 Rabbit 3 Rat unclassi�ed new
genotype, 3 (not independently con�rmed) Mongoose 3 Moose unclassi�ed new hepevirus Ferret unclassi�ed
new hepevirus Bat unclassi�ed new hepevirus Cutthroat Trout unclassi�ed new hepevirus Serological evidence
of infection Rhesus Macaque Cynomolgus Goat Sheep Cattle Unknown Unknown Unknown Unknown Unknown
Table 2: Experimental Susceptibility of Different Animal Species to HEV strains Species Non-Human Primates:
Cynomolgus monkey Rhesus monkey Chimpanzee Tamarins Owl Monkey Vervet Squirrel Monkey Patas
Domestic Swine Rabbit Chicken Turkey Lamb HEV genotypes Human 1, 2 Rabbit HEV Human 1, 2, 3, 4 Swine 3,
4 Avian HEV Human 1, 2, 3, 4 Swine 3, 4 Human 1, 2 Human 1, 2 Human 1, 2 Human 1, 2 Human 1, 2 Human 3,
4 Human 1 Human 2 Rabbit HEV Avian HEV Rat HEV Human 4 Human 1 Swine 4 Human 1 Swine 3 Avian HEV
Avian HEV Human 1 Experimental susceptibility Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No
Yes No No Yes No Ine�cient No No Yes Yes Yes (not independently con�rmed) Rodents: Rat Human 1, 2, 3, 4
No Swine 3 No Avian HEV No Balb/C mice Swine 4 Yes C57BL/6 mice Human 1 No Swine 3,4 No Mongolian
Gerbil Swine 4 Yes (not independently con�rmed) Table 3: Applications of available animal models including
naturally occurring animal models for various aspects of HEV studies Species Application Chimpanzee
Pathogenesis, Molecular Biology and Virus Replication, Cross-species Infection Rhesus monkey Cynomolgus
Monkey Owl Monkey Rodents Swine Chicken Rabbit Vaccine, Pathogenesis, Molecular Biology and Virus
Replication, Cross-species Infection Vaccine, Pathogenesis, Molecular Biology and Virus Replication, Cross-
species Infection Cross-species Infection Vaccine, Cross-species Infection Vaccine, Pathogenesis, Molecular
Biology and Virus Replication, Cross-species Infection Vaccine, Pathogenesis, Molecular Biology and Virus
Replication, Cross-species Infection Vaccine, Pathogenesis, Cross species Infection FIGURE
Figure 1: Figure 1: A phylogenetic tree based on the full- length genomic sequences with
genotype classi�cation of known
animal strains of HEV. Sequence alignment was completed using ClustalW, MEGA version 5.2
(www.megasoftware.net) for the phylogenetic tree, and the
tree was constructed using the neighbor-joining method with the maximum composite likelihood
method
for evolutionary distances corresponding to each branch length and the units of the number of base
substitutions per site. Each of the four known genotypes (1-4) is labeled, with representative strains included
for each species, and novel strains from ferret, bat, rat, avian, and �sh identi�ed individually as separate new
putative genotypes or species. Chapter III: Hepatitis Virus Infections in Poultry Danielle M. Yugo1, Ruediger
Hauck2, H. L. Shivaprasad3, and Xiang-Jin Meng1* 1Department of
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 82/156
Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia
Polytechnic Institute and State University, Blacksburg, VA 24061-0913;
2Department of Population Health and Reproduction,
School of Veterinary Medicine, University of California, Davis, CA
95616; 3California
Animal Health and Food Safety Laboratory System, University of California-Davis, Tulare, CA 93274
Avian Diseases. 2016; Sep; 60(3): 576-588.
This is a pre- copyedited, author-produced PDF of an article accepted for publication in
Avian Diseases following peer review. The version of record
[Yugo, DM, Hauck, R, Shivaprasad, HL, and Meng, XJ, Hepatitis Virus Infections in Poultry, Avian Dis.
2016 Sep; 60(
3): 576-588.] is available online at: https://doi.org/10.1637/11229-070515-Review.1. Summary Viral hepatitis in
poultry is a complex disease syndrome caused by several viruses belonging to different families including
avian hepatitis E virus (HEV),
duck hepatitis B virus (DBHV), duck hepatitis A virus (DHAV-1, -2, -3), duck hepatitis virus
types 2 and 3, fowl adenoviruses (FAdV), and Turkey hepatitis virus (THV). While these hepatitis viruses share
the same target organ, the liver, they each possess unique clinical and biological features. In this article, we
aim to review the common and unique features of major poultry hepatitis viruses in an effort to identify the
knowledge gaps and aid the prevention and control of poultry viral hepatitis. Avian HEV is an Orthohepevirus B
in the family Hepeviridae that naturally infects chickens and consists of 3 distinct genotypes worldwide. Avian
HEV is associated with Hepatitis-Splenomegaly syndrome or Big Liver and Spleen Disease in chickens,
although the majority of the infected birds are subclinical. Avihepadnaviruses in the family of Hepadnaviridae
have been isolated from ducks, snow geese, white storks, grey herons, cranes, and parrots. DHBV evolved with
the host as a noncytopathic form without clinical signs and rarely progressed to chronicity. The outcome for
DHBV infection varies by the host’s ability to elicit an immune response and is dose and age dependent in
ducks, thus mimicking the pathogenesis of human HBV infections and providing an excellent animal model for
human HBV. DHAV
is a picornavirus that causes a highly contagious virus infection in ducks with up to
100% �ock mortality in ducklings under 6 weeks of age, while older birds remain unaffected. The high
morbidity and mortality have an economic impact on intensive duck production farming. DHV types 2 and 3 are
astroviruses in the family of Astroviridae with similarity phylogenetically to turkey astroviruses implicating the
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 83/156
potential for cross-species infections between strains. DAstV causes acute, fatal infections in ducklings with a
rapid decline within 1-2 hours and clinical and pathological signs virtually indistinguishable from DHAV. DAstV-
1 has only been recognized in the United Kingdom and recently in China, while DAstV-2 has
been reported in ducks in the United States. Fowl adenoviruses (FAdV), the causative agent of
Inclusion Body Hepatitis (IBH), is a group I avian adenovirus in the genus Aviadenovirus. The affected birds
have a swollen, friable and discolored liver, sometimes with necrotic or hemorrhagic foci. Histological lesions
include multifocal necrosis of hepatocytes and acute hepatitis with intranuclear inclusion bodies in the nuclei
of the hepatocytes. Turkey Hepatitis Virus (THV) is a picornavirus that is likely the causative agent of Turkey
viral hepatitis (TVH). Currently there are more questions than answers about THV, and the pathogenesis and
clinical impacts remain largely unknown. Future research in viral hepatic diseases of poultry is warranted to
develop speci�c diagnostic assays, identify suitable cell culture systems for virus propagation, and develop
effective vaccines. Key Words/Index Terms Avian hepatitis E (avian HEV); Duck hepatitis B virus (DHBV); Duck
hepatitis virus type 2 (DAstV-1, DAstV-2); Duck hepatitis A (DHAV); Fowl Adenovirus (FAdV); Turkey hepatitis
virus (THV) Introduction Viral hepatitis in poultry is an important disease syndrome caused by a number of
viruses including avian hepatitis E virus (avian HEV),
duck hepatitis B virus (DBHV), duck hepatitis A virus (DHAV), duck hepatitis virus
types 2 and type 3, fowl adenoviruses, and Turkey hepatitis virus. While these avian hepatitis viruses have the
same target organ, the liver, they are very different in virus biology and pathogenesis as each of these viruses
belongs to a different family. Therefore, understanding the common and unique features of these hepatitis
viruses in poultry will aid the diagnosis and differential diagnosis of viral hepatitis in poultry and help develop
more effective �ock management, preventive and control measures. Avian Hepatitis E Virus (Avian HEV)
History: A disease,
referred to as Big Liver and Spleen (BLS) Disease
(1, 2), was �rst reported in chickens in Australia (3). The estimated impact of BLS on Australia chicken
producers was a loss of 8 eggs per hen in affected broiler-breeder �ocks leading to a total 2.8 million
Australian dollar loss to the industry and nearly 50% of all �ocks affected. A similar disease, referred to as
Hepatitis-Splenomegaly (HS) syndrome, was also reported in layer and broiler- breeder chickens in the United
States and Canada in 1991(1, 2). The disease presented as a decrease in overall mortality and egg production,
while �eld veterinarians reported serosanguinous abdominal �uid or clotted blood in the abdomen and
enlarged livers and spleens at necropsy (3). Initially, attempts to link the syndrome to any speci�c agent were
unsuccessful (3-5) and only one outbreak was able to be linked to a strain of Campylobacter spp (3).
Avian hepatitis E virus (avian HEV) was �rst identi�ed from chickens with HS syndrome in the United
States
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 84/156
in 2001 (1). HS syndrome and BLS are caused by variants of the same avian HEV (1, 2, 6, 7). Classi�cation: The
BLS virus from Australia shares approximately 80% of nucleotide sequence identity with avian HEV from HS
syndrome (2, 6), while all known strains of avian HEV worldwide share approximately 60% of nucleotide
sequence identity and are divided into three separate genotypes (genotypes 1-3) (6). A recent ICTV proposal
includes division of the HEV strains among three genera: Orthohepevirus A which includes all genotypes 1-4
strains that infect humans, camels, wild boars, deer, rabbits, rats, and mongooses, Orthohepevirus B including
all avian HEV strains, Orthohepevirus C consisting of all ferret and most rat HEV strains, Orthohepevirus D
including variants of bat HEV strains, and Piscihepevirus including all strains of cutthroat trout hepeviruses (8).
Seroprevalence and transmission: Chickens are the only known reservoir for avian HEV infection under natural
conditions. Approximately 71% of chicken �ocks within the United States are seropositive to avian HEV based
on a survey of 1,276 chickens from 76 �ocks within �ve states (7). The virus appears to spread easily within
and between �ocks via the fecal-oral route of transmission (3). In an age-dependent manner, 17% of young
chickens (under 18 weeks of age) are positive for anti-HEV antibodies, while 36% of adult chickens are
seropositive (7, 9). Avian HEV infections in chickens have been described throughout the United States (1, 9,
10), Canada (7, 11), the United Kingdom (12), Australia (13), Taiwan, China (14), and Russia (15). Caged
leghorn chickens are frequently affected with reoccurrence on many farms due to circulation of the virus within
the �ock (5, 15). Broiler breeder hens, dual-purpose hens, and smaller �ocks may be infected by avian HEV with
sporadic mortality especially when housed on litter allowing for the accumulation and ease of transmission
between birds (7). In a prospective transmission study monitoring 14 seronegative chickens beginning at 12
weeks of age, all birds seroconverted to anti- HEV antibodies by 21 weeks of age (9).
Large amounts of virus are shed in feces of chickens infected
experimentally by avian HEV; therefore, feces likely serve as the main source for virus spread within the �ock
(3, 16). Other routes of transmission including aerosol, vertical, vector- borne, or mechanical carrier have not
been demonstrated in natural or experimental avian models (16). Clinical signs and pathobiology: The
mortality rate for chickens infected with avian HEV genotypes 1-3 ranges from 0.3% to 1.0% of the overall �ock
(3); therefore, many birds carry subclinical avian HEV infections, thus expediting and masking transmission
between birds. Few birds show clinical signs prior to acute death (3-5, 7, 9); however, egg drop with up to 20%
of hens presenting with reduced production and hepato-splenomegaly are described in some outbreaks (5),
while others do not appear to affect overall production. The incubation period ranges between 1-3 weeks in
birds infected via oronasal route in an experimental setting (17). In the �eld, broiler breeder and laying hens
experience the highest incidence of mortality at ages 30-72 weeks, with mortality typically lasting several
weeks during the mid-production period for these �ocks (7, 16, 18, 19). Clinical signs in BLSV-infected �ocks in
Australia have more severe infections with birds presenting with pale wattles and combs, pasty droppings,
soiled vents, anorexia, depression, and elevations in egg drop and mortality for 3-4 weeks (3, 5, 18-20). While
the eggs produced in infected chickens retain commercial value based on comparable quality, fertility, and
hatchability, the shells themselves are lacking pigment and thin (3). The appearance of IgG antibodies
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 85/156
following avian HEV infection characterizes the humoral immune response in chickens (17, 21), while
knowledge is lacking as to the cell-mediated immune response. Following inoculation via intravenous or
oronasal route, chickens seroconvert between 1-4 weeks post-infection (21). The capsid protein (ORF2) of
avian HEV shares conserved antigenic epitopes with swine and human HEV capsids and elicits a protective
immune response against avian HEV infection (22). In vitro analysis of recombinant HEV capsid proteins
demonstrates cross-reactivity between avian HEV capsid and antisera raised against human HEV (Sar-55
genotype 3 strain), swine HEV (Meng strain), and human HEV (US-2 genotype 2 strain) (22-24). Clinico-
pathological parameters of liver disease including elevations in aspartate aminotransferase (AST),
albumin/globulin (A/G) ratios, or bile acids are not present in chickens experimentally infected with avian HEV;
however, lactate dehydrogenase (LDH) levels varied with progression of virus infection with intravenously-
infected chickens exhibiting peak LDH levels one week post-infection (wpi), and oronasally-infected chickens
exhibiting peak LDH elevations from 1-4 and 6 wpi prior to returning to baseline level by 7 wpi (17). At necropsy,
birds infected with avian HEV display regressed ovaries, enlarged, hemorrhagic, friable, and necrotic livers with
subcapsular or capsular hematomas (Fig. 1), enlarged spleens, and serosanguinous �uid within the abdominal
cavity (1, 3, 7, 21). Experimental avian HEV infections in chickens display similar gross lesions at necropsy with
nearly 25% presenting with enlarged hemorrhagic livers (17). Microscopic evaluations of natural and
experimental infections in chickens consistently show in�ammatory cellular in�ltrations within the parenchyma
of the liver and a lymphocytic periphlebitis and phlebitis in the liver (17). Lesions vary from multifocal to
extensive areas of necrosis, hemorrhage, heterophillic and mononuclear in�ammatory in�ltrates as well as
segmental lymphocytic and plasma cell in�ltrates around the portal veins. Commonly, hepatocytes are
separated by interstitial accumulation of eosinophillic amyloid deposits (4, 17). The pathogenesis of avian HEV
in chickens remains mostly unknown. Presumably, the virus enters the host by direct contact with
contaminated feces via oronasal inoculation and travels to the gastrointestinal tissues where virus replication
takes place as the primary site (17, 25). The detection of avian HEV in experimentally infected chickens in the
colon, cecum as early as 5 days post-infection (dpi), jejunum by 20 dpi, ileum by 7 dpi, duodenum by 20 dpi,
and cecal tonsils by 35 dpi further con�rms a gastrointestinal site of primary virus replication. Following entry
and replication in the GI tissues, the virus travels to the liver as a secondary site of virus replication based on
experimental infections of mammalian HEV in primates and swine, and is released from hepatocytes into the
gallbladder (26). The gallbladder expels contents containing infectious avian HEV particles during normal
digestion into the small intestines where the virus is capable of traveling throughout to �nally be expelled in
excrement into the environment. The exact mechanisms of avian HEV replication and release remain largely
unknown however, and studies thus far rely solely upon the ability to detect infectious virus as con�rmation of
virus replication (16, 27). Understanding the importance of these extrahepatic sites of virus replication and
their roles in transmission are crucial in understanding and diminishing the spread of virus. Cross-species
infection: Avian HEV is limited to chickens under �eld conditions; however, turkeys were successfully infected
with avian HEV under experimental conditions as evidenced by seroconversion to anti-HEV antibodies, fecal
virus shedding, and viremia (21). The inoculated turkeys seroconverted at 4-6 wpi with viremia detectable by 2-
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 86/156
6 weeks. In addition, contact between control and infected turkeys allowed for transmission of the virus
indicating the ease of transmission in birds (21). Subsequent
attempts to infect mice (3) and rhesus macaques with avian HEV (28) were unsuccessful.
Experimentally, all ages of chickens are susceptible to infection with avian HEV by intravenous and oronasal
routes of inoculation (17, 21, 29). Embryonic chicken eggs; however, were only susceptible to avian HEV
infection when inoculated intravenously (30). Prevention and control: A vaccine against avian HEV is not yet
available. Avian HEV capsid protein has been used to induce protective immunity when challenged with avian
HEV in chickens (23). Chickens immunized with keyhole limpet hemocyanin-conjugated avian HEV capsid
(KLH) peptides did not induce protection when challenged with avian HEV (31). However, chickens immunized
with recombinant avian HEV capsid antigens had complete protection against avian HEV challenge. Identifying
speci�c B-cell epitopes within avian HEV capsid protein is useful in future vaccine design and development of
diagnostic immunoassays (24). In the lack of a vaccine, strict biosecurity and better hygiene practices on the
farm help prevent the spread of avian HEV infection in �ocks. Unanswered questions and future prospective:
Even though avian HEV was discovered more than a decade ago, there remain many unanswered questions.
Due to the lack of a cell culture system to propagate avian HEV, the biology and pathogenesis of
the virus are still poorly understood. The lack of a cell culture system signi�cantly hinders the development of
an effective and practical vaccine against avian HEV. The extent of infection and genetic variations of avian
HEV from chickens worldwide are also unknown, as thus far only three genotypes were identi�ed from
chickens in just a few countries. Although most avian HEV infections are subclinical, the effect of co-infection
between avian HEV and other poultry pathogens on disease manifestation is unknown. A commercial
diagnostic assay for avian HEV is still lacking, even though homemade RT-PCR and ELISA assays have been
used for research purpose. Future research is warranted to identify suitable cell culture systems that can
e�ciently propagate avian HEV, to develop avian HEV-speci�c diagnostic assays, to understand the effect of
avian HEV co-infection with other agents in chicken �ocks, and to develop an effective vaccine against avian
HEV.
Duck Hepatitis B Virus (DHBV) History: Following the discovery of human hepatitis B virus
(HBV) in 1970 (32) and subsequent discovery of HBV-like viruses in numerous primate species (33-36) and
non-primate species (37-39), the �rst Avihepadnavirus was identi�ed in Pekin ducks (Anas platyrhynchos
forma domestica) in 1980 (40, 41). Avihepadnaviruses have now been isolated from snow geese (Anser
caerulescens) (42), white storks (Ciconia ciconia) (43), grey herons (Ardea cinerea) (44), cranes (Grus genus)
(45), and parrots (Psittacula krameri) (46). The virus is detectable in many commercially bred �ocks. The
narrow host range of Avihepadnaviruses limits virus infection to each respective species with little cross-
species infectivity including in chickens or other Anseriformes such as Muscovy ducks (Cairina moschata)
(47). Except in cases in which a�atoxin carcinogens are present, Duck hepatitis B virus (DHBV) does not induce
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 87/156
clinical signs of pathogenicity and only rarely progress into chronicity and liver cancer (48); therefore, the virus
is assumed to have evolved with the host as a noncytopathic form (49). Classi�cation: Hepadnaviridae family
consists of Orthohepadnavirus and Avihepadnavirus genera for those viruses infecting mammals and birds,
respectively (50). Aviahepadnaviruses include
duck hepatitis B (DHBV) (41), heron hepatitis B (HHBV) (44), Ross goose hepatitis (RGHV) (42),
stork hepatitis B
(STHBV) (43), and parrot hepatitis B (PHBV) (46) viruses. DHBV is the most characterized virus of the genera
and shares approximately 40% nucleotide sequence identity with human HBV (50). Orthohepadnaviruses
include human HBV, non-human primate hepatitis viruses such as chimpanzee (ChHBV) (34), gorilla (GoHBV)
(51), orangutan (OuHBV) (52), woolly monkey (WMHBV) (33, 36), and gibbon (GiHBV) (53), rodent hepatitis
viruses such as ground squirrel (GSHV) (39), arctic squirrel (ASHV) (38), and woodchuck (WHV) (37), as well
as bat hepadnavirus from Burmese bats (BtHV) (54). All 10 genotypes (A-J) of human HBV varied with more
than 8% nucleotide sequence diversity (50, 55). The non-human primate strains carry 7-9% divergence (50) and
form geographical clusters (56), while sequence divergence with human HBV strains ranges from 10-15% for
most strains aside from WMHBV, which carries 28% nucleotide sequence diversity with other primate strains
(36). Non-primate strains of HBV constitute a separate species of Orthohepadnavirus with sequence identities
varying by 53% for BtHV, 37% for ASHV, 45% for GSHV, and 30% for WHV (50) with human HBV. Clinical signs
and pathobiology: The pathogenesis of DHBV in ducks mimics human HBV infections with an ability to lead to
an acute and transient infection or a chronic infection. Young ducks develop an age-dependent and dose-
dependent predisposition to carrying a persistent infection, while older ducks tend to clear the virus infection
transiently (57). Natural infection of DHBV occurs by
vertical transmission from an infected hen to the embryonic eggs through the bloodstream and
subsequent infection of embryonic hepatocytes at day 6 of development resulting in infected offspring (58).
Viral replication occurs in the yolk sac and developing embryonic hepatocytes resulting in a congenital
infection (58, 59) followed by continued virus replication in the hepatocytes and a small percentage in
pancreatic, kidney, and splenic cells (60) of infected ducks and geese with a very high serum viral titer (1010
virions or 1013 viral particles per ml) when persistent infection is established (49, 61). Additionally, it has been
shown that only one genome copy of the virus is needed to successfully infect a duckling and spread to nearly
full hepatocyte infection within 14 days post-inoculation (62). Chinese domestic ducks, American Pekin ducks,
and a few geese species are infected with DHBV with poor e�ciency outside the narrow host range (63).
Hepadnaviruses are cell type- and host-speci�c allowing for infections in only a few closely related species.
Infected adult ducks face a far different outcome by carrying a transient acute infection that is cleared by
neutralizing antibodies. These outcomes mimic the range of human HBV infections with neonates resulting in
persistent infections, adults resulting in transient infections, and those persistently infected resulting in varying
degrees of severity from mild chronic hepatitis to a chronic active hepatitis, liver cirrhosis, and hepatocellular
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 88/156
carcinoma (60). The outcome for DHBV infection varies based on the host’s ability to elicit an immune
response. Variability in non-cytopathic viruses include the dose of inoculum, viral replication, and cell, tissue,
and host tropism being balanced with the humoral and cell-mediated immunity of the host (60, 64). It has been
suggested that the number of lymphoid cells present or the overall maturity of the immune system affects the
ability to elicit a virus-clearing immune response resulting in the disparity seen between neonates and adults
infected with DHBV (60). The age of the duck with neonates primarily being persistently infected with DHBV
and the dose of inoculum resulting in a more severe infection consistently supports this theory (57, 59). In
young ducks inoculated experimentally with DHBV, persistent infection is evidenced by a mild mononuclear
cellular in�ltration within the portal tracts of the liver, but no lobular hepatitis (57). In one study, goose and duck
embryos exhibited mononuclear and heterophillic cell in�ltrations perivascularly without severe in�ammation
(65). GHBV-infected goose embryos predominantly exhibited hepatic bile ductular cell proliferation and varying
degrees of hepatocellular vacuolization. Adult ducks experimentally infected with DHBV clear the infection
without pathological changes in most cases. However, in one study, one out of �ve adult ducks developed
severe chronic hepatitis and a prolonged infection (57). DHBV results in little clinical disease or lesions for
congenitally infected or acute experimentally infected birds (65), unlike its mammalian counterparts.
Hepatocellular carcinoma as an outcome has not been established with congenital or experimental DHBV
infections in ducks, likely due to the short lifespan and period of 25-30 years required for adequate chronic
in�ammation, cell regeneration, cirrhosis, and �nally HCC in humans (60). In ducks infected with DHBV, anti-
DHBV surface antibodies are detectable by 17 days post-inoculation (dpi). By 40 dpi, serum containing DHBV
antibodies was capable of neutralizing DHBV infections in 1-day-old ducklings (66, 67). In addition, ducks
ranging from 3-8 weeks of age were seropositive for anti-DHBV antibodies in 20-40% of cases (68). Anti-DBHV
core antibodies are present in the sera of persistently infected ducklings by 7-10 dpi; however, there is no
clearance of virus infection, and anti-DBHV surface antibodies fail to develop (57). Increasing dosages of
inoculum in 4 month-old ducks both increased the levels of detectable antibodies with a correlative level of
infection of the liver as well as shortening the time to serum antibody appearance (57). DHBV and WHV
infections lead to >95% of hepatocytes participating in viral replication, and clearance occurred coincidentally
with anti-viral surface antibody increases in the serum (57, 69). In both cases, only minimal cellular in�ltration
and liver enzyme elevations were observed. IgM antibodies predominate early in the immune response with a
switch to two distinct forms of IgY later in the response. Likewise, a cell-mediated immune response
speci�cally by cytotoxic T-cells is necessary for complete viral clearance during persistent DHBV infection (60).
In studies completed in transgenic mice, HBV-speci�c CTLs lead to apoptosis of hepatocytes leading to
clearance of cells expressing HBV antigens (70). Non-cytolytic mechanisms of viral clearance likely play a role
with HBV infections as well. In HBV transgenic mice, IFN-γ and TNF- α secretions were capable of suppressing
HBV surface antigens in hepatocytes (71). Previously, HBV mRNA expression was hampered by IFN-γ and TNF-
α in transgenic mice (70, 71). Cross-species infection: Hepadnaviruses are generally considered as host
speci�c; however, it is well established that recombination occurs between genotypes of human HBV (72) as
well as between human and ape and different non-human primate variants (73). Much like mammalian
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 89/156
hepadnaviruses, the avihepadnaviruses also infect a narrow host range. DHBV is not able to infect the
Muscovy duck or chickens and remains limited in susceptibility to only a few species of ducks or geese (47).
CHBV (crane) is capable of infecting primary duck hepatocytes (45), although the full clinical spectrum of
infection in ducks in vivo and the ability to establish chronicity are uncertain (63). HHBV (grey heron) only
ine�ciently infects primary duck hepatocytes (PDHs) in vitro and does not infect ducks in vivo (44). Alterations
in the
HHBV- speci�c preS domain of the large envelope protein (L protein) with the appropriate
sequence from DHBV
allows for e�cient infection of PDHs by HHBV due to conservation of the biological function of this region (63,
74). The same was shown to be true for woolly monkey hepatitis B virus for use in infecting human
hepatocytes (63, 75). Evidence is lacking for zoonotic transmission of avihepadnaviruses to humans.
Experimental animal models for human HBV: DHBV as a model system for the study of human HBV is well
established and particularly advantageous due to the ability to reproduce infection in ducks and the use of
PDHs for both in vitro and in vivo molecular studies. HBV and DHBV share many characteristics including
being partially double-stranded DNA viruses that use an RNA intermediate with reverse transcription as a
replication strategy (76, 77), overlapping open reading frames (ORFs) in viral DNA genomes (63), infections
primarily occurring in hepatocytes, and extensive similarities in genomic organization, biological
characteristics, and virus replication life cycles. The clinical syndrome between ducks and humans infected
with HBV varies considerably however, with ducks exhibiting no clinical signs and remaining healthy despite
establishing a chronic persistent virus infection and transmission to subsequent progeny, while in humans liver
injury and either hepatocellular carcinoma or cirrhosis of the liver ensues due to chronic HBV infection (63).
Adult birds infected with DHBV also clear the virus with no outward signs of infection or long-lasting effects,
while humans develop acute or fulminant hepatitis without elimination. Due to the ability to transfect
cloned DHBV into a chicken hepatoma cell line (LMH) (78), mutations
to the genome regarding replication strategies, host tropism, treatments, and vaccination strategies can now
be studied (63) using the duck model for human HBV infections. Unanswered questions and future
prospective: Despite providing a valuable model for the study of human HBV infection, DBHV infections in
ducks are unable to reproduce all aspects of infection and pathogenesis including the typical clinical
syndrome, immunopathology, and progression to chronic infection and hepatocellular carcinoma. The
mechanisms underlying chronic infections are poorly understood and necessary in order to devise future
antiviral therapies to ameliorate infections. In addition, the natural course of virus infection characterized by
cyclical clearance and reinfection paired with individualistic immune responses to infection complicates our
understanding of the pathogenesis and leads to vast differences in therapeutic responses. The effect of a co-
infection between DHBV and other pathogens is not understood and long-term treatment strategies cannot be
replicated in the duck model for use in human HBV patients. Thus far, very little research has focused on HBV
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 90/156
within each avian species nor the interaction and opportunity for cross-species infection. The variable clinical
pathology and disease syndrome of HBV in domestic and wild birds warrants further investigation. Lastly, the
potential for cross- species infection by hepadnaviruses between humans and mammalian and avian species
highlights the need for additional research and surveillance in this poorly understood arena.
Duck Hepatitis A Virus (DHAV-1, DHAV-2, and DHAV-3) DHAV classi�cation and
characteristics: DHAV is
a member of the Picornaviridae family in a new genus Avihepatovirus
as classi�ed by ICTV and is referred to as “duck virus hepatitis A” informally. This new genus contains all three
serotypes of
duck hepatitis A virus, namely DHAV-1, DHAV-2 from Taiwan, and DHAV-3 from South Korea and
China (79-82). Recently, novel picornaviruses have also been identi�ed in turkeys (avisivirus A, AsV-A) (83) and
ducks (84) that are genetically and antigenically related to DHAV. DHAV is a typical picornavirus as a single-
stranded, non-enveloped, positive-sense, and polyadenylated RNA virus with a genome consisting of one single
ORF encoding a polyprotein �anked by 5’ and 3’ untranslated regions (UTRs). Clinical signs and pathobiology:
DHAV-1 is a highly contagious virus in ducks associated with diseases in mallard, Pekin, and Muscovy species
(85). In natural infection, young ducklings of 6 weeks of age and younger present with lethargy, ataxia,
opisthotonos, and a very rapid death, often taking as little as 1-2 hours (86). Due to the high morbidity within a
�ock of up to 100%, the vast majority of ducklings will be affected with �ock mortality of 95-100% occurring
within 3-4 days but older birds are not affected (87). At necropsy, the liver is typically enlarged with petechial
and ecchymotic hemorrhages throughout (Fig. 2). Microscopic lesions in the liver include extensive hepatocyte
necrosis (Fig. 3), bile duct hyperplasia, hemorrhages, and in�ammatory cell in�ltrations dispersed throughout
(88). The spleen and kidneys often swell with congestion of the blood vessels often apparent. The clinical and
pathological lesions are characteristic for DHAV-1 infections and with little information on
DHAV-2 and DHAV-3 infections, the clinical presentation for DHAV-
2 and -3 is assumed similar (86). One study showed that DHAV-3 induced apoptosis and necrosis of multiple
organs including the liver, but the mechanism is not understood (88). While no public health signi�cance is
noted due to DHAV infections, economically, the highly lethal and rapidly spreading infection may affect
intensive duck production farming regions of the world (85). DHAV is controlled by vaccination of breeder
ducks with a live-attenuated virus in order to transfer maternal immunity to the hatched ducklings (86) with
protection waning over the �rst 2 weeks of life, but re-immunization with a live-attenuated vaccine at 7-10 days
of age allows for protection through the susceptible period (89). Hatchling ducks may also be immunized with
a live-attenuated vaccine that confers immunity within 48-72 hours lasting through the susceptible period (90)
or passive introduction of antibodies for short-lived immunity (86). DHAV diagnosis: Con�rmation of DHAV
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 91/156
infection is completed by recovery of virus from the liver of affected ducklings and inoculation of 1-7 day-old
naïve ducklings, 10-14 day-old embryonated duck eggs, or primary cultures of duck embryo liver cells (DEL)
(86). Ducklings follow a characteristic course of infection with death within 18-48 hours, duck embryos die
within 24-72 hours, and DEL cells develop a cytopathic effect characterized by rounding and necrosis of the
infected cells (86). Necropsy lesions in embryos follow the natural infection characteristics with stunting and
hemorrhaging of the entire body, subcutaneous edema of the abdomen and hind limbs, and focal necrosis of
the liver parenchyma. Neutralization assays (91-93) have been described for diagnosing DHAV-1 infections;
however they are not typically used as con�rmation, and diversity between DHAV isolates limits reactivity with
hyperimmune sera (93). Nucleic acid recognition techniques including reverse transcriptase PCR (80, 82, 94-
96)
and real time RT-PCR (97) have been described for the identi�cation of
the 3D gene of DHAV-1 and to identify genotypic variation among isolates. Unanswered questions and future
prospective: Despite the lack of public health signi�cance of DHAV-1, -2, and -3 infections, the economic
impact on duck production warrants further investigation into the mechanisms of pathogenesis and
immunopathology implicated in the infectious disease process. Speci�cally, the age-dependent differences in
clinical outcome and mortality between ducklings and adult ducks is of importance for management and
control of outbreaks within the �ock. Future research into the differences between genotypes of DHV type 1
and their interaction with one another within the host species will greatly enhance the ability to properly
diagnose and prevent outbreaks leading to less mortality within the �ock. The extent of infection and genetic
variation worldwide is currently unknown, in part due to the lack of a DHAV- speci�c assay outside of research
settings, which limits our full understanding of the economic impact as well as the impact of co-infections on
the production industry. Duck Hepatitis Virus (DHV II & III) DHV type 2 (DAstV-1, DAstV-2) classi�cation and
characteristics: DHV type II is an Astrovirus as classi�ed by ICTV and is referred to as duck Astrovirus type 1
(DAstV-1) (98). The electron microscopy morphology of DAstV-1 resembles that of a typical Astrovirus with 28-
30 nm in diameter (99).
Astroviruses are single-stranded, positive-sense, non-enveloped, RNA viruses with
three ORFs (1a, 1b, 2) and are capable of infecting numerous mammalian and avian hosts (100). DAstV-1 has
been identi�ed from ducks in the United Kingdom (101, 102) and recently in eastern China (103). DHV type III
(DAstV-2) is considered as genetically distinct (98, 104), while still a member of Astroviridae family. DAstV-2
has only been reported from ducks in the United States (105). Recently, DAstV-3 (106) and DAstV-4 (107), two
distinct astroviruses have been identi�ed in Pekin ducks, Shaoxing ducks and Landes geese and Pekin ducks
respectively. In another study reporting a novel isolate of DAstV in China, a phylogenetic analysis revealed a
stronger relationship with
turkey astrovirus (TAstV) type 2, TAstV-3 and TAstV/MN/01),
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 92/156
thus indicating the potential for cross species infection between astrovirus strains (108). More work is
warranted to fully understand these new isolates of astroviruses and their potential for cross species
transmission. Clinical signs and pathobiology: DAstV-1 causes an acute, fatal infection in ducklings typically
between the ages of 10 days to 6 weeks of age (99). Similarly, DAstV-2 causes an acute infection with losses
up to 20% of those immune to DHV type 1 (86, 105). The natural clinical infection is similar to DHAV in that
lethargy, ataxia, opisthotonos are commonly seen with a rapid decline to death within 1-2 hours (86, 101). Sick
ducklings may present with polydipsia prior to death as the only differentiating sign. At necropsy, ducks
present with splenomegaly, swollen pale kidneys with congested vessels, empty, mucous �lled alimentary
tracts with areas of hemorrhage, petechial hemorrhages in the heart, and petechial to diffusely con�uent
hemorrhages throughout the liver (99, 109). Microscopic changes are similar to those of DHAV with extensive
hepatocyte necrosis, bile duct hyperplasia, hemorrhages, and in�ammatory cell in�ltrations dispersed
throughout, but with a relative increase in bile duct hyperplasia noted (109). Under experimental �eld
conditions (110, 111), DAstV-1 may be protected with a live-attenuated vaccine; however, DAstV-2 infections
are routinely prevented with immunity transferred to hatching ducklings using a live-attenuated vaccine (86).
DAstV-1 and -2 diagnosis: Diagnosis of DAstV-1 infection is achieved by recovery of the virus from the livers of
affected ducklings and inoculation into susceptible ducklings or embryonated chicken or duck eggs resulting
in only a 20% mortality of ducks (101) and stunting of embryos with green necrotic livers after 6-10 days of
infection (109), which is in stark contrast with DHAV infections in which the mortality rate is much higher and
the progression of disease much faster. Neutralization assays for the identi�cation of virus as well as cross
protection tests (101) in ducklings in order to distinguish between DAstV types 1 and 2 have been described,
but neither are used routinely. Serological responses to infection are poor in ducklings and duck embryos, thus
rendering an immunological test not applicable. RT-PCR has been described for con�rmation that DAstV-1 is
indeed an astrovirus (104, 112); however, further analyses have not been completed. Diagnosis of DAstV-2
infections are achieved by the inoculation into susceptible ducklings or the
chorioallantoic membrane of 10-day-old embryonated duck eggs
resulting in a 20% mortality following 60% morbidity in ducklings and embryonic mortality in 7-10 days (86).
Much like DAstV-1 infections, embryos exhibit stunting, edema, and skin hemorrhages, but infection may also
result in enlargement of the kidneys, liver, and spleen (86). In cell culture, DAstV-1 is reportedly capable of
infecting primary chicken embryo liver cell lines with plaques formed at 5 dpi (113), while DAstV-2 is capable of
detection by immuno�ouorescence in infected DEL and duck embryo kidney (DEK) cultures (105). RT-PCR has
also been used to con�rm the identi�cation of DAstV-2 as a distinct astrovirus from DAstV-1 (104, 112).
Unanswered questions and future prospective: The mechanisms leading to pathogenesis and clinical disease
in ducks infected with DAstV-1 and -2 are poorly understood; therefore, hindering differentiation with other viral
hepatic diseases and limiting the ability to establish an e�cient diagnostic aid or practical vaccine. Recent
research on astroviruses in poultry primarily focuses on the identi�cation and phylogenetic analyses for the
purposes of understanding the ecology and evolution. Therefore, additional work is necessary to understand
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 93/156
the implications for disease development and pathogenesis. Given the recently reported variability of
astroviruses in poultry and the potential for cross-species infection and evolution, future research must aim to
focus on the signi�cance of each individual virus as well as co-infection potential in these commercial poultry
species. Fowl Adenoviruses (FAdV) Classi�cation: Inclusion Body Hepatitis (IBH) is caused by fowl
adenoviruses (FAdV) of the genus Aviadenovirus (Group I avian adenoviruses) (114).
Group II avian adenoviruses are the hemorrhagic enteritis (HE) virus of turkeys and marble
spleen disease (MSD) virus of pheasants,
both of which belong to the genus Siadenovirus. Duck adenovirus A causing egg drop syndrome (EDS) in laying
hens is a member of the genus Atadenovirus and designated as Group III avian adenovirus. Within the genus
Aviadenovirus, six species (FAdV A – E and goose adenovirus) and three tentative species (duck adenovirus B,
pigeon adenovirus and turkey adenovirus B) are recognized (114). Twelve serotypes can be distinguished
within FAdV A-E (115, 116). FAdVs causing IBH have predominantly been typed as fowl adenovirus D or E (115,
117). Transmission and prevalence: All FAdVs including those responsible for IBH are assumed to transmit
similarly. Horizontal transmission occurs mainly by the fecal-oral route (118). The virus is shed in the feces for
up to six weeks (119). Adenoviruses are very resistant in the environment, and therefore fomites contaminated
with feces are important in spreading virus. Airborne transmission is probable, since the virus can be re-
isolated from the trachea and experimental intratracheal infection or infection by eye drop was successful
(119). Vertical transmission is an important route of infection. Infected breeder hens shed virus in their eggs,
thus infecting their progeny, as early as one week after experimental infection for at least �ve weeks (120).
Several serotypes can be detected sequentially during the live time of a �ock or at the same time without
necessarily be correlated to disease (121, 122). In Canada, approximately 77% of 231 randomly selected broiler
�ocks had been exposed to FAdV, with approximately 39% positive for FAdV D or E viral DNA (123). Outbreaks
of IBH are often epidemic, such as those in the early 1970s in England (124) and Canada (125), and more
recently in Korea and Japan (126, 127). Clinical signs and pathobiology:
The clinical course of IBH varies depending on the virulence of the virus, the age
of the infected chickens and the presence of other pathogens, especially the immunosuppressive Chicken
Infectious Anemia Virus (CIAV) and Infectious Bursal Disease Virus (IBDV). IBH has been observed in vertically
infected chickens as young as �ve days with mortality up to 5% and was experimentally reproduced in one day
old SPF chickens who subsequently developed signs of the disease three days later (128). On the other hand,
FAdV was repeatedly isolated from layers and broiler breeders of up to 45 weeks of age having IBH (129).
Generally, older chickens seem to be less susceptible than younger ones. Mortalities after experimental
infection of 2 days old chickens were between 50% and 83%, depending on the infective dose and route of
infection, but only between 0% and 43% in 2 weeks old chickens (130). Co-infections with IBDV or CIAV
aggravate the disease, and it was even doubted that FAdV were primary pathogens for IBH during co-infection
(131). However, a high number of IBH cases was observed in New Zealand and Asia without the presence of
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 94/156
IBDV and CIAV, and there was no correlation between cases of IBH or FAdV antibodies, respectively, with
antibodies against IBDV and CIAV in Canada and Belgium (123, 132). Clinical signs of IBH are nonspeci�c;
chickens are depressed with ru�ed feathers and having watery droppings (133). After experimental oral or
ocular infection of chickens, deaths were observed between �ve and twelve days post-infection with varying
mortality (128, 134). Hepatic lesions are characterized by diffusely swollen, friable and pale liver (Fig. 4),
sometimes with necrotic or hemorrhagic foci (Fig. 5) (127, 128, 135). Jaundice, especially in recovering birds,
has also been described. Histological lesions are characterized by multifocal necrosis of hepatocytes and
acute hepatitis. The namesake intranuclear inclusion bodies are located in the nuclei of the hepatocytes (Fi. 6)
(134, 136, 137). Lesions in other organs have rarely been described. The mechanism of pathogenesis of IBH is
largely unknown. Cross species infection: Hepatitis with inclusion bodies caused by adenoviruses has been
described in pigeons, parrots, cockatiels, falcons as well as turkeys (138-141). However, in most cases with a
few exceptions, it is unclear if these viruses were FAdV or other adenoviruses. An adenovirus isolated from
various psittacine species all exhibiting hepatitis with inclusion bodies was shown to be similar to FAdV D
(138). Diagnosis: Diagnosis in acute cases is primarily based on pathological lesions with laboratory
con�rmation by detection of FAdV, which is also required for typing. Since FAdV are almost ubiquitous, mere
detection of FAdV does not prove the causal relationship with observed lesions. FAdV can be isolated in
embryonated chicken eggs as well as in cell culture (142, 143). Serological methods such as ELISAs, serum
neutralization test (SNT) and AGPT using anti-FAdV antisera can detect either all FAdV or only speci�c
serotypes, depending on the test (144, 145). Numerous PCR assays have been used to detect FAdV followed by
typing (146, 147). Liver samples generally yielded more positive results than fecal samples for the PCR assays.
Prevention and control: Autogenous vaccines against IBH-causing FAdV are used in some countries.
Furthermore, an inactivated vaccine against FAdV is commercially available in China, and a live vaccine is
available in Australia. Since IBH is of most concern in younger broilers, and maternal antibodies are capable to
protect progeny against IBH, broiler breeders are vaccinated with inactivated FAdV to induce maternal
antibodies, which are then passed on to their progeny (133). In Australia, a live FAdV E vaccine is used to
control IBH by vaccinating parent �ocks in order to protect the progeny since 1989 (148). However, in spite of
the vaccination, there are still sporadic outbreaks of IBH in Australia. Unanswered questions and future
perspectives: IBH is an old disease, but the increasing number of reported cases of IBH during the last �ve
years indicates a need for better means to control the disease. Currently there are very good tools in place to
diagnose the disease and type the causative viruses. However, there is a lack of understanding of the
pathogenesis and of virulence factors of the virus. Therefore, future research is necessary to delineate the
basis of viral pathogenesis and understand the structural and functional relationship of viral genes in order to
develop better vaccines. Turkey Hepatitis Virus (THV) Classi�cation: For a long time, a picornavirus had been
suspected as possible causative agent for Turkey Viral Hepatitis (TVH) (149-151). In 2011, a novel picornavirus
was identi�ed by pyrosequencing as the likely causative agent of TVH and tentatively named Turkey Hepatitis
Virus (THV) (152). Two strains of the novel picornavirus were identi�ed with a 96.8% amino acid and 89.9%
nucleotide sequence identities to each other. Phylogenetic analyses revealed that the novel picornavirus is
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 95/156
distinct from other known picornaviruses, including Avian Encephalomyelitis Virus (AEV) (152). Transmission:
Experimental infections using the oral, intravenous, intraperitoneal, intraocular, and intratracheal routes were
successful (149, 151-153). Since the virus is shed in the feces and very resistant to inactivation, it can be
assumed
that the fecal-oral route is the main route of transmission.
Since AEV is transmitted vertically, it is assumed that THV may also transmit vertically, although experimental
evidence of vertical transmission is still lacking thus far (154). The disease seems to be most prevalent in
winter, presumably due to the fact that cold weather favors the survival of the virus in the environment (154).
Clinical signs and pathobiology: Eleven of 17 THV cases in turkey �ocks had been diagnosed in �ocks younger
than �ve weeks, and only two in �ocks of 6-8 weeks of age (155). In a more recent study, TVH was observed in
turkey �ocks between 7 and 61 days old, with a median age of 28 days (154). Experimentally, the same virus
inoculum caused the disease in two days old turkeys but not in four weeks old turkeys, suggesting potential
age resistance against THV (150). In �eld cases, however, there was no correlation between the age of
diseased �ocks and the presence of gross lesions in the liver, and also the disease was experimentally
reproduced in turkeys as old as eleven weeks in one study (154, 155). Under experimental conditions, clinical
signs or mortality are lacking in infected birds, even though the infected birds at necropsies had pathological
lesions (149-151, 155). Under �eld conditions, mortality was reported to be 1-25% in the late 1950s and early
1960s (155), and 0.03-5% daily mortality in the 2000’s (154). Other diseases were frequently observed in
addition to TVH. Whitish or tan foci in livers of affected birds are typical TVH gross lesions (Fig, 7) at post
mortem (149, 151, 155, 156). However, analysis of 76 cases, in which TVH was diagnosed mainly based on
histopathological lesions, showed that whitish or tan foci were only present in 46% of cases. In 28% of the
cases, gross lesions were not present in the liver, while in the rest of cases, dark, congested, enlarged or
greenish livers were observed (154). Histopathological liver lesions include mostly coagulative necrosis of
hepatocytes and different stages of in�ammation characterized by an in�ux of mononuclear in�ammatory
cells primarily composed of lymphocytes, macrophages and a few plasma cells and heterophils. Sometimes in
subacute or chronic cases multifocal hepatitis without necrosis is present. Other hepatic lesions which have
been described include biliary hyperplasia and the presence of giant cells or syncytia as well as vacuolation of
hepatocytes (149, 151, 154-156). In addition to liver lesions, pale patchy areas in the pancreas (Fig. 8)
characterized by focal necrosis of acinar cells with different stages of in�ammation were also observed. .
Gross lesions in the pancreas were observed in 28% of cases and histopathological lesions in 46% of cases
(154). Virus was re-isolated from liver, bile, feces, kidney, spleen and blood of experimentally-infected birds.
THV genome was detected by PCR in liver, pancreas, intestines, feces and serum of naturally-infected birds
(152, 155). It has been speculated that, after fecal-oral transmission, THV initially replicates in the intestine,
subsequently the birds become then viremic, and the virus eventually localizes in the liver and pancreas
causing lesions in these organs (154). Diagnosis: Until recently, diagnosis was based mainly on the
identi�cation of gross and characteristic histopathological lesions. The causative agent, assumed to be THV,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 96/156
can be isolated in the yolk sac of embryonated chicken eggs causing high mortality of the embryos. The virus
does not multiply after inoculation into the allantoic sac (156). More recently, a PCR assay and
in situ hybridization have been reported for the detection of
THV (152). Transmission electron microscopy can also be used to detect the virus with a low sensitivity.
Immunhistochemistry using convalescent sera from naturally infected turkeys can detect virus antigen in livers
of diseased poults (152). Unanswered questions and future perspectives: Currently there are more questions
than answers about TVH, despite the fact that the disease was �rst described more than �ve decades ago.
While there is a strong evidence that THV is the causative agent of TVH, the Koch postulates have not been
ful�lled yet. The pathogenesis is unknown, the described syncytia in the liver require further study as there
does not seem to be a relationship between a picornavirus and syncytia yet. It remains to be explored if TVH is
in any way related to poult enteritis. Since the signs of TVH are subtle and can be easily missed, it is unknown
how prevalent TVH and THV are. Lesions in the liver are also of nonspeci�c etiology and can be easily
confused with bacterial infections, Ascarid larval migration and occasionally with histomonosis. THV-speci�c
PCR and serology would certainly aid in diagnosis. The identi�cation of two different strains in California and
of a related strain in Hungary, which was associated with enteric disease, also raises the possibility that variant
strains or genotypes may exist. Only when these questions are answered, the economic impact of TVH can
then be more accurately assessed.
References 1. Haqshenas, G., H. Shivaprasad, P. Woolcock, D. Read, and X.J. Meng Genetic
identi�cation and characterization of a novel virus related to human hepatitis E virus from chickens with
hepatitis-splenomegaly syndrome in the United States.
The Journal of general virology 82:2449-2462. 2001. 2. Payne, C.J., T.M. Ellis, S.L. Plant, A.R. Gregory, and G.E.
Wilcox Sequence data suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E
virus. Veterinary microbiology 68:119-125. 1999. 3. Meng, X.J., H. Shivaprasad, and C.J. Payne Hepatitis E
Virus infections.
In: Diseases of Poultry, 13th ed. Y.M. Saif, A.M. Fadly, J.R. Glisson, L.R. McDougald, L .K. Nolan and
D.E. Swayne, eds. Blackwell Publishing Press, Ames, Iowa. pp 443-452. 2008.
4. Tablante, N.L., J.P. Vaillancourt, and R.J. Julian Necrotic, haemorrhagic, hepatomegalic hepatitis associated
with vasculitis and amyloidosis in commercial laying hens. Avian pathology : journal of the W.V.P.A 23:725-732.
1994. 5. Ritchie, S.J., and C. Riddell British Columbia. "Hepatitis-splenomegaly"
syndrome in commercial egg laying hens. The Canadian veterinary journal.
La revue veterinaire canadienne 32:500-501. 1991. 6. Marek, A., I. Bilic, I. Proko�eva, and M. Hess Phylogenetic
analysis of avian hepatitis E virus samples from European and Australian chicken �ocks supports the
existence of a different genus within the Hepeviridae comprising at least three different genotypes. Veterinary
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 97/156
microbiology 145:54-61. 2010. 7. Huang, F., G. Haqshenas, H. Shivaprasad, D. Guenette, P. Woolcock, C. Larsen,
F. Pierson, F. Elvinger, T. Toth, and X. Meng Heterogeneity and seroprevalence of a newly identi�ed avian
hepatitis e virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 2002. 8.
Smith, D.B., P. Simmonds, G. members of the International Committee on the Taxonomy of Viruses
Hepeviridae Study, S. Jameel, S. U. Emerson, T.J. Harrison, X .J. Meng, H. Okamoto, W
.H. Van der Poel, and M.A. Purdy Consensus proposals for classi�cation of the family Hepeviridae.
The Journal of general virology 96:1191-1192. 2015. 9. Sun, Z., C. Larsen, A. Dunlop, F. Huang, F. Pierson, T.
Toth, and X.J. Meng Genetic identi�cation of avian hepatitis E virus (HEV) from healthy chicken �ocks and
characterization of the capsid gene of 14 avian HEV isolates from chickens with hepatitis-splenomegaly
syndrome in different geographical regions of the United States. The Journal of general virology 85:693-700.
2004. 10. Huang, F.F., G. Haqshenas, H.L. Shivaprasad, D.K. Guenette, P.R. Woolcock, C.T. Larsen, F.W. Pierson,
F. Elvinger, T.E. Toth, and X.J. Meng Heterogeneity and seroprevalence of a newly identi�ed avian hepatitis e
virus from chickens in the United States. Journal of clinical microbiology 40:4197-4202. 2002. 11. Agunos,
A.C., D. Yoo, S.A. Youssef, D. Ran, B. Binnington, and D.B. Hunter
Avian hepatitis E virus in an outbreak of hepatitis--splenomegaly syndrome and fatty liver haemorrhage
syndrome in two �axseed-fed layer �ocks in Ontario.
Avian pathology : journal of the W.V.P.A 35:404-412. 2006. 12. Todd, D., K.A. Mawhinney, V.A. McAlinden, and
A.J. Douglas Development of an
enzyme-linked immunosorbent assay for the serological diagnosis of
big liver and spleen disease. Avian diseases 37:811-816. 1993. 13. Bilic, I., B. Jaskulska, A. Basic, C. Morrow,
and M. Hess Sequence analysis and comparison of avian hepatitis E viruses from Australia and Europe
indicate the existence of different genotypes. The Journal of general virology 90:863-873. 2009. 14. Zhang, W.,
Q. Shen, J. Mou, G. Gong, Z. Yang, L. Cui, J. Zhu, G. Ju, and X. Hua Hepatitis E virus infection among domestic
animals in eastern China. Zoonoses and public health 55:291-298. 2008. 15. Meng, X.J., D.A. Anderson, V.A.
Arankalle, S.U. Emerson, T.J. Harrison, S. Jameel, and H. Okamoto Hepeviridae. In:
Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses.
A.
King, M.J. Adams, E.B. Carstens and E.J. Lefkowitz, eds., London, United Kingdom. pp
1021-1028. 2012. 16. Meng, X.-J. From barnyard to food table: the omnipresence of hepatitis E virus and risk
for zoonotic infection and food safety. Virus research 161:23-30. 2011. 17. Billam, P., F. Huang, Z. Sun, F.
Pierson, R. Duncan, F. Elvinger, D. Guenette, T. Toth, and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 98/156
X.J. Meng Systematic pathogenesis and replication of avian hepatitis E virus in speci�c- pathogen-free
adult chickens. Journal of virology 79:3429- 3437. 2005.
18. Handlinger, J.H., and W. Williams An egg drop associated with splenomegaly in broiler breeders. Avian
diseases 32:773-778. 1988. 19. Crerar, S.K., and G.M. Cross Epidemiological and clinical investigations into
big liver and spleen disease of broiler breeder hens. Australian veterinary journal 71:
410-413. 1994. 20.
Crerar, S.K., and G.M. Cross The experimental production of big liver and spleen disease in broiler
breeder hens. Australian veterinary journal 71:414-417.
1994. 21. Sun, Z.F., C.T. Larsen, F.F. Huang, P. Billam, F.W. Pierson, T.E. Toth, and X.J. Meng Generation and
infectivity titration of an infectious stock of avian hepatitis E virus (HEV) in chickens and cross-species
infection of turkeys with avian HEV. Journal of clinical microbiology 42:2658-2662. 2004. 22. Haqshenas, G.,
F.F. Huang, M. Fenaux, D.K. Guenette, F.W. Pierson, C.T. Larsen, H.L. Shivaprasad, T.E. Toth, and X.J. Meng The
putative capsid protein of the newly identi�ed avian hepatitis E virus shares antigenic epitopes with that of
swine and human hepatitis E viruses and chicken big liver and spleen disease virus. The Journal of general
virology 83:2201-2209. 2002. 23. Guo, H., E.M. Zhou, Z.F. Sun, and X.J. Meng
Protection of chickens against avian hepatitis E virus (avian HEV) infection by immunization with recombinant
avian HEV capsid protein. Vaccine
25:2892-2899. 2007. 24. Guo, H., E.M. Zhou, Z.F. Sun, X.J. Meng, and P.G. Halbur
Identi�cation of B-cell epitopes in the capsid protein of avian hepatitis E virus (avian HEV) that are common to
human and swine HEVs or unique to avian HEV.
The Journal of general virology 87:217-223. 2006. 25. Billam, P., F. Pierson, W. Li, T. LeRoith, R. Duncan, and X.
Meng Development and validation of a negative-strand-speci�c reverse transcription-PCR assay for detection
of a chicken strain of hepatitis E virus: identi�cation of nonliver replication sites. Journal of clinical
microbiology 46:2630-2634. 2008. 26. Williams, T.P., C. Kasorndorkbua, P.G. Halbur, G. Haqshenas, D.K.
Guenette, T.E. Toth, and X.J. Meng Evidence of extrahepatic sites of replication of the hepatitis E virus in a
swine model. Journal of clinical microbiology 39:3040-3046. 2001. 27.
Chandra, V., S. Taneja, M. Kalia, and S. Jameel Molecular biology and pathogenesis of hepatitis E
virus. Journal of biosciences 33:451-464. 2008.
28. Huang, F., Z. Sun, S. Emerson, R. Purcell, H. Shivaprasad, F. Pierson, T. Toth, and X.J. Meng
Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and
attempts to infect rhesus monkeys with avian HEV.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 99/156
The Journal of general virology 85:1609-1618. 2004. 29. Huang, F.F., F.W. Pierson, T.E. Toth, and X.J. Meng
Construction and characterization of infectious cDNA clones of a chicken strain of hepatitis E virus (HEV),
avian HEV. The Journal of general virology 86:2585-2593. 2005. 30. Payne,
C.J., S .L. Plant, T.M. Ellis, P.W. Hillier, and W. Hopkinson
The detection of the big liver and spleen agent in infected tissues via intravenous chick embryo inoculation.
Avian pathology : journal of the W.V.P.A 22:245-256. 1993. 31. Guo, H., E.M. Zhou, Z.F. Sun, and X.J. Meng
Immunodominant epitopes mapped by synthetic peptides on the capsid protein of avian hepatitis E virus are
non-protective. Viral Immunol 21:61-67. 2008.
32.
Dane, D.S., C.H. Cameron, and M. Briggs Virus-like particles in serum of patients with Australia-
antigen-associated hepatitis. Lancet 1:695-698. 1970. 33. Kock, J.,
M. Nassal, S. MacNelly, T.F. Baumert,
H.E. Blum, and F. von Weizsacker E�cient infection of primary tupaia hepatocytes with puri�ed human
and woolly monkey hepatitis B virus. Journal of virology 75:5084-
5089. 2001. 34. Will, H., R. Cattaneo, H.G. Koch, G. Darai, H. Schaller, H. Schellekens, P.M. van Eerd, and F.
Deinhardt
Cloned HBV DNA causes hepatitis in chimpanzees. Nature 299:740-
742. 1982. 35. Schultz, U.,
E. Grgacic, and M. Nassal Duck hepatitis B virus: an invaluable model system for HBV infection.
Advances in virus research 63:1-70.
2004. 36.
Lanford, R.E., D. Chavez, K.M. Brasky, R.B. Burns, 3rd, and R. Rico-Hesse Isolation of a hepadnavirus from
the woolly monkey, a New World primate.
Proceedings of the National Academy of Sciences of the United States of America 95:5757-
5761. 1998. 37. Summers, J., J.M. Smolec, and R. Snyder
A virus similar to human hepatitis B virus associated with hepatitis and hepatoma in woodchucks.
Proceedings of the National Academy of Sciences of the United States of America 75:4533-
4537. 1978. 38.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 100/156
Testut, P., C.A. Renard, O. Terradillos, L. Vitvitski-Trepo, F. Tekaia, C. Degott, J. Blake, B. Boyer, and M.A.
Buendia A new hepadnavirus endemic in arctic ground squirrels in Alaska. Journal of virology 70:
4210-4219. 1996. 39.
Marion, P.L., L.S. Oshiro, D.C. Regnery, G.H. Scullard, and W.S. Robinson A virus in Beechey ground squirrels
that is related to hepatitis B virus of
humans. Proceedings of the National Academy of Sciences of the United States of America 77:2941-
2945. 1980. 40.
Mason, W.S., M.S. Halpern, J.M. England, G. Seal, J. Egan, L. Coates, C. Aldrich, and J. Summers Experimental
transmission of duck hepatitis B virus. Virology 131:375-384.
1983. 41.
Mason, W.S., G. Seal, and J. Summers Virus of Pekin ducks with structural and biological relatedness to human
hepatitis B virus. Journal of virology 36:829-836.
1980. 42.
Chang, S.F., H.J. Netter, M. Bruns, R. Schneider, K. Frolich, and H. Will A new avian hepadnavirus infecting snow
geese (Anser caerulescens) produces a signi�cant fraction of virions containing single-stranded DNA. Virology
262:39-54.
1999. 43.
Pult, I., H.J. Netter, M. Bruns, A. Prassolov, H. Sirma, H. Hohenberg, S.F. Chang, K. Frolich, O. Krone, E.F. Kaleta,
and H. Will Identi�cation and analysis of a new hepadnavirus in white storks. Virology 289:114-128.
2001. 44.
Sprengel, R., E.F. Kaleta, and H. Will Isolation and characterization of a hepatitis B virus endemic in
herons. Journal of virology 62:3832-3839. 1988.
45. Prassolov,
A., H. Hohenberg, T. Kalinina, C. Schneider, L. Cova, O. Krone, K. Frolich, H. Will, and H. Sirma New hepatitis B
virus of cranes that has an unexpected broad host range. Journal of virology 77:1964-1976.
2003. 46.
Piasecki, T., B. Kurenbach, K. Chrzastek, K. Bednarek, S. Kraberger, D.P. Martin, and A.
Varsani Molecular characterisation of an avihepadnavirus isolated from Psittacula krameri (ring-necked parrot).
Archives of virology 157:585-590.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 101/156
2012. 47.
Pugh, J.C., and H. Simmons Duck hepatitis B virus infection of Muscovy duck hepatocytes and nature of virus
resistance in vivo. Journal of virology 68:2487-2494. 1994.
48.
Cova, L., R. Mehrotra, C.P. Wild, S. Chutimataewin, S.F. Cao, A. Du�ot, M. Prave, S.Z. Yu, R. Montesano, and C.
Trepo Duck hepatitis B virus infection, a�atoxin B1 and liver cancer in domestic Chinese ducks. British journal
of cancer 69:104-109.
1994. 49.
Lenhoff, R.J., C.A. Luscombe, and J. Summers Competition in vivo between a cytopathic variant and a
wild-type duck hepatitis B virus. Virology 251:85-95.
1998. 50. Locarnini, S.,
M. Littlejohn, M.N. Aziz, and L. Yuen Possible origins and evolution of the hepatitis B virus (HBV). Seminars in
cancer biology
23:561-575. 2013. 51. Njouom, R., S.A. Mba, E. Nerrienet, Y. Foupouapouognigni, and D. Rousset
Detection and characterization of hepatitis B virus strains from wild-caught gorillas and chimpanzees in
Cameroon, Central Africa. Infection,
genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases
10:790-796. 2010. 52.
Warren, K.S., J.L. Heeney, R.A. Swan, Heriyanto, and E.J. Verschoor A new group of
hepadnaviruses naturally infecting orangutans (Pongo pygmaeus). Journal of virology 73:7860- 7865.
1999. 53.
Lanford, R.E., D. Chavez, R. Rico-Hesse, and A. Mootnick Hepadnavirus infection in captive
gibbons. Journal of virology 74:2955-2959.
2000. 54. He, B., Q. Fan, F. Yang, T. Hu, W. Qiu, Y. Feng, Z. Li, Y. Li, F. Zhang, H. Guo, X. Zou, and C. Tu Hepatitis
virus in long-�ngered bats, Myanmar. Emerging infectious diseases 19:638- 640. 2013. 55. Norder, H., A.M.
Courouce, and L.O. Magnius
Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four
of which represent two new genotypes. Virology
198:489-503. 1994. 56.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 102/156
Starkman, S.E., D.M. MacDonald, J.C. Lewis, E.C. Holmes, and P. Simmonds Geographic and species
association of hepatitis B virus genotypes in non-human primates. Virology 314:381-
393. 2003. 57.
Jilbert, A.R., J.A. Botten, D.S. Miller, E.M. Bertram, P. M. Hall, J. Kotlarski, and C.J. Burrell
Characterization of age- and dose-related outcomes of duck hepatitis B virus infection. Virology 244 :273-
282.
1998. 58. Urban, M.K., A.P. O'Connell, and W.T. London
Sequence of events in natural infection of Pekin duck embryos with duck hepatitis B virus. Journal of virology
55:16-22.
1985. 59.
Jilbert, A.R., T.T. Wu, J.M. England, P.M. Hall, N.Z. Carp, A.P. O'Connell, and W.S. Mason Rapid resolution of
duck hepatitis B virus infections occurs after massive hepatocellular involvement. Journal of virology
66:1377-1388.
1992. 60. Jilbert, A.R., and I. Kotlarski Immune responses to duck hepatitis B virus infection. Developmental
and comparative immunology 24:285-302. 2000. 61. Lenhoff, R.J., C.A. Luscombe, and J. Summers Acute liver
injury following infection with a cytopathic strain of duck hepatitis B virus. Hepatology 29:563-571. 1999. 62.
Jilbert, A.R., D.S. Miller, C.A. Scougall, H. Turnbull, and C.J. Burrell Kinetics of duck hepatitis B virus infection
following low dose virus inoculation: one virus DNA genome is infectious in neonatal ducks. Virology 226:338-
345.
1996. 63.
Funk, A., M. Mhamdi, H. Will, and H. Sirma Avian hepatitis B viruses: molecular and cellular
biology, phylogenesis, and host tropism. World
journal of gastroenterology : WJG 13:91-103. 2007. 64.
Zinkernagel, R.M. Immunology taught by viruses. Science 271:173-178. 1996. 65. Bidin, M.,
M. Tisljar, Z. Bidin, I. Lojkic, and D. Majnaric Genetic characterization of hepadnaviruses associated with
histopathological changes in the liver of duck and goose embryos. Veterinary microbiology 174:302-308. 2014.
66. Halpern, M.S., W.S. Mason, L. Coates, A.P. O'Connell, and J.M. England
Humoral immune responsiveness in duck hepatitis B virus-infected ducks. Journal of virology 61:916-920.
1987. 67. Vickery, K., J.S. Freiman, R.J. Dixon, R. Kearney, S. Murray, and Y.E. Cossart Immunity in Pekin ducks
experimentally and naturally
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 103/156
infected with duck hepatitis B virus. Journal of medical virology
28:231-236. 1989. 68.
Qiao, M., E.J. Gowans, S .E. Bailey, A.R. Jilbert, and C.J. Burrell Serological analysis of duck
hepatitis B virus infection. Virus research 17:3-
13. 1990. 69.
Kajino, K., A.R. Jilbert, J. Saputelli, C.E. Aldrich, J. Cullen, and W.S. Mason
Woodchuck hepatitis virus infections: very rapid recovery after a prolonged viremia and infection of virtually
every hepatocyte. Journal of virology 68:5792-5803.
1994. 70. Guidotti, L.G., K. Ando, M.V. Hobbs, T. Ishikawa, L. Runkel, R.D. Schreiber, and F.V. Chisari Cytotoxic T
lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism
in transgenic mice. Proceedings of the National Academy of Sciences of the United States of America
91:3764-3768. 1994. 71. Guidotti, L.G., T. Ishikawa, M.V. Hobbs, B. Matzke, R. Schreiber, and F.V. Chisari
Intracellular inactivation of the hepatitis B virus by cytotoxic T lymphocytes. Immunity 4:25-36.
1996. 72. Shi, W., Z. Zhang, C. Ling, W. Zheng, C. Zhu, M.J. Carr, and D.G. Higgins Hepatitis B virus
subgenotyping: history, effects of recombination, misclassi�cations, and corrections.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious
diseases 16:355-361. 2013.
73. Bonvicino, C.R., M.A. Moreira, and M.A. Soares Hepatitis B virus lineages in mammalian hosts: potential for
bidirectional cross-species transmission. World journal of gastroenterology : WJG 20:7665-7674. 2014. 74.
Ishikawa, T., and D. Ganem The pre-S domain of the large viral envelope protein determines host range in avian
hepatitis B
viruses.
Proceedings of the National Academy of Sciences of the United States of America 92:
6259-6263. 1995. 75. Chouteau, P., J. Le Seyec,
I. Cannie, M. Nassal, C. Guguen-Guillouzo, and P. Gripon A short N-proximal region in the large envelope
protein harbors a determinant that contributes to the species speci�city of human hepatitis B virus. Journal
of virology 75:11565-
11572. 2001. 76.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 104/156
Summers, J., and W.S. Mason Replication of the genome of a hepatitis B--like virus by reverse transcription of
an RNA intermediate. Cell 29:403-415.
1982. 77.
Wang, G.H., and C. Seeger The reverse transcriptase of hepatitis B virus acts as a protein primer for viral DNA
synthesis. Cell 71:663-670.
1992. 78.
Condreay, L.D., C.E. Aldrich, L. Coates, W.S. Mason, and T.T. Wu E�cient duck hepatitis B virus
production by an avian liver tumor cell line. Journal of virology 64:3249-3258.
1990. 79. Fu, Y., M. Pan, X. Wang, Y. Xu, H. Yang, and D. Zhang
Molecular detection and typing of duck hepatitis A virus directly from clinical specimens. Veterinary
microbiology 131:247- 257. 2008.
80.
Kim, M.C., Y.K. Kwon, S .J. Joh, S .J. Kim, C. Tolf, J.H. Kim, H.W. Sung, A.M.
Lindberg, and J.H. Kwon Recent Korean isolates of duck hepatitis virus reveal the presence of a new geno-
and serotype when compared to duck hepatitis virus type 1 type strains. Archives of virology 152:2059-2072.
2007. 81. Tseng, C.H., N.J. Knowles, and H.J. Tsai Molecular analysis of
duck hepatitis virus type 1 indicates that it should be assigned to a new genus. Virus research 123:190-
203.
2007. 82.
Kim, M.C., Y.K. Kwon, S .J. Joh, J.H. Kwon, and A.M. Lindberg Differential diagnosis between
type-speci�c duck hepatitis virus type 1 (DHV-1) and recent Korean DHV-1-like isolates using a multiplex
polymerase chain reaction. Avian
pathology : journal of the W.V.P.A 37:171-177. 2008. 83. Boros, A., C. Nemes, P. Pankovics, B. Kapusinszky, E.
Delwart, and G. Reuter
Genetic characterization of a novel picornavirus in turkeys (Meleagris gallopavo) distinct from turkey
galliviruses and megriviruses and distantly related to the members of the genus Avihepatovirus.
The Journal of general virology 94:1496-1509. 2013. 84. Wang, X., N. Liu, F. Wang, K. Ning, Y. Li, and D. Zhang
Genetic characterization of a novel duck-origin picornavirus with six 2A proteins. The Journal of general
virology 95:1289- 1296. 2014. 85.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 105/156
Woolcock, P.R. Duck hepatitis. In: Diseases of Poultry, 11th ed. Y.M. Saif, Barnes, H.J., Glisson, J.R.,
Fadly, A.M., McDougald, L.R., & Swayne, D.E., ed. Iowa State Press, IA. pp 343- 354. 2003. 86. OIE
Duck Hepatitis Virus. In:
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2015 (Terrestrial Manual),
7th ed. 2012. 87. Okda, F.A., S. Yassein, A.R. Ahmed, H. Soufy, and S.M. Nasr
Some Haematological and Biochemical Investigations on Duck Virus Hepatitis following Administration of
Glycyrrhizin. ISRN pharmacology 2013:
849412. 2013. 88. Zhang, H., J. Pi, C. Tang, H. Yue, and F. Yang
An experimental study of the pathogenicity of a duck hepatitis A virus genotype C isolate in speci�c pathogen
free ducklings.
Avian pathology : journal of the W.V.P.A 41:613-620. 2012. 89.
Hanson, L.E., and D.N. Tripathy Oral immunization of ducklings with attenuated duck hepatitis virus.
Developments in biological standardization 33:357-363.
1976. 90.
Crighton, G.W., and P.R. Woolcock Active immunisation of ducklings against duck virus hepatitis.
The Veterinary record 102:358-361.
1978. 91.
Chalmers, W.S., and P.R. Woolcock The effect of animal sera on duck hepatitis virus. Avian
pathology : journal of the W.V.P.A 13:727-732. 1984. 92. Woolcock, P.R., W.S. Chalmers, and D. Davis
A plaque assay for duck hepatitis virus. Avian pathology
: journal of the W.V.P.A 11:607-610. 1982. 93. Wu, X., X. Li, Q. Zhang, S. Wulin, X. Bai, T. Zhang, Y. Wang, M. Liu,
and Y. Zhang Identi�cation of a conserved B-cell epitope on duck hepatitis A type 1 virus VP1 protein. PloS one
10:e0118041. 2015. 94.
Anchun, C., W. Mingshu, X. Hongyi, Z. Dekang, L. Xinran, C. Haijuen, J. Renyong, and
Y. Miao
Development and application of a reverse transcriptase polymerase chain reaction to detect Chinese isolates of
duck hepatitis virus type 1. Journal of microbiological methods 77:332-336.
2009. 95.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 106/156
Kim, M.C., Y.K. Kwon, S .J. Joh, J.H. Kwon, J.H. Kim, and S .J. Kim Development of one-
step reverse transcriptase-polymerase chain reaction to detect duck hepatitis virus type 1. Avian diseases
51:540-545.
2007. 96. Huang, Q., H. Yue, B. Zhang, P. Nie, and C. Tang
Development of a real-time quantitative PCR for detecting duck hepatitis a virus genotype C.
Journal of clinical microbiology 50:3318-3323. 2012. 97. Yang, M., A. Cheng, M. Wang, and H. Xing
Development and application of a one-step real-time Taqman RT-PCR assay for detection of Duck hepatitis
virus type1.
Journal of virological methods 153:55-60. 2008. 98.
Pantin-Jackwood, M.J., K.O. Strother, E. Mundt, L. Zsak, J.M. Day, and E. Spackman Molecular characterization
of avian astroviruses. Archives of virology 156:235-244.
2011. 99. Koci, M.D., and S. Schultz-Cherry Avian astroviruses. Avian pathology : journal of the W.V.P.A 31:213-
227. 2002. 100.
Monroe, S.S., Carter, M.J., Herrmann, J., Mitchel, D.K.,
& Svensson, L.
Astroviridae. In: Virus Taxonomy. Eighth Report of the International Committee on Taxonomy of Viruses. C.M.
Fauquet, Mayo, A., Maniloff, J., Desselberger, U., & Ball, L.A., ed. Elsevier Academic Press, California. pp
859-864.
2005. 101.
Gough, R.E., E.D. Borland, I.F. Keymer, and J.C. Stuart An outbreak of duck hepatitis type II in
commercial ducks. Avian pathology
: journal of the W.V.P.A 14:227-236. 1985. 102.
Asplin, F.D. Duck Hepatitis. The Veterinary record 77:487-
488. 1965. 103. Chen, L., Q. Xu, R. Zhang, J. Li, Z. Xie, Y. Wang, Y. Zhu, and S. Jiang
Complete genome sequence of a duck astrovirus discovered in eastern China. Journal of virology
86:13833-13834. 2012. 104.
Todd, D., V.J. Smyth, N.W. Ball, B.M. Donnelly, M. Wylie, N.J. Knowles, and B.M. Adair Identi�cation of chicken
enterovirus-like viruses, duck hepatitis virus type 2 and duck hepatitis virus type 3 as astroviruses. Avian
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 107/156
pathology
: journal of the W.V.P.A 38:21-30. 2009. 105.
Haider, S.A., and B.W. Calnek In vitro isolation, propagation, and characterization of duck hepatitis virus
type III. Avian diseases 23:715-729.
1979. 106. Liu, N., F. Wang, and D. Zhang Complete sequence of a novel duck astrovirus. Archives of virology
159:2823-2827. 2014. 107. Liao, Q., N. Liu, X. Wang, F. Wang, and D. Zhang Genetic characterization of a novel
astrovirus in Pekin ducks. Infection, genetics and evolution : journal of molecular epidemiology and
evolutionary genetics in infectious diseases 32:60-67. 2015. 108.
Fu, Y., M. Pan, X. Wang, Y. Xu, X. Xie, N.J. Knowles, H. Yang, and D. Zhang Complete sequence of a duck
astrovirus associated with fatal hepatitis in ducklings. The Journal of general virology 90:1104-1108.
2009. 109. Bidin, M., I. Lojkic, M. Tisljar, Z. Bidin, and D. Majnaric
Astroviruses associated with stunting and pre-hatching mortality in duck and goose embryos. Avian pathology
: journal of the W.V.P.A 41:91-97. 2012. 110.
Gough, R.E., and D. Spackman Studies with inactivated duck virus hepatitis vaccines in breeder ducks. Avian
pathology
: journal of the W.V.P.A 10:471-479. 1981. 111.
Asplin, F.D. Duck hepatitis: vaccination against two serological types. The Veterinary record 77:1529-1530.
1965. 112.
Cavanagh, D. Innovation and discovery: the application of nucleic acid-based technology to avian virus
detection and characterization. Avian
pathology : journal of the W.V.P.A 30:
581- 598. 2001. 113. Baxendale, W., and T. Mebatsion The isolation and characterisation of astroviruses from
chickens. Avian pathology : journal of the W.V.P.A 33:364-370. 2004. 114. Harrach B., M.B., G. W. Both, M.
Brown, A. J. Davison, M. Echavarria, M. Hess, A. Kajon, H. D. Lehmkuhl, V. Mautner, S. K. Mittal and G. Wadell.
Adenoviridae. Elsevier, London ; Waltham, MA. . 2011. 115. Marek, A., A. Gunes, E. Schulz, and M. Hess
Classi�cation of fowl adenoviruses by use of phylogenetic analysis and high-resolution melting-curve
analysis of the hexon L1 gene region. Journal of
virological methods 170:147-154. 2010. 116.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 108/156
Meulemans, G., B. Couvreur, M. Decaesstecker, M. Boschmans, and T.P. van den Berg
Phylogenetic analysis of fowl adenoviruses. Avian
pathology : journal of the W.V.P.A 33:164- 170. 2004. 117. Ojkic, D., E. Martin, J. Swinton, J.P. Vaillancourt, M.
Boulianne, and S. Gomis Genotyping of Canadian isolates of fowl adenoviruses. Avian pathology : journal of
the W.V.P.A 37:95-100. 2008. 118. Kohn, A. Gallus adeno-like virus in chickens--studies on infection, excretion,
and immunity. American journal of veterinary research 23:562-568. 1962. 119. Cook, J.K. Spread of an avian
adenovirus (CELO virus) to uninoculated fowls. Research in veterinary science 16:156-161. 1974. 120.
Toro, H., O. Gonzalez, C. Escobar, L. Cerda, M.A. Morales, and C. Gonzalez Vertical induction of the inclusion
body hepatitis/hydropericardium syndrome with fowl adenovirus and chicken anemia virus. Avian diseases
45:215-
222. 2001. 121.
Cowen, B., G.B. Mitchell, and B.W. Calnek An adenovirus survey of poultry �ocks during the growing
and laying periods. Avian diseases 22:115-121.
1978. 122. Cook, J.K. Incidence of chick embryo lethal orphan virus antibody in the fowl (Gallus domesticus) in
Britain. Research in veterinary science 11:343-348. 1970. 123. Eregae, M.E., C.E. Dewey, S.A. McEwen, R.
Ouckama, D. Ojkic, and M.T. Guerin Flock
prevalence of exposure to avian adeno-associated virus, chicken anemia virus, fowl adenovirus, and infectious
bursal disease virus among Ontario broiler chicken �ocks. Avian
diseases 58:71- 77. 2014. 124. Macpherson, I.,
J.S. McDougall, and A.P. Laursen-Jones Inclusion body hepatitis in a broiler integration. The Veterinary
record 95:286-289. 1974. 125. Pettit, J. R., and
H.C. Carlson Inclusion-body hepatitis in broiler chickens. Avian diseases 16:858-863. 1972.
126. Choi,
K.S., S .J. Kye, J.Y. Kim, W.J. Jeon, E.K. Lee, K.Y. Park, and H.W. Sung
Epidemiological investigation of outbreaks of fowl adenovirus infection in commercial chickens in Korea.
Poultry science 91:2502-2506. 2012. 127.
Nakamura, K., M. Mase, Y. Yamamoto, K. Takizawa, M. Kabeya, T. Wakuda, M.
Matsuda, T. Chikuba, Y. Yamamoto, T. Ohyama, K. Takahashi, N. Sato, N. Akiyama, H.
Honma, and K. Imai Inclusion body hepatitis caused by fowl adenovirus in broiler chickens in Japan, 2009-
2010. Avian diseases 55:719-723. 2011.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 109/156
128. Steer, P.A., J.R. Sandy, D. O'Rourke, P.C. Scott, G.F. Browning, and A.H. Noormohammadi Chronological
analysis of gross and histological lesions induced by �eld strains of fowl adenovirus serotypes 1, 8b and 11 in
one-day-old
chickens. Avian pathology : journal of the W.V.P.A
44:106-113. 2015. 129. Lim, T.H., H.J. Lee,
D.H. Lee, Y.N. Lee, J.K. Park, H.N. Youn, M.S. Kim, H. S. Youn, J. B. Lee, S.Y.
Park, I.S. Choi, and C.S. Song Identi�cation and virulence characterization of fowl adenoviruses in Korea. Avian
diseases 55:554-560. 2011. 130. Dar, A., S. Gomis, I. Shirley, G. Mutwiri, R. Brownlie, A. Potter, V. Gerdts, and
S.K. Tikoo
Pathotypic and molecular characterization of a fowl adenovirus associated with inclusion body hepatitis in
Saskatchewan chickens. Avian diseases 56:73-81. 2012.
131.
Fadly, A.M., R.W. Winter�eld, and H.J. Olander Role of the bursa of Fabricius in the pathogenicity of inclusion
body hepatitis and infectious bursal disease viruses. Avian diseases 20:467-477. 1976. 132. Gomis, S.,
A.R. Goodhope, A.
D. Ojkic, and P. Willson Inclusion body hepatitis as a primary disease in broilers in Saskatchewan, Canada.
Avian diseases 50:550-555. 2006.
133.
Alvarado, I.R., P. Villegas, J. El-Attrache, E. Jensen, G. Rosales, F. Perozo, and L.B. Purvis Genetic
characterization, pathogenicity, and protection studies with an avian adenovirus isolate associated with inclusion
body hepatitis. Avian diseases 51:27-32. 2007.
134. Zhao, J., Q. Zhong, Y. Zhao, Y.X. Hu, and G.Z. Zhang Pathogenicity and Complete Genome
Characterization of Fowl Adenoviruses Isolated from Chickens Associated with Inclusion Body
Hepatitis and Hydropericardium Syndrome in
China. PloS one 10:e0133073. 2015. 135.
Christensen, N.H., and M. Saifuddin A primary epidemic of inclusion body hepatitis in broilers. Avian
diseases 33:622-630. 1989. 136. Howell, J.,
D.W. MacDonald, and R.G. Christian Inclusion body hepatitis in chickens.
The Canadian veterinary journal. La revue veterinaire canadienne 11:99-101. 1970. 137.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 110/156
Erny, K.M., D.A. Barr, and K.J. Fahey Molecular characterization of highly virulent fowl adenoviruses associated
with outbreaks of inclusion body hepatitis. Avian
pathology : journal of the W.V.P.A 20:
597-606. 1991. 138. Capua, I., L. Liberti, R.E. Gough, C. Casaccia, and G. Asdrubali
Isolation and characterization of an adenovirus associated with inclusion body hepatitis in psittacine birds.
Avian pathology
: journal of the W.V.P.A 24:717-722. 1995. 139.
Shivaprasad, H.L., P.R. Woolcock, and M.D. McFarland Group I avian adenovirus and avian adeno-
associated virus in turkey poults with inclusion body hepatitis. Avian pathology
: journal of the W.V.P.A 30:661-666. 2001. 140. Schelling, S.H.,
D.S. Garlick, and J. Alroy Adenoviral hepatitis in a merlin (Falco columbarius). Veterinary pathology
26:529-530. 1989. 141. Takase, K., N. Yoshinaga, T. Egashira, T. Uchimura, and M. Yamamoto Avian adenovirus
isolated from pigeons affected with inclusion body hepatitis.
Nihon juigaku zasshi. The Japanese journal of veterinary science
52:207-215. 1990. 142.
McFerran, J.B., and B.M. Adair Avian adenoviruses--a review. Avian pathology : journal of the W.V.P.A 6:189-
217.
1977. 143.
Cowen, B.S. Chicken embryo propagation of type I avian adenoviruses. Avian diseases 32:347-352.
1988. 144.
McFerran, J.B., B. Adair, and T.J. Connor Adenoviral antigens (CELO, QBV, GAL). American journal of veterinary
research 36:527-529.
1975. 145.
Grimes, T.M., D.H. Culver, and D.J. King Virus-neutralizing antibody titers against 8 avian adenovirus serotypes
in breeder hens in Georgia by a microneutralization procedure. Avian diseases 21:220-229.
1977. 146.
Meulemans, G., M. Boschmans, T.P. Berg, and M. Decaesstecker Polymerase chain reaction combined with
restriction enzyme analysis for detection and differentiation of fowl adenoviruses. Avian pathology
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 111/156
: journal of the W.V.P.A 30:655-660. 2001. 147. Xie, Z., A.A. Fadl, T. Girshick, and M.I. Khan
Detection of avian adenovirus by polymerase chain reaction. Avian diseases 43:
98-105. 1999. 148. Steer, P.A., D. O'Rourke, S.A. Ghorashi, and A.H. Noormohammadi
Application of high- resolution melting curve analysis for typing of fowl adenoviruses in �eld cases of inclusion
body hepatitis. Australian veterinary journal 89:184-192. 2011.
149.
Klein, P.N., A.E. Castro, C.U. Meteyer, B. Reynolds, J.A. Swartzman-Andert, G. Cooper,
R.P. Chin, and H.L. Shivaprasad Experimental transmission of turkey viral hepatitis to day-old poults
and identi�cation of associated viral particles resembling picornaviruses. Avian diseases 35:115-125.
1991. 150.
MacDonald, J.W., C.J. Randall, M.D. Dagless, and E.W. Gray Picorna-like virus causing hepatitis
and pancreatitis in turkeys. The Veterinary record 111:323.
1982. 151. Snoeyenbos GH, B.H.,
Sevoian M An Infectious Agent Producing Hepatitis in Turkeys. Avian diseases 3:377-388.
1959. 152. Honkavuori,
K.S., H.L. Shivaprasad, T. Briese, C. Street, D.L. Hirschberg, S.K. Hutchison, and W.I. Lipkin Novel
picornavirus in Turkey poults with hepatitis, California, USA. Emerging infectious diseases 17:
480-487. 2011. 153. Tzianabos, T., and G.H. Snoeyenbos Some Physicochemical Properties of Turkey Hepatitis
Virus. Avian diseases 9:152-156. 1965. 154. Hauck, R.,
R.P. Chin, G. Senties-Cue, B. Charlton, and H.L. Shivaprasad
Retrospective study of turkey viral hepatitis in California turkey �ocks, 2000-2012. Avian diseases 58:205- 210.
2014. 155. Snoeyenbos GH, B.H. Further Studies of Virus Hepatitis of Turkeys. Avian diseases 4:477-485. 1960.
156.
Mongeau, N. Hepatic Distomatosis and Infectious Canine Hepatitis in Northern Manitoba.
The Canadian veterinary journal. La revue veterinaire canadienne 2:33-38. 1961. Acknowledgments X.J.M.’s
research on hepatitis viruses is supported by the U.S. National Institutes of Health (R01AI074667, and
R01AI050611). D.M.Y. is supported by a grant from the U.S. National Institutes of Health (T32OD010430-06).
FIGURES Figures 1 and 2: 1 2 Fig. 1. Enlarged and hemorrhagic liver in a 42-week-old broiler breeder due to
avian hepatitis E virus infection. Fig. 2. Enlarged liver with petechiae in a six-day-old duckling due to DHAV-1
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 112/156
infection. Figure 3: Fig. 3. Histopathology of the liver with severe diffuse necrosis of hepatocytes and
hemorrhage due to DHAV–1 infection. Figure 4: 4 4 Fig. 4. Diffusely enlarged and pale liver due to Fowl
Adenovirus-1 (IBH) in a broiler chicken. Figure 5: 5 Fig. 5. One diffusely enlarged and pale liver with petechiae
and another liver with pale foci of necrosis in a broiler chicken due to IBH. Figure 6: Fig. 6. Histopathology of
liver with hepatocellular necrosis, in�ammation and intranuclear inclusion bodies in a case of IBH. Figure 7: 7
Fig. 7. Enlarged liver with pale foci of necrosis in a young turkey poult suffering from Turkey Viral Hepatitis.
Figure 8: 8 Fig. 8. Pancreas with pale patches of necrosis in a turkey poult to TVH. Chapter IV:
Infection Dynamics of Hepatitis E Virus in Wild-Type and Immunoglobulin Heavy Chain Knockout JH (-/-)
Gnotobiotic Piglets
Danielle M. Yugoa, C. Lynn Heffrona, Junghyun Ryub, Kyungjun Uhb, Sakthivel Subramaniama, Shannon R.
Matzingera†, Christopher Overenda‡, Dianjun Caoa, Scott P. Kenneyd, Harini Sooryanaraina, Thomas Cecerea,
Tanya LeRoitha, Lijuan Yuana, Nathaniel Juec, Sherrie Clark- Deenerc, Kiho Leeb, and Xiang-Jin Menga
aDepartment of
Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia
Polytechnic Institute and State University, Blacksburg, VA 24061;
bDepartment of Animal and Poultry Sciences,
Virginia Polytechnic Institute and State University, Blacksburg, VA 24061;
cDepartment of Large Animal Clinical Sciences, Virginia-Maryland
College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061;
dDepartment of
Veterinary Preventive Medicine, Food Animal Health Research Program, Ohio Agricultural Research and
Development Center, The Ohio State University, Wooster, OH 44691
†Present address: Colorado Department of Public Health and Environment, Denver, CO80230 ‡Present
address: Environmental Health and Safety, University of Florida, Gainesville, FL32611 Journal of Virology. 2018;
Oct; 92(21) e01208-18. Copyright © American Society for Microbiology, J Virol. 2018 Oct; 92(21)e01208-18;
DOI: 10.1128/JVI.01208-18. ABSTRACT Hepatitis E virus (HEV), the causative agent of hepatitis E, is an
important but incompletely understood pathogen causing high mortality during pregnancy and leading to
chronic hepatitis in immunocompromised individuals. The underlying mechanisms leading to hepatic damage
remain unknown; however, the humoral immune response is implicated. In this study, immunoglobulin (Ig)
heavy chain JH (-/-) knockout gnotobiotic pigs were generated using CRISPR/Cas9 technology to deplete the
B-lymphocyte population resulting in an inability to generate a humoral immune response to genotype 3 HEV
infection. Compared to wild-type gnotobiotic piglets, the frequencies of B-lymphocytes in Ig heavy chain JH
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 113/156
(-/-) knockouts were signi�cantly lower, despite similar levels of other innate and adaptive T-lymphocyte cell
populations. The dynamic of acute HEV infection was subsequently determined in heavy chain JH (-/-)
knockout and wild-type gnotobiotic pigs. The data showed that wild-type piglets had higher viral RNA loads in
feces and sera when compared to the JH (-/-) knockout pigs, suggesting that the Ig heavy chain JH (-/-)
knockout in pigs actually decreased level of HEV replication. Both HEV-infected wild-type and JH (-/-) knockout
gnotobiotic piglets developed more pronounced lymphoplasmacytic hepatitis and hepatocellular necrosis
lesions than other studies with conventional pigs. The HEV-infected JH (-/-) knockout pigs also had
signi�cantly enlarged livers both grossly and as a ratio of liver/body weight when compared with PBS-
inoculated groups. This novel gnotobiotic pig model will aid in future studies into HEV pathogenicity, an aspect
which has thus far been di�cult to reproduce in the available animal model systems. Keywords: Hepatitis E
virus (HEV); gnotobiotic pig; Ig heavy chain knockout; B cell depletion IMPORTANCE According to World Health
Organization, approximately 20 million HEV infections occur annually, resulting in 3.3 million cases of hepatitis
E and > 44,000 deaths. The
lack of an e�cient animal model that can mimic the full -spectrum of
infection outcomes hinders our ability to delineate the mechanism of HEV pathogenesis. Here, we successfully
generated immunoglobulin heavy chain JH (-/-) knockout gnotobiotic pigs using CRISPR/Cas9 technology,
established a novel JH (-/-) knockout and wild-type gnotobiotic pig model for HEV, and systemically determined
the dynamic of acute HEV infection in gnotobiotic pigs. It was demonstrated that knockout of the Ig heavy
chain in pigs decreased the level of HEV replication. Infected wild-type and JH (-/-) knockout gnotobiotic
piglets developed more pronounced HEV-speci�c lesions than other studies using conventional pigs, and the
infected JH (-/-) knockout pigs had signi�cantly enlarged livers. The availability of this novel model will
facilitate future studies of HEV pathogenicity. INTRODUCTION Hepatitis E, caused by hepatitis E virus (HEV), is
typically an acute icteric disease of worldwide importance. Transmission of HEV occurs by the fecal-oral route,
which often results in large explosive waterborne outbreaks in developing countries and sporadic foodborne
cases in industrialized countries including the United States (1-4). The mortality rate for HEV infection ranges
from 0.4-2% in immunocompetent healthy individuals (5); however, infected pregnant women experience a
signi�cantly elevated level of mortality, up to 28-30% (6, 7). While hepatitis E is generally recognized as a self-
limiting acute disease, immunosuppressed individuals such as solid organ transplant recipients (8), individuals
with concurrent HIV infections (9), and patients with lymphoma or leukemia tend to progress to a state of
chronicity (10) with cirrhotic disease and elevated mortality (11). The underlying mechanisms of disease
severity and hepatic damage experienced by these populations are currently not understood, nor do we
possess an adequate animal model for addressing the current knowledge gaps. HEV is a single-stranded,
positive-sense RNA virus classi�ed in the family Hepeviridae (12), which consists of two genera:
Orthohepevirus and Piscihepevirus. Within the genus Orthohepevirus, 4 species are recognized. Species
Orthohepevirus A includes all HEV strains that are known to infect humans and numerous other mammalian
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 114/156
species. At least 8 distinct genotypes have been identi�ed thus far within species Orthohepevirus A: genotypes
1-4 are known to infect humans (1, 12, 13) with genotypes 1 and 2 affecting only humans whereas
genotypes 3 and 4 affect humans and several other animal species
such as domestic pigs (14), deer (15), and rabbits (16, 17). Genotype 5 and 6 HEVs infect wild boars (18),
genotype 7 HEV infects dromedary camels (19) and possibly humans (20), and genotype 8 HEV infects the
Bactrian camel (19). Species Orthohepevirus B consists of HEV strains that infect avian species (21-23),
Orthohepevirus C infects rodents (24, 25), and Orthohepevirus D infects bats (26). The genus Piscipehevirus
includes the sole strain of HEV infecting cutthroat trout (27). Pigs are a major animal
reservoir for HEV and a major source of zoonotic infections in humans
(4). As the natural host for genotypes 3 and 4 HEV infections in humans (13, 28), the pig model has been used
to study HEV biology and cross-species infections (13, 29). However, the typical outbred conventional pig
experimentally infected with HEV does not develop the level of pathogenicity and progression of disease seen
in immunocompromised and pregnant populations (30). Infection with HEV in conventional pigs are in general
clinically asymptomatic with only mild to moderate hepatic changes observed (31). The typical course of HEV
infection includes fecal shedding of HEV RNA in infected individuals at 1 week post-infection (wpi), which can
persist for up to 8 wpi with a peak in viral titer at approximately 4 wpi (32, 33), a viremic phase lasting 1-2
weeks, followed by clearance of the virus at 8-9 wpi with the development of IgG anti- HEV at 2-4 wpi (34).
Replication of HEV occurs primarily in the gastrointestinal tract (31, 35) with only limited level of virus
replication in hepatocytes. As a result, direct viral effects within hepatic tissue is limited. Consequently, the
humoral immune response has long been thought to exacerbate the hepatic disease process as an immune-
mediated event, leading to the development of the observed liver lesions (36). Likewise, in non-human primates
(37, 38) and chickens (39) experimentally infected with HEV, hepatic lesions and alterations in serum levels of
liver enzymes often correspond to the appearance of HEV antibodies, further suggesting that anti-HEV IgG may
play a role in the development of hepatic lesions. Here we report the successful establishment of an
immunoglobulin (Ig) heavy chain knockout JH (-/-) gnotobiotic piglet model that better mimics the course of
acute HEV infection observed in humans. The dynamic of acute HEV infection was systematically determined
in both Ig heavy chain knockout and wild-type gnotobiotic piglets experimentally-infected with a genotype 3
human HEV. The presence and magnitude of viremia and fecal viral shedding, IgG anti-HEV antibody response
to infection, immune correlates of infection, magnitude of infection and presence of viral RNA in extrahepatic
sites, and liver pathology associated with HEV infection were determined. RESULTS Successful development of
Ig heavy chain JH (-/-) knockout gnotobiotic piglets. In order to delineate the differentiating characteristics
between Ig heavy chain JH (-/-) knockout and wild-type gnotobiotic piglets, CRISPR/Cas9 technology was
utilized to alter the region designated as the Ig heavy chain leading to the generation of “JH (-/-) knockout”
piglets (Table 1). Similarly, as demonstrated in our previous studies (40-42), no wild-type allele was observed in
any of the genotyped embryos (Table 2 and Fig. 1), suggesting that the approach is effective in producing Ig
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 115/156
heavy-chain knockout pigs. Pigs carrying the Ig heavy-chain knockout phenotype were produced by transferring
CRISPR/Cas9 injected embryos into estrus matched surrogate sows. Included in this study was a total of 21
live piglets and one stillborn that were born from 6 surrogate dams (Tables 3 and 4). Genotyping results
indicated that all Ig heavy-chain knockout pigs carried the modi�ed Ig heavy chain region (Fig. 1 and Table 2).
All wild-type gnotobiotic piglets were derived by embryo transfer of in vitro fertilized embryos carrying identical
parental line as the Ig heavy-chain knockout pigs. Gnotobiotic piglets were retrieved by hysterectomy of
pregnant sows with the removal of the entire uterus under sterile conditions and revived and housed in
individual sterile isolators where all procedures occurred for the duration of the study. Sterility of the surgical
set-up, recovery chamber, and individual isolators was determined and con�rmed by swabbing of the
respective equipment and streaking on blood agar plates for any bacterial growth. The sterility of the
gnotobiotic piglets was determined through the veri�cation of a lack of bacterial growth (on both blood agar
plates and Luria broth) from fecal swab samples throughout the course of the experiment. The JH (-/-) Ig heavy
chain knockout gnotobiotic piglets were characterized and exhibited signi�cantly reduced the numbers of
CD79a+ B-lymphocytes (Fig. 2A and 2B) in the peripheral blood mononuclear cell (PBMC) populations, despite
having normal levels of CD3+CD4+ lymphocytes and no alteration in CD16+ natural killer cell populations.
Lower fecal viral RNA loads in HEV-infected JH (-/-) gnotobiotic piglets than in wild-type piglets. In general, HEV
infected conventional pigs shed virus in the feces by 1 week post- inoculation (wpi) with peak fecal viral
shedding at 4 wpi and virus clearance by 7-8 wpi (33). In the Ig JH (-/-) gnotobiotic piglets infected with US-2
HEV in this study, viral RNAs were detected in feces as early as 4 days post-inoculation (dpi) with all piglets
testing positive by 7 dpi and remained positive through necropsy at 28 dpi (Table 5). Likewise, the wild-type
gnotobiotic piglets had detectable viral RNA in the feces from 7 dpi with all piglets testing positive by 9 dpi
(Table 5) and remained so until necropsy at 28 dpi. Quanti�cation of HEV RNA loads in fecal samples (three
times per week), weekly serum samples, intestinal content, bile, and hepatic as well as extrahepatic tissues
including thymus, duodenum, jejunum, ileum, large intestine, gall bladder, spleen, liver, brain and spinal cord,
and mesenteric lymph node was determined by qRT-PCR. The infected Ig JH (-/-) gnotobiotic piglets reached
peak viral RNA loads in the feces at 16 dpi, whereas the viral RNA loads in infected wild- type gnotobiotic
piglets increased until 23 dpi (Fig. 3A and 3C). Viral RNA loads in both groups tapered but remained positive
throughout the experimental period in accordance with the typical course of HEV infection. Neither group
experienced a signi�cant decrease in viral RNA loads by the 4 wpi necropsy timepoint. The fecal viral RNA
loads were signi�cantly higher in the HEV- infected wild-type gnotobiotic pigs than the JH (-/-) knockout
gnotobiotic pigs (p<0.05) (Fig. 3A and 3C) at 23 dpi. The infected wild-type pigs also had numerically higher
amounts of fecal viral RNA loads at other time points compared to the JH (-/-) knockout pigs, although the
difference was not statistically signi�cant at other time points. Likewise, the viral RNA loads in the intestinal
content were also higher in the infected wild-type piglets than JH (-/-) knockout pigs; although, the difference
was not signi�cant (Fig. 3B). Overall, the JH (-/-) knockout pigs exhibited a reduced level of fecal HEV RNA
shedding in the �rst 4 wpi compared to wild-type pigs; however, a signi�cant difference was observed only at
23 dpi due to individual pig variations in both groups (Fig. 3A and 3C). Lower serum viral RNA loads and fewer
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 116/156
incidence of viremia in HEV-infected JH (-/-) piglets compared to wild-type piglets under gnotobiotic condition.
In the HEV-infected JH (-/-) knockout pigs, when tested by a nested RT-PCR assay, 4/6 pigs became viremic by
14 dpi and 3/6 remained positive at necropsy at 28 dpi (Table 5). However, when tested by a quantitative qRT-
PCR assay, which is less sensitive than nested RT-PCR and has a detection limit of 400 copies/µL sample, only
2 piglets in the JH (-/-) knockout pig group were positive for HEV RNA in the serum and none were positive until
3 wpi (Fig. 3D). In the infected wild-type pig group, viremia was detected as early as at 7 dpi with 4/6 pigs being
positive at 14 dpi and 3/6 pigs remaining positive at necropsy at 28 dpi (Table 5). When tested by the qRT-PCR
assay for the sera from the infected wild-type pig group, the results were similar with that obtained by the
nested RT-PCR assay: 1/6 positive at 7 dpi (Fig. 3D) and 4/6 positive at 14 dpi and remained positive by 28 dpi.
The infected wild-type pigs had numerically higher amount of viral RNA loads in the serum than the JH (-/-)
knockout pigs, although the difference was not signi�cant (Fig. 3D). Overall, the data suggests that the level of
viral RNA loads in serum is reduced in the JH (-/-) knockout pigs with fewer positive piglets when compared to
the wild-type pigs. Both the IgM and IgG anti-HEV responses in the JH knock-out and wild-type pigs were
analyzed by ELISA. Anti-HEV antibody responses are typically observed during acute HEV infections by
approximately 4-5 wpi in humans and conventional pigs (5, 32, 33). In this study, seroconversion to HEV
antibodies was not detected in gnotobiotic pigs by the necropsy time point at 28 dpi (data not shown). No
difference in the amount of viral RNAs in extrahepatic tissues between HEV-infected JH (-/-) knockout pigs and
wild-type pigs. During the acute phase of HEV infection in pigs, viral RNA is typically detectable in a variety of
hepatic and extrahepatic tissues due to the circulating virus in the blood during the viremic stage. A qRT-PCR
assay was used
to quantify the amount of HEV RNA in samples of liver and various extrahepatic tissues
including thymus, duodenum, jejunum, ileum, large intestine, gall bladder, spleen, brain and spinal cord, and
mesenteric lymph node. HEV RNA was present in all tissues for the majority of piglets in both groups except in
thymus and mesenteric lymph node. All thymus samples had very low viral RNA titers in only 2/6 JH (-/-)
knockout piglets and 0/6 wild-type pigs. Mesenteric lymph node samples were positive at low levels in 3/6 JH
(-/-) knockout piglets, but in all wild-type piglets (Data not shown). In the bile sample, the amount of HEV RNA
was signi�cantly higher (P=0.0169) in wild-type pigs than in JH (-/-) knockout pigs (Figure 3B); although, there
was no difference in viral RNA loads in other extrahepatic tissues between the JH (-/-) knockout and wild-type
groups (Data not shown). Elevation of serum level of liver enzyme g-glutamyl transferase (GGT), but not other
enzymes, in HEV-infected JH (-/-) knockout gnotobiotic pigs at 3 wpi. The serum levels of liver enzymes
including aspartate aminotransferase (AST) (Fig. 4A), total bilirubin (Fig. 4B), and alkaline phosphatase (Fig.
4C) were assessed and found to be similar among the mock-infected JH (-/-) knockout, HEV-infected JH (-/-)
knockout, mock-infected wild-type, and HEV-infected wild- type piglets. Total bilirubin appeared to be different
between HEV-infected JH (-/-) knockout pigs and mock-infected JH (-/-) knockout piglets at 2-4 wpi; however,
the differences were not statistically signi�cant (Fig. 4B). The serum level of g-glutamyl transferase (GGT) were
found to be statistically elevated at 3 wpi (Fig. 4D) in HEV-infected JH (-/-) knockout gnotobiotic pigs when
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 117/156
compared to the JH (-/-) knockout PBS group. There were abnormally elevated levels of GGT (10- 100 IU/L
considered within normal limits), AST, (10-100 IU/L), and total bilirubin (<1.0 mg/dL) in serum samples from all
groups at various timepoints. In addition, all serum samples for all piglets in all groups had elevated alkaline
phosphatase (>100 IU/L) from 0 wpi to 4 wpi (36 days of age) (Fig. 4C). Histological liver lesions characterized
by lymphoplasmacytic hepatitis and hepatocellular necrosis in both HEV-infected JH (-/-) knockout and wild-
type pigs. At necropsy at 28 dpi, the histological lesions in the liver of infected pigs were characterized as
lymphoplasmacytic hepatitis and hepatocellular necrosis (Fig. 5A). The average lesion score of
lymphoplasmacytic hepatitis in HEV-infected JH (-/-) knockout pigs was signi�cantly higher (P=0.0111) than
that in PBS- inoculated JH (-/-) knockout pigs. Similarly, the average lymphoplasmacytic hepatitis lesion score
was also higher (P <0.05) in HEV-infected wild-type pigs than in PBS inoculated wild-type pigs (Fig. 5A). The
hepatocellular necrosis lesion score in HEV-infected wild-type pigs was also signi�cantly higher (P<0.05) than
that in PBS-inoculated wild-type pigs but there was not a difference in lymphoplasmacytic hepatitis or
hepatocellular necrosis lesion score between HEV- infected wild-type pigs and HEV-infected JH (-/-) knockout
pigs (Fig. 5A). Higher liver/body weight ratio in HEV-infected JH (-/-) knockout pigs compared to PBS-
inoculated controls. The liver and body weights of each pig were measured at necropsy and the liver/body
weight ratio was calculated to determine if the livers were enlarged. The average liver/body weight ratio in HEV-
infected JH (-/-) knockout pigs was signi�cantly higher than that of the PBS-inoculated JH (-/-) knockout
(P<0.01) or wild-type pigs (p<0.05) (Fig. 5B), indicating that the presence of hepatic lesions and in�ammation
in this group led to larger livers than in the PBS-inoculated group. There was
no signi�cant difference in liver/body weight ratio between the wild-type pig infected and
mock-infected groups (Fig. 5B). IFN-g- and IL-4-speci�c CD4+ T-cell responses were not signi�cantly altered in
HEV- infected JH (-/-) knockout piglets when compared to HEV-infected wild-type pigs and mock- infected
groups at 28 dpi. PBMCs from heparinized plasma and mononuclear cells (MNCs) from spleen and mesenteric
lymph nodes were isolated and stimulated with HEV-speci�c recombinant capsid antigen followed by staining
and �ow cytometry analysis (Fig. 6). HEV-speci�c T-cell (Th1) responses were analyzed for the frequency of
IFN-g and IL-4 expression and compared between mock-infected JH (-/-) knockout, HEV-infected JH (-/-)
knockout, mock-infected wild- type, and HEV-infected wild-type groups. Despite an apparent numerically lower
level of expression of IFN-g (Fig. 6A) in the PBMC T-cell population for all groups, the observed difference was
not statistically signi�cant. Expression of IL-4 (Fig. 6B) appeared to be numerically elevated in both mock-
infected wild-type and HEV-infected groups when compared with the mock-infected and HEV-infected JH (-/-)
knockout groups, again the difference was not statistically signi�cant. In addition, total CD3+ CD4+ T-cells
(Th1) in the spleen and mesenteric lymph node were signi�cantly elevated in both the mock-infected and HEV-
infected JH (-/-) knockout groups when compared with wild-type infected groups (P<0.01) (Fig. 6C). The
difference was discernible between both JH (-/-) knockout pig groups and the wild-type infected group at
p<0.01; while, the difference between JH (-/-) infected and wild-type infected was more signi�cant at p<0.001.
IL-10- and TGF-b-producing CD4+CD25+Foxp3+ and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 118/156
CD4+CD25-Foxp3+ T- reg cell populations were not signi�cantly altered in
HEV-infected JH (-/-) knockout piglets when compared to HEV-infected wild-type pigs and mock-infected
groups at 28 dpi. To examine the in�uence of HEV infection on the functionality of Treg-cell subsets, we
determined the frequencies of IL-10 and TGF-b expression as intracellular cytokines in PBMCs from
heparinized plasma and MNCs from both splenic and mesenteric lymph node preparations. The mean
frequencies of CD4+CD25+ and CD4+CD25- Treg cell subsets (Fig. 7A and 7B) were similar among all groups
in blood, spleen, and mesenteric lymph node. Likewise, the total Foxp3+ Treg cells in blood, spleen, and
mesenteric lymph node were not signi�cantly altered between the mock- infected and HEV-infected wild-type
or JH (-/-) knockout groups of piglets (Fig. 7B).
There was no discernible difference in the frequency of TGF -b
(Fig. 7C) expression in any of the aforementioned groups. Likewise, the IL-10 expression (Fig. 7D) was not
signi�cantly altered based on pig phenotype (wild-type versus JH (-/-) knockout) or infection status (HEV
versus mock- infected). There was an overall lower level of expression of IL-10+ CD4+ CD25+ Treg cells in the
blood versus MNCs isolated from spleen or lymph nodes but this difference was consistent in all four groups
regardless of infection or pig phenotype status (Fig. 7D). DISCUSSION HEV is an important but understudied
pathogen with the potential to cause signi�cant mortality in immunocompromised populations such as organ
transplant recipients (8), those with concurrent systemic immunosuppressive diseases such as lymphoma
(10) or HIV/AIDS (43, 44), and in HEV-infected pregnant women who are burdened with a higher mortality rate
reaching up to 28-30% (5). In this study, we successfully established a novel gnotobiotic pig model for HEV
infection, and systematically determined the dynamics of acute HEV infection in wild-type and Ig heavy chain
JH (-/-) knockout gnotobiotic piglets. We also attempted to investigate the role of immunoglobulin heavy-chain
JH in HEV pathogenesis and acute virus infection. Pigs are the natural host for genotypes 3 and 4 HEVs (13,
45, 46), which cause the majority of sporadic, cluster and chronic cases of hepatitis E in humans mostly from
industrialized countries (4, 43). As an animal model, aside from non-human primates, pigs match humans (47)
more closely than any other animals in terms of physiological characteristics and immunological parameters
and responses. The gnotobiotic piglet model is extremely attractive especially for studying viral pathogenicity
and immune responses, since the animals are raised in isolated sterile conditions with no interference from
other infectious agents. In this case, infection with HEV was the only experimental manipulation in the piglets;
therefore, the obtained results are solely attributable and speci�c to HEV. In addition, it has been shown that
gnotobiotic piglets are more susceptible to virus infection (48, 49) and tend to develop more progressive
disease with discernible lesions. Lacking maternal antibodies at the time of infection may allow for the
increased pathogenesis of HEV and afford the opportunity to utilize a model that more closely matches
symptomatic human infection. This is important in the study of HEV infection because the conventional pig
model develops only mild-to-moderate hepatitis lesions and clears the infection asymptomatically (33, 50). The
application of the CRISRP/Cas9 system to produce Ig JH (-/-) knockout piglets signi�cantly impacts the
production of large animal models for biomedical research and in this case, allowed for the identi�cation and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 119/156
isolation of each arm of the immune system in response to HEV infection. The CRISPR/Cas9 system allows for
effective site-speci�c genome modi�cation or targeted modi�cations during embryogenesis; therefore,
bypassing the need for somatic cell nuclear transfer (SCNT), which is associated with developmental defects
in animal production. In a previous study, we
generated RAG2/IL2RG double knockout pigs using direct injection of CRISRP /Cas9 system
(41), thus eliminating the breeding step in generating these pigs. The e�ciency of this approach was high
enough (100%) to place these pigs into a human norovirus challenge study without genotyping. Similarly, in this
HEV infection study, all JH (-/-) knockout genetically modi�ed pigs were generated
using direct injection of CRISPR/Cas9 into developing embryos
without reversion to wild-type genotyping. In addition, none of the Ig heavy-chain knockout piglets carried a
mosaic genotype, which can be a shortcoming of the direct injection of the CRISPR/Cas9 system. These
results suggest that the CRISPR/Cas9 system is a valid approach to use for animal production without having
to establish a breeding program or herd for such use. Large animal models, namely pigs, closely recapitulate
the clinical signs of disease in human patients (51). However, use of the pig model in biomedical research is
limited due to the cost of housing, housing requirements, and relatively prolonged gestation period. Using
CRISPR/Cas9 system in large animal production may help reduce these costs through increased e�ciency as
well as opening up the opportunity to develop speci�c knock-out models in order to assess various
immunological parameters. During the acute phase of HEV infection, fecal virus shedding is typically apparent
by 1 wpi and continues for ~3-4 weeks (32, 33, 52). By this time, the development of anti-HEV IgG is able to
clear the infection, usually resulting in an asymptomatic course of infection devoid of clinical signs in both
immunocompetent humans and pigs. The viremic phase typically lasts 1-3 weeks (34) and the acute infection
is considered peak at 4 wpi. In the present study, it was important to demonstrate that this novel gnotobiotic
pig model mimics the typical course of HEV infection in humans as this is the �rst reported use of gnotobiotic
piglets for the study of HEV. To evaluate the gross and microscopic lesions in the liver attributable to HEV
infection, the infected animals had to be euthanized at 28 days post-infection at which time the pathological
liver lesions usually peak. In all HEV-inoculated gnotobiotic piglets, HEV was detectable in the feces during the
�rst wpi and remained positive with relatively high viral RNA levels until necropsy at 28 dpi (Table 5, Fig. 3A and
3C). Fecal virus shedding appeared much earlier at 2 dpi in JH (-/-) knockout gnotobiotic piglets than in wild-
type piglets (7 dpi). Interestingly, the viral RNA loads in fecal samples, intestinal content collected at necropsy,
and serum samples were generally higher with signi�cant differences observed at 23 dpi in the HEV-infected
wild-type gnotobiotic piglets when compared to the HEV-infected JH (-/-) knockout gnotobiotic piglets.
Furthermore, the incidence of viremia and viral RNA loads in sera were also higher in HEV-infected wild-type
piglets than in HEV infected JH (-/-) knockout gnotobiotic piglets. It is possible that the decreased level of HEV
replication in JH (-/-) knockout gnotobiotic piglets is attributable to the lack of Ig heavy chain in the infected
pigs. Unfortunately, due to the limited scope of the study, which is to study the infection dynamic and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 120/156
pathogenicity during acute infection, the animal experiment was terminated during the time of peak
pathological liver lesions prior to the appearance of anti-HEV antibodies in pigs, which typically occurs at 4-5
weeks post-infection. The lack of detectable anti-HEV antibodies in infected JH (-/-) knockout and wild-type
pigs at all time points validates the gnotobiotic pig model in that there are no maternal effects carried over
after birth since piglets were retrieved via hysterectomy. Speci�cally, these piglets were naïve to colostrum and
were maintained on sterile whole cow’s milk. Future studies are warranted to extend the infection period
beyond the 4-week acute infection in order to de�nitively determine the role that the Ig heavy chain plays in
susceptibility to virus infection and clearance. It is likely that the differences in virus replication level observed
during the 4 weeks post-infection between the HEV-infected JH (-/-) knockout and wild-type groups will be
greatly exacerbated with a prolonged experimental period, thus highlighting the importance of the humoral
immune response to HEV infection. HEV infection in immunocompetent humans and outbred conventional
pigs generally causes only mild-to moderate hepatic lesions without clinical disease (2). In this study, both
wild- type and JH (-/-) knockout gnotobiotic piglets experimentally infected with HEV developed more
pronounced lymphoplasmacytic hepatitis and hepatocellular necrosis lesions than other studies using
conventional pigs (Fig. 5A). All HEV-infected gnotobiotic piglets recorded a histopathologic score of 2, which
corresponds to 3-5 focal in�ltrates per 10 liver lobules or a 3 corresponding with 6-10 focal in�ltrates per 10
liver lobules (33). Pigs with an assessed score of 3 also had hepatocellular necrosis or apoptosis, which was
indicative of HEV-speci�c liver lesions. In addition, the HEV-infected JH (-/-) knockout pigs had signi�cantly
enlarged livers both grossly and as a ratio of liver/body weight (Fig. 5B) when compared with PBS-inoculated
group. Therefore, it appears that the HEV-infected gnotobiotic pigs induced more severe histological and gross
liver pathology and in�ammation than the conventional pigs. This presented as expected since gnotobiotic
pigs are more sensitive to virus infection and are considered as an excellent model for pathogenicity studies of
viral infections (48, 49). Therefore, the gnotobiotic pig model may aid in future studies of HEV pathogenesis
and disease, an aspect which has thus far been di�cult to reproduce in the available animal model systems.
Serum levels of liver enzymes during HEV infections tend to elevate at the time of peak virus infection (30, 53,
54). In this study, we showed that the serum levels of liver enzymes, with the exception of GGT (Fig. 4A-D),
were not good indicators for liver damage nor do they assess overall liver health in the HEV-infected
gnotobiotic piglets. Alkaline phosphatase was dramatically, yet inconsequentially elevated (Fig. 4C) in these
piglets and likely due to the chosen feed source as well as the young age of the gnotobiotic piglets. It is likely
that this enzyme will return to normal values after approximately 60 days of age. Furthermore, feeding sterile
boxed cow’s milk in order to retain their sterility have had an adverse effect on the alkaline phosphatase levels,
rendering it an insigni�cant biomarker in the gnotobiotic piglet model (55). Total bilirubin (Fig. 4B) and AST
(Fig. 4A) were observed to be at similar levels in both the PBS mock-infected and HEV-infected groups. All
animals presented with elevated values, albeit with no discernible trend or signi�cance. The serum level of the
liver enzyme GGT (Fig. 4D) was signi�cantly elevated in HEV-infected JH (-/-) knockout gnotobiotic pigs at 23
dpi, which may indicate liver damage in HEV-infected JH (-/-) knockout pigs, since the predominant source of
GGT is the biliary epithelium, and signi�cantly higher HEV RNA loads were observed in bile (P=0.0169) in wild-
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 121/156
type versus JH (-/-) knockout pigs. At necropsy, neither the Ig heavy chain JH (-/-) knockout or wild-type piglets
had developed the antibodies necessary for clearance of HEV infection. By infecting gnotobiotic piglets at an
early age (8 days) and completing the study by 35 days of age, the piglets are less immunocompetent than
conventional pigs, which may result in a reduced humoral immune response and play a role in the level of HEV
replication and pathogenesis. However, gnotobiotic piglets have been widely used to study other enteric
viruses such as rotavirus infection dynamics and respond with a strong antibody response following infection
by 28 dpi (56, 57). Therefore, the lack of antibodies is less likely in�uenced by the age of piglet, rather the
typical time course for HEV infection. It has long been suspected that liver damage during HEV infection is a
result of an immune-mediated (especially antibody-mediated) event and not due to the result of direct virus
replication in hepatocytes (37, 38). Studies in non-human primates (38) demonstrated a correlation between
liver lesions, elevated levels of liver enzymes, and symptomatic hepatic disease with the appearance of anti-
HEV antibodies. Therefore, a longer term gnotobiotic pig infection study is needed to determine the
signi�cance of IgG anti-HEV antibodies in control of virus infection and pathogenesis and to determine the
immune response of gnotobiotic piglets infected with HEV at an early age. Unfortunately, gnotobiotic piglets
do have a rather limited lifespan due to the diet (sterile milk) and housing (plastic sterile bubble) requirements.
The presence of liver lesions in the current study prior to an antibody response suggests that the liver damage
is not solely mediated by the humoral immune response and requires further validation. Cytokines play
important roles regulating the immune response during virus infection but are currently not well understood in
the context of HEV infection. During the acute HEV infection (up to 28 dpi) in the gnotobiotic pigs, we
systematically determined the Treg, Th1, and Th2 cytokine responses in PBMC and splenic and mesenteric
lymph node MNC populations. When gated on CD3+, CD4+ Th1 cell frequencies in �ow cytometric analyses
were signi�cantly elevated in the mock-infected and HEV-infected Ig heavy chain JH (-/-) knockout groups
when compared with wild-type piglets (Fig. 6C). However, the IFNg+ Th cells, which are the critical effector
memory T-cells (58) used in pigs to mount cell-mediated immune responses, were not signi�cantly different
between any of the groups. The frequency of expression of IFN-g+ T cells appeared to be numerically lower in
PBMCs and to a lesser degree in lymph node MNCs in both JH (-/-) knockout groups when compared to the
wild-type pig groups (Fig. 6A), but not in the MNCs populations isolated from spleen. Although the difference
was not signi�cant, it points to a trend in a somewhat dampened cell-mediated immune response in JH (-/-)
knockout pigs when compared to the wild- type piglet. In addition to the Th responses, Treg cells are also
important in maintaining the balance between clearing virus infection and minimizing immune-mediated
pathology during infection (59, 60). In this study, there was no difference in Treg cell populations (CD25+ or
CD25-) between mock-infected and HEV-infected groups (Fig. 7A and 7B), regardless of the phenotypes of the
pigs. Similarly, the Treg speci�c cytokines TGF-b and IL-10, typically expressed as a functional determination of
the Treg cell population (Fig. 7C and 7D), were not signi�cantly different among any of the groups. Therefore,
while Treg cells may play a role in viral clearance or mitigation of immune-mediated pathology, this was not
evident during the �rst 28 dpi of HEV infection in gnotobiotic pigs. Overall, the results from this study showed a
weak cell-mediated immune response in both the JH (-/-) knockout and wild-type pigs at the presumptive peak
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 122/156
virus infection at 28 dpi. Since this was the �rst attempt at HEV infection of gnotobiotic piglets with a limited
study scope focusing on acute virus infection, the full course of infection from virus inoculation to clearance
has not been evaluated. We demonstrated that Ig JH (-/-) knockout phenotype pigs exhibit a reduction in the
mean frequencies of B lymphocytes while maintaining other cell populations including T-cells and NK cells.
However, this study did not reach a time point when the wild-type pigs produced HEV-speci�c antibodies, which
is a limitation. Therefore, a prolonged follow-up study is needed to fully discern the differences in immune
responses between these JH (-/-) knockout and wild-type animals. Nevertheless, a discernible difference was
observed with respect to liver lesions in HEV-infected gnotobiotic groups, a difference in the liver size both
grossly and as a ratio of liver/body weight in the HEV-infected JH (-/-) knockout group, and a signi�cant
difference in viral RNA loads in bile at 28 dpi. The HEV infection dynamic data in gnotobiotic piglets from this
study will help design future experiments using gnotobiotic pig model. Clearly, the JH (-/-) knockout
gnotobiotic pig model for HEV requires further re�nement to determine if anti-HEV antibodies play a role in
pathogenicity and virus clearance and the presence of liver damage prior to the onset of an antibody response
requires investigation. MATERIALS AND METHODS Generation of Ig JH (-/-) knockout gnotobiotic pigs by
CRISPR/Cas9 technology. To disrupt the Ig heavy chain, a total of four target sites were designed using a web-
based program (http://www.crispr-cas.org/p/resources.html) (Fig. 1A and Table 6). To minimize potential off-
targeting events, target sequences were blasted against the whole pig genome and those carrying 17 or more
identities with other loci in the pig genome were excluded. The four sgRNAs, containing a target sequence and
tracker RNA, were synthesized by in vitro transcription via MEGAshortscript™ Kit (Ambion) using a double-
stranded DNA as a template (IDT). Cas9 mRNA was generated as described in our previous studies (40-42).
Pig oocytes were obtained either from ovaries collected at a local abattoir or purchased commercially (DeSoto,
Inc). To collect oocytes from ovaries, medium-sized follicles were aspirated using an 18-gauge needle attached
to a 10 ml syringe. Cumulus cell-oocyte complexes (COC) were washed twice with pre-warmed TL-Hepes
medium and COCs with a multiple layer of cumulus cells, stimulated to mature in vitro in a TCM-199 based
maturation media containing 0.5 IU/ml FSH, 0.5 IU/ml LH, 0.82 mM cysteine, 3.02 mM glucose, 0.91 mM
sodium pyruvate, and 10 ng/ml EGF for 42-44 hours at 38.5 °C and 5% CO2 incubator. After maturation, COCs
were denuded by 0.1% hyaluronidase. Oocytes were then extruded and the �rst polar body was used for in vitro
fertilization (IVF). Groups of 30 oocytes were placed in 50 µl droplets of IVF medium (modi�ed Tris-buffered
medium with 113.1
mM NaCl, 3 mM KCl, 7 .5 mM CaCl2, 11 mM glucose, 20 mM
Tris, 2 mM caffeine, 5 mM sodium pyruvate, and 2 mg/ml BSA) and covered with mineral oil. Extended semen
was washed with PBS at 720 rcf, 3 min thrice. After the wash, the sperm pellet was resuspended with mTBM
media. Subsequently, 50 µl of diluted sperm (2.5 × 105 sperm/ml) was added into mTBM drops that contained
oocytes. The gametes were co- incubated for 5 hours at 38.5 °C and 5% CO2. Presumable zygotes were
washed thrice with Porcine Zygote Media 3 (PZM-3) (61) then placed in PZM-3and incubated at 38.5 °C, 5%
CO2, and 5% O2. Two hours after IVF, sgRNAs and Cas9 mRNA were introduced into presumptive zygotes to
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 123/156
disrupt Ig heavy chain via microinjection. Each zygote received 10 ng/µl of sgRNAs and 20 ng/µl of Cas9
mRNA by direct injection into the cytoplasm using a FemtoJet microinjector (Eppendorf, Hamburg, Germany).
Microinjection was conducted in manipulation medium (TCM199 with 0.6 mM NaHCO3, 2.9 mM HEPES, 30
mM NaCl, 10 ng/ml gentamicin, and 3 mg/ml BSA) and covered with mineral oil on the heated stage of a Nikon
inverted microscope (Nikon Corporation, Tokyo, Japan). Injected zygotes were washed with PZM-3, then
cultured in PZM-3 until further analyses. For embryo transfer, embryos were cultured in PZM-3 in the presence
of 10 ng/ml GM-CSF (62). To con�rm mutations of the Ig heavy chain region, PCR veri�cation was performed
using the primers listed in Table 6. Genomic DNA was extracted from an individual blastocyst by incubating
blastocysts in the embryo
lysis buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris- HCl pH 8.5, 0.5% Nonidet P40, 0.5% Tween- 20 and
200 µg/ml proteinase K)
for 30 min at 65 °C, followed by 10 min at 95 °C.
Genomic DNA was extracted from the tissue of each piglet using PureLink Genomic DNA kit (Thermo Fisher
Scienti�c) following the manufacturer’s instructions. The predicted mutation sites were ampli�ed by using
Platinum Taq DNA Polymerase (Thermo Fisher Scienti�c). PCR was conducted using the following conditions:
initial denature
at 95 °C for 2 min, denature at 95 °C for 30 sec,
annealing at 55 °C for 30 sec and extension at 72 °C for 1min for 34 cycles,
�nal extension at 72 °C for 5 min, and holding at 4 °C.
The PCR products were either directly sequenced or inserted into a cloning vector (TOPO, Invitrogen) to
con�rm the mutations introduced by CRISPR/Cas9 system. At day 5-6 post IVF, blastocysts and embryos
carrying over 16 cells were transferred into surrogate gilts. The embryos were surgically transferred into the
oviduct of the gilts. Pregnancy was determined by ultrasound examination at day 30-35 of gestation. Sows
impregnated with wild- type or knock-out embryos, respectively, underwent hysterectomy at 111-113 days of
gestation for the retrieval of gnotobiotic piglets. Piglets were further maintained in plastic sterile
microbiological isolators (“bubbles”) for the duration of the study. All animals were delivered and housed at
Virginia Polytechnic Institute and State University (Blacksburg, VA) in accordance with the approved
procedures of the Institutional Animal
Care and Use Committee (IACUC). Twenty- one gnotobiotic piglets were used, corresponding with 6 litters
(IACUC no. 13-127-CVM). Virus inoculum. A genotype 3 strain of human HEV (US-2) originally isolated from a
patient in the United States was used in this study (63). The infectious stock of the US-2 HEV was prepared as
a 10% fecal suspension in 0.01M PBS using the feces of a pig experimentally infected with the
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 124/156
US-2 strain of human HEV from a previous study (34). The
fecal suspension was further puri�ed to produce an endotoxin-free virus preparation using cellu�ne sulfate
(JNC Corporation, Tokyo, Japan) as the binding substrate for column puri�cation and elution into PBS. The
genomic equivalent (GE) titer of the �nal viral stock was determined by HEV-speci�c quantitative qRT- PCR with
a GE titer of ~4.5 x 106 per mL of fecal suspension. Experimental infection of wild-type and JH (-/-) knockout
gnotobiotic piglets with a genotype 3 strain of human HEV. The experimental design for the HEV infection of
gnotobiotic pigs is detailed in Table 1. The gnotobiotic piglets were housed in the sterile isolators for 7 days
before virus inoculation. On day 8, a total of 6 JH (-/-) knockout gnotobiotic piglets were intravenously
inoculated with approximately 9 x 106 GE titer of US-2 HEV infectious stock, and 5 other JH (-/-) knockout
piglets were similarly mock-inoculated with PBS (Table 1). As controls, a total of 5 wild-type gnotobiotic pigs
were intravenously inoculated with approximately 9 x 106 GE titer of US-2 HEV infectious stock, and another 4
wild-type gnotobiotic pigs were similarly inoculated with PBS buffer. After inoculation, the gnotobiotic piglets
were monitored daily for a total of 4 weeks post- infection (wpi). Blood
samples were collected from each pig weekly, and fecal samples were collected
three times per week. At 4 wpi, all gnotobiotic piglets were humanely euthanized and necropsied. Blood
samples were collected for serum and PBMC isolation prior to euthanasia. The total body and liver weights
were measured. During necropsy, tissue samples including spinal cord, brain, lung, liver, kidney, spleen,
duodenum, jejunum, ileum, large intestine, and mesenteric lymph node were collected from each pig. A portion
of the tissue samples
were �xed in 10% formalin to process for routine histological examination
of pathological lesions, and another portion of the tissues samples were immediately frozen on dry ice and
further stored at -80ºC for detection and quanti�cation of HEV RNA by qRT-PCR (Table 5). Additionally,
samples of bile and intestinal content were also collected and stored at -80ºC for the detection and
quanti�cation of HEV RNA by RT-PCR and qRT-PCR (Figure 3B). Furthermore, sections of spleen and
mesenteric lymph node were sterilely collected in RPMI-1640 medium and stored on wet ice for immediate
isolation of MNCs. Histological examination of liver lesions. Evaluation of gross and histological lesion were
conducted by a board-certi�ed veterinary pathologist in a blinded fashion. The formalin-�xed tissues were
trimmed, and routinely processed for histological examination. The lesion scoring criteria were previously
described as follows (33): score 0, no in�ammation; score 1, 1-2 focal lymphoplasmacytic in�ltrates per 10
hepatic lobules; score 2, 2-5 focal in�ltrates/10 hepatic lobules; score 3, 6-10 focal in�ltrates/10 lobules; score
4, >10 focal in�ltrates/10 hepatic lobules (Fig. 5A). Detection of HEV RNA by a nested RT-PCR. To detect HEV
RNA in weekly fecal samples, total RNAs were extracted with TRIzol LS Reagent (Invitrogen) from 200µL of
each 10% fecal suspension. The total RNAs were resuspended in 30µL of DNase-, RNase-, and proteinase-free
water (Eppendorf Inc.). Synthesis of cDNA and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 125/156
�rst-round PCR ampli�cation were performed using Superscript III one-step reverse transcriptase
PCR kit (Invitrogen)
with primers speci�c for the US-2 strain of HEV: forward primer US202:1198F22 (5’-
ATCGCCCTGACACTGTTCAATC-3’), reverse primer US202:2064R25 (5’- AGGAATTAATTAAGACTCCCGGGTT-3’).
The cDNA synthesis was carried out at 55°C for 30 minutes followed by PCR ampli�cation with an initial
denaturing incubation
at 94°C for 2 minutes and 40 cycles of denaturation at 94°C for 15 second, annealing at 55 °C for
30 seconds, and extension at 68°C for
1 minute, with a �nal incubation at 68 °C for 5 minutes. The second round nested RT -PCR
was completed using
Hi-�delity Taq polymerase (Invitrogen) using 5µL of �rst round PCR product as the template and the same
primers US202:1198F22 and US202:2064R25 in a reaction as described previously (25, 47, 64). The ampli�ed
PCR products were visualized by gel electrophoresis on 1% agarose in Tris-acetate-EDTA buffer (TAE, Thermo
Fisher Scienti�c). An expected PCR product band of 895 bp was extracted and puri�ed from the gel using QG
buffer (Qiagen), and sequenced to verify the authenticity of the ampli�ed product at the Genomic Sequencing
Center at the Biocomplexity Institute of Virginia Tech. Quanti�cation of HEV RNA by qRT-PCR. The amounts of
viral RNAs in weekly serum and fecal swab samples as well as in a panel of tissue samples collected at
necropsy were quanti�ed by qRT-PCR using HEV-speci�c primers and probe. Brie�y, fecal swab materials and
intestinal content were suspended in 10% sterile PBS (w/v). Serum and bile samples were diluted in 10% sterile
PBS (v/v). One gram of tissue samples (liver, spleen, jejunum, and lymph node) were homogenized in 1mL of
TRIzol LS Reagent (Invitrogen) to prepare a 10% tissue suspension. Brie�y, each one-gram sample was placed
in 1mL of TRIzol for 5 min at room temperature, homogenized using individual sterile gentleMACS dissociator
tubes (Miltenyi Biotec), and centrifuged at 4°C for 5 min. Samples were separated into 1.5 mL microcentrifuge
tubes for the addition of 200 µL chloroform per 1mL
sample. Samples were incubated at room temperature for 10 minutes, centrifuged at 12,000 rpm for 15
min at 4°C
for phase separation and supernatants added to an equivalent amount of 70% ethanol. Total RNAs were
extracted using the RNeasy micro-kit columns (Qiagen) from 10% serum, bile, fecal swab materials, intestinal
contents, and tissue suspension in 70% ethanol using a standard Qiagen protocol. The amounts of HEV RNA
were quanti�ed using the SensiFAST Probe No-ROX One-Step kit (Bioline, USA, Inc.) with the forward primer
(JVHEVF, 5’GGTGGTTTCTGGGGTGAC-3’), reverse primer (JVHEVR, 5’- AGGGGTTGGTTGGATGAA-3’), and
hybridization probe (JVHEVP, 5’- TGATTCTCAGCCCTTCGC -3’) following the
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 126/156
protocol as described previously (65). The qRT- PCR assays were performed in a CFX96 real-time (RT) PCR
machine (Bio-Rad Laboratories). The standard curve was produced with puri�ed HEV genomic RNAs, and the
thermal cycling conditions were as follows: 45°C for 10 min (reverse transcription), 95°C for 2 min (initial
denaturation), followed by 95
°C for 5 s (denaturation), and 60°C for 20 s (PCR ampli�cation) for
40 cycles. The detection limit of the qRT-PCR assay was reported earlier as 10 viral genomic copies, which
corresponds to approximately 400 copies of viral RNA per 1 mL sample or per gram tissue (65, 66). Samples
with GE titers below the detection limit were considered negative. ELISA to detect IgG anti-HEV in pigs. Weekly
serum
samples were tested for IgG anti -HEV antibodies by an enzyme-linked immunosorbent assay
(ELISA)
as described previously (14, 34, 47). Brie�y, a truncated recombinant HEV capsid protein containing the
immunodominant region of HEV ORF2 (amino acids 452-617) was used as the antigen (GenWay Biotech Inc.,
San Diego, CA), and plated at 6 µg/10mL carbonate coating buffer to each well. The serum samples were
tested at 1:100 dilution in blocking buffer. Pre-immune
and hyperimmune anti-HEV positive pig sera were included as the negative and positive controls,
respectively.
Horse-radish peroxidase (HRP)-conjugated goat anti-swine IgG (Sigma) was used as the secondary antibody at
1:2,000 in blocking buffer. The plate was developed using ABTS substrate and absorbance was measured at
405 nm on a Promega GloMax Discover plate reader. Determination of serum levels of liver enzymes in pigs. A
panel of liver enzymes including
aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), alkaline phosphatase, and total
bilirubin were
measured in weekly serum samples using established protocols and standard values from
the Veterinary Diagnostic Lab at Iowa State University College of Veterinary Medicine (Ames,
IA). Isolation of PBMCs from peripheral blood and MNCs from spleen and lymph node tissues. Blood was
collected from each pig for PBMC isolation prior to euthanasia and isolated using
density-gradient centrifugation with Ficoll-Paque PREMIUM (GE Healthcare).
Buffy coats were resuspended in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS)
and 1% penicillin/streptomycin. Viability counts of PBMCs were conducted with 1:1 Trypan blue as the stain
and a Cellometer (Nexelom). Cells were stored at a density of 1x107/mL in FBS with 5% DMSO at -80ºC
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 127/156
overnight before moving to liquid nitrogen for storage prior to staining. Samples of spleen and MLN tissues
were collected in RPMI-1640 medium supplemented with gentamicin, ampicillin, and HEPES on the day of
euthanasia and processed for the isolation of MNCs as described previously (67, 68). Brie�y, the spleen tissues
were minced and transferred through a 40 µm cell strainer and pelleted by centrifugation. A density-gradient
isolation procedure was followed using Percoll in order to collect the interface containing MNCs. The isolated
cells were resuspended in enriched RPMI-1640 medium supplemented with
8% FBS, gentamicin, ampicillin,
2 mM L-Glutamine, 100 µM non-essential amino acids, 1 mM
sodium pyruvate, and 1:1000 2-mercaptoethanol. For the mesenteric lymph node (MLN), the tissue samples
were incubated for 30 minutes at 37°C on a horizontal shaker in RPMI medium supplemented with 8% FBS,
gentamicin, ampicillin, HEPES, collagenase D (1mg/mL), and DNase I (100U/mL), prior to transferring the
suspension to a cell strainer and collection by centrifugation. Cells were counted with 1:1 Trypan blue using
Cellometer and stored as described above. Intracellular cytokine staining and �ow cytometry analyses. Splenic
and mesenteric lymph node MNCs and blood PBMCs were thawed at room temperature, resuspended in RPMI-
1640 medium with 10% FBS, ampicillin, and gentamicin, and plated at a concentration of 2x106
cells/100µL/well of a 96-well V-bottom tissue-culture plate. Two wells were prepared for each sample and 3
separate plates for each of the 3 staining protocols. An unstimulated preparation of RPMI-1640 medium with
10% FBS, ampicillin, gentamicin, and 0.2 µg anti-human CD49 costimulatory mAb was applied to one well for
each sample per plate at 100 µL per well. A stimulation preparation of RPMI-1640 medium with 10% FBS,
ampicillin, gentamicin, 0.2 µg CD49 mAb, and 1µL JPT Pepmix (puri�ed recombinant HEV ORF2 antigen) was
applied to one well for each sample per plate at 100 µL per well. A cell stimulation mixture (eBioscience, Inc.)
was used as a positive stimulation control. Cells were stimulated for 12 hr at 37°C. Brefeldin A (GolgiPlug, BD
Biosciences) was added to each well at 0.2
µL/well and further incubated at 37°C for 5 hr. Plates were
stored overnight and protected from light at 4°C prior to antibody staining. PBMCs and MNCs were washed
with PBS once, resuspended in cold PBS with 3% FBS (FACS buffer), and stained with one of the following three
panels of �uorochrome-conjugated antibodies according to manufacturer’s recommendations and procedures
described previously (45, 48, 49). In panel one, PBMCs (2x106 cells per well) were sequentially stained with the
following mAb sets diluted in cold PBS with 3% FBS at 4°C for 15 min per incubation period: Spectral Red-
conjugated mouse (IgG1) anti-pig CD3e (clone PPT3; Southern Biotech) and phycoerythrin (PE)- conjugated
mouse (IgG1) anti-pig CD16 (AbDSerotec) followed by permeabilization with BD Cyto�x/Cytoperm buffer (BD
Pharmigen) at 4°C for 15 min and washing thrice with BD Perm/Wash buffer (BD Pharmigen). Intracellular
markers were stained with mouse IgG2b anti- human CD79a (Clone 11D10, Vector Laboratories), followed by
PE-Cy7
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 128/156
-goat anti-mouse IgG2b (Southern Biotech) and FITC-conjugated rat anti-mouse (IgG2b)
(BioLegend) at 4°C for 15 min. Appropriate isotype-matched control antibodies were included as background
staining controls (Southern Biotech, BD Biosciences, eBioscience, and Affymetrix ebioscience). The
frequencies of CD16+ and CD79a+ cells were expressed as percentages of parental CD3gated cells. In panel
two, in vitro HEV-speci�c antigen-stimulated PBMCs and splenic and mesenteric lymph node MNCs were
stained with antibodies to determine the frequencies of CD3+CD4+Foxp3+ Treg cells, CD25+ activation status,
and the expression of regulatory cytokines IL-10 and TGF-b in these cells (45, 48). PBMCs, spleen-derived
MNCs, and mesenteric lymph node-derived MNCs (2x106 cells/well) were stained at 4°C for 15 min with FITC-
conjugated mouse (IgG2b) anti-pig CD4a, SPRD-conjugated mouse (IgG2a) anti-pig CD3, and mouse (IgG1)
anti-pig CD25 (IgG1, clone K231.3B2; AbD Serotec), followed by APC-conjugated rat (IgG1) anti-mouse (clone
X56, BD Pharmingen). After staining for the extracellular markers, the cells were permeabilized with 146 the
Foxp3-staining buffer set (eBioscience) at 4°C for 15 min. Intracellular staining was completed with PE-Cy7-
conjugated rat (IgG2) anti-mouse/rat Foxp3 (cloneFJK-16s; eBioscience), Biotin mouse (IgG1) anti-pig IL-10
(clone 945a; Cell Sciences), and PE- conjugated mouse (IgG1) anti- human TGF-b1 (clone 9016; R&D system)
at 4°C for 15 min. The appropriated isotype-matched control antibodies and PE-conjugated
mouse (IgG1) isotype control (clone P3.6.2.8.
2; eBioscience) were used as background staining controls. The frequencies of CD4+Foxp3+, CD25+, IL-10+,
and TGF-b+ cells were expressed as percentages of parental CD3 gated cells. In panel three, in vitro HEV-
speci�c antigen-stimulated PBMCs and spleen-derived and mesenteric lymph node-derived MNCs were
stained with antibodies to determine CD3+ CD4+ cells expressing IL-4 and IFN-g regulatory cytokines. PBMCs
and MNCs were stained at 4°C for 15 min with FITC-conjugated mouse (IgG2b) anti-pig CD4a (clone 74-12-4;
BD Pharmingen) and SPRD-conjugated (IgG1) anti-pig CD3e followed by permeabilization with BD
Cyto�x/Cytoperm buffer (BD Pharmingen) at 4°C for 15 min. PBMCs and MNCs were washed three times with
BD Perm/Wash buffer (BD Pharmingen) and subsequently stained with PE-conjugated mouse (IgG1) anti-pig
IFN-g (clone P2G10; BD Pharmingen) and
Brilliant Violet 421 anti-human IL-4 antibody (IgG1 clone MP4-25D2; BioLegend).
The appropriate isotype-matched control antibodies were used as background staining controls (BioLegend,
BD Biosciences, and Southern Biotech). For all three staining panels, at least 100,000 events
were acquired on FACS Calibur �ow cytometer (BD Biosciences) and the data were analyzed using
FloJo V10 software (Tree Star).
The absolute number of B, Treg, and NK-cells were based on the frequencies of cells in each sample,
respectively. Statistical analyses. All data was statistically analyzed using GraphPad Prism 7.0 (GraphPad
Software Inc.). The differences between the mean values of two treatment groups were analyzed with two-way
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 129/156
ANOVA or two-tailed unpaired student’s t-test and Tukey multiple comparison tools. The presence or absence
of hepatic in�ltrates was analyzed by Fisher’s exact test.
A p-value of <0.05 was considered statistically signi�cant for all
analyses. All graphs were reported as the mean +/- SEM. ACKNOWLEDGMENTS This study
is supported by grants from the National Institutes of Health (R01 AI074667, and R01 AI050611). Danielle M.
Yugo is supported by a
Ruth L. Kirschstein National Research Service Award Institutional Research Training Grant (T32OD010430). We
thank Ms. Melissa Makris for her technical assistance in �ow cytometry, Karen Hall, Kimberly Allen, Peter
Jobst, and the Teaching and Research Animal Care Support Staff (TRACCS) for their support in the animal
study, and Dr. Lijuan Yuan’s laboratory for their support in the animal study. REFERENCES 1. Yugo DM, Meng
XJ. 2013. Hepatitis E virus: foodborne, waterborne and zoonotic transmission. Int J Environ Res Public Health
10:4507-33. 2. 3. Emerson S, Purcell R.
2003. Hepatitis E virus. Reviews in medical virology 13:145-154.
Dalton H, Bendall R, Ijaz S, Banks M. 2008. Hepatitis E: an emerging infection in developed countries. The
Lancet infectious diseases 8:698-709. 4. Meng X-J. 2011. From barnyard to food table: the omnipresence of
hepatitis E virus and risk for zoonotic infection and food safety. Virus Res 161:23-30. 5. Meng X-J. 2013.
Zoonotic and foodborne transmission of hepatitis E virus. Semin Liv Dis 33:41-49. 6. Navaneethan U. 2009.
Seroprevalence of hepatitis E infection in pregnancy - more questions than answers. Indian J Med Res
130:677-9. 7. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy: understanding the
pathogenesis. Liver Int 28:1190-1199. 8. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H,
Reimerink JH, Koopmans MP.
2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-53.
9. Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. 2009. Persistent carriage of hepatitis E virus in patients
with HIV infection. N Engl J Med 361:1025-7. 10. Kamar N, Garrouste C, Haagsma EB, Garrigue V, Pischke S,
Chauvet C, Dumortier J, Cannesson A, Cassuto-Viguier E, Thervet E, Conti F, Lebray P, Dalton HR, Santella R,
Kanaan N, Essig M, Mousson C, Radenne S, Roque-Afonso AM, Izopet J, Rostaing L. 2011. Factors associated
with chronic hepatitis in patients with hepatitis E virus infection who have received solid organ transplants.
Gastroenterology 140:1481-9. 11. Singh A, Seth R, Gupta A, Shalimar, Nayak B, Acharya SK, Das P. 2016.
Chronic hepatitis E - an emerging disease in an immunocompromised host. Gastroenterol Rep (Oxf)
doi:10.1093/gastro/gow024. 12.
Purdy MA, Harrison TJ, Jameel S, Meng XJ, Okamoto H, Van der Poel WHM, Smith DB, Ictv
Report C. 2017. ICTV Virus Taxonomy Pro�le: Hepeviridae. J Gen Virol 98:2645-2646. 13.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 130/156
Meng XJ. 2010. Hepatitis E virus: animal reservoirs and zoonotic risk. Vet Microbiol
140:256-265. 14.
Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B,
Emerson S. 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci
U S A 94:9860-9865. 15. Sonoda H, Abe M, Sugimoto T, Sato Y, Bando M, Fukui E, Mizuo H, Takahashi M,
Nishizawa T, Okamoto H. 2004. Prevalence of hepatitis E virus (HEV) Infection in wild boars and deer and
genetic identi�cation of a genotype 3 HEV from a boar in Japan. J Clin Microbiol 42:5371-4. 16. Izopet J,
Dubois M, Bertagnoli S, Lhomme S, Marchandeau S, Boucher S, Kamar N, Abravanel F, Guerin JL. 2012.
Hepatitis E virus strains in rabbits and evidence of a closely related strain in humans, France.
Emerg Infect Dis 18:1274-1281. 17. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C, Qiao Z, Fan J, Ma H, Li M, Song
A, Wang Y. 2009. A novel genotype of hepatitis E virus prevalent among farmed rabbits in China. J Med Virol
81:1371-1379. 18. de Deus N, Peralta B, Pina S, Allepuz A, Mateu E, Vidal D, Ruiz-Fons F, Martín M, Gortázar C,
Segalés J. 2008. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in
Spain. Veterinary microbiology 129:163-170. 19. 20. Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. 2017.
Hepatitis E Virus Genotypes and Evolution: Emergence of Camel Hepatitis E Variants. Int J Mol Sci 18.
Lee GH, Tan BH, Teo EC, Lim SG, Dan YY, Wee A, Aw PP, Zhu Y, Hibberd ML, Tan CK,
Purdy MA, Teo CG. 2016. Chronic Infection With Camelid Hepatitis E Virus in a Liver Transplant Recipient Who
Regularly Consumes Camel Meat and Milk. Gastroenterology 150:355-7 e3. 21. Payne CJ, Ellis TM, Plant SL,
Gregory AR, Wilcox GE. 1999. Sequence data suggests big liver and spleen disease virus (BLSV) is genetically
related to hepatitis E virus. Vet Microbiol 68:119-125. 22. Billam P, Huang F, Sun Z, Pierson F, Duncan R, Elvinger
F, Guenette D, Toth T, Meng XJ. 2005. Systematic pathogenesis and replication of avian hepatitis E virus in
speci�c- pathogen-free adult chickens. J Virol 79:3429-3437. 23. Sun ZF, Larsen CT, Huang FF, Billam P, Pierson
FW, Toth TE, Meng XJ. 2004. Generation and infectivity titration of an infectious stock of avian hepatitis E virus
(HEV) in chickens and cross-species infection of turkeys with avian HEV. J Clin Microbiol 42:2658-2662. 24.
Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. 2011. Novel hepatitis E
virus genotype in Norway rats, Germany. Emerg Infect Dis 16:1452-1455. 25.
Johne R, Plenge-Bönig A, Hess M, Ulrich R, Reetz J, Schielke A. 2010. Detection of a novel hepatitis E-
like virus in faeces of wild rats using a nested broad-spectrum RT-PCR.
The Journal of general virology 91:750-758. 26. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V,
Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A,
Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. 2012. Bats worldwide carry hepatitis E virus-related viruses
that form a putative novel genus within the family Hepeviridae. J Virol 86:9134-9147. 27. Batts W, Yun S,
Hedrick R, Winton J. 2011. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 131/156
clarkii). Virus Res 158:116-123. 28. Kasorndorkbua C, Guenette D, Huang F, Thomas P, Meng XJ, Halbur P. 2004.
Routes of transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-5052. 29. Cao D, Huang Y-W,
Meng X-J. 2010. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus
genome are critical for virus replication. Journal of virology 84:13040-13044. 30.
Yugo DM, Cossaboom CM, Meng XJ. 2014. Naturally occurring animal models of human hepatitis E virus
infection. ILAR J
55:187-99. 31. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette DK, Toth TE, Meng XJ. 2001.
Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J Clin Microbiol 39:3040-
6. 32. Purcell RE, S.U. 2001. Hepatitis E Virus, 4th ed, p 3051-3061. Lippincott: Williams and Wilkins,
Philadelphia, PA.
33. Halbur PG, Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell RH, Emerson SU, Toth TE, Meng XJ.
2001. Comparative pathogenesis of infection of pigs with hepatitis E viruses recovered from a pig and a human.
J Clin Microbiol
39:918-923. 34. Meng XJ, Halbur P, Shapiro M,
Govindarajan S, Bruna J, Mushahwar I, Purcell R, Emerson S. 1998. Genetic and experimental evidence for
cross-species infection by swine hepatitis E virus. J Virol 72:9714-9721. 35.
Billam P, Pierson F, Li W, LeRoith T, Duncan R, Meng X. 2008. Development and validation of a negative-strand-
speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus: identi�cation of
nonliver replication sites. Journal of clinical microbiology 46:2630-2634. 36. Emerson S, Purcell R. 2007.
Hepatitis E. The Pediatric infectious disease journal 26:1147-1148. 37. Tsarev SA, Emerson SU, Tsareva TS,
Yarbough PO, Lewis M, Govindarajan S, Reyes GR, Shapiro M, Purcell RH. 1993. Variation in course of hepatitis
E in experimentally infected cynomolgus monkeys. J Infect Dis 167:1302-1306. 38. Tsarev SA, Tsareva TS,
Emerson SU, Rippy MK, Zack P, Shapiro M, Purcell RH. 1995. Experimental hepatitis E in pregnant rhesus
monkeys: failure to transmit hepatitis E virus (HEV) to offspring and evidence of naturally acquired antibodies
to HEV. J Infect Dis 172:31-37. 39. Billam P, LeRoith T, Pudupakam RS, Pierson FW, Duncan RB, Meng XJ. 2009.
Comparative pathogenesis in speci�c-pathogen-free chickens of two strains of avian hepatitis E virus
recovered from a chicken with Hepatitis-Splenomegaly syndrome and from a clinically healthy chicken. Vet
Microbiol 139:253-261. 40. Lei S, Ryu J, Wen K, Twitchell E, Bui T, Ramesh A, Weiss M, Li G, Samuel H, Clark-
Deener S, Jiang X, Lee K, Yuan L. 2016.
Increased and prolonged human norovirus infection in RAG2/IL2RG de�cient gnotobiotic pigs with severe
combined immunode�ciency.
Sci Rep 6:25222. 41. 42. Ryu J, Lee K. 2017. CRISPR/Cas9-Mediated Gene Targeting during Embryogenesis in
Swine. Methods Mol Biol 1605:231-244. Kang JT, Cho B, Ryu J, Ray C, Lee EJ, Yun YJ, Ahn S, Lee J, Ji DY, Jue N,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 132/156
Clark- Deener S, Lee K, Park KW. 2016.
Biallelic modi�cation of IL2RG leads to severe combined immunode�ciency in pigs.
Reprod Biol Endocrinol 14:74. 43.
44. Dalton H, Bendall, RP, Rashid, M, et al. 2011. Host risk factors and autochthonous hepatitis e
infection. Eur J Gastroenterol Hepatol
23:1200-5. Dalton HR, Fellows HJ, Stableforth W, Joseph M, Thurairajah PH, Warshow U, Hazeldine S,
Remnarace R, Ijaz S, Hussaini SH, Bendall RP. 2007. The role of hepatitis E virus testing in drug-induced liver
injury. Aliment Pharmacol Ther 26:1429-1435. 45.
Cao D, Cao QM, Subramaniam S, Yugo DM, Heffron CL, Rogers AJ,
Kenney SP, Tian D, Matzinger SR, Overend C, Catanzaro N, LeRoith T, Wang H, Pineyro P, Lindstrom N, Clark-
Deener S, Yuan L, Meng XJ. 2017.
Pig model mimicking chronic hepatitis E virus infection in immunocompromised patients to assess immune
correlates during chronicity. Proc Natl Acad Sci U S A
114:6914-6923. 46. Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection of
pigs with a genotype 3 swine hepatitis E virus (HEV) protects against subsequent challenges with homologous
and heterologous genotypes 3 and 4 human HEV. Virus Res 159:17-22.
47. Meng X, Halbur P, Haynes J, Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental
infection of pigs with the newly identi�ed swine hepatitis E virus (swine HEV), but not with human strains of HEV.
Archives of virology
143:1405-1415. 48.
Wen K, Li G, Yang X, Bui T, Bai M, Liu F, Kocher J, Yuan L. 2012. CD4+ CD25- FoxP3+ regulatory cells are the
predominant responding regulatory T cells after human rotavirus infection or vaccination in gnotobiotic pigs.
Immunology 137:160-
71. 49.
Yuan L, Wen K, Azevedo MS, Gonzalez AM, Zhang W, Saif LJ. 2008. Virus-speci�c intestinal IFN- gamma
producing T cell responses induced by human rotavirus infection and vaccines are correlated with protection
against rotavirus diarrhea in gnotobiotic pigs. Vaccine 26:3322-
31. 50.
Emerson SU, Purcell RH. 2007. Hepatitis E. Pediatr Infect Dis J
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 133/156
26:1147-8. 51.
Rogers CS, Hao Y, Rokhlina T, Samuel M, Stoltz DA, Li Y, Petroff E, Vermeer DW, Kabel AC, Yan Z, Spate L, Wax
D, Murphy CN, Rieke A, Whitworth K, Linville ML, Korte SW, Engelhardt JF, Welsh MJ, Prather RS. 2008.
Production of CFTR-null and CFTR-DeltaF508 heterozygous pigs by adeno-associated virus-mediated gene
targeting and somatic cell nuclear transfer. J Clin Invest 118:1571-
7. 52. 53. Purcell R, Emerson S. 2008.
Hepatitis E: an emerging awareness of an old disease. Journal of hepatology
48:494-503. Aggarwal R, Kamili S, Spelbring J, Krawczynski K. 2001. Experimental studies on subclinical
hepatitis E virus infection in cynomolgus macaques. J Infect Dis 184:1380- 1385. 54. 55. 56. 57. Krawczynski
K, Meng X-J, Rybczynska J. 2011. Pathogenetic elements of hepatitis E and animal models of HEV infection.
Virus Res 161:78-83. Butterworth PJ. 1983.
Alkaline phosphatase. Biochemistry of mammalian alkaline phosphatases. Cell Biochem Funct
1:66-70. Kim YB. 1975. Developmental immunity in the piglet. Birth Defects Orig Artic Ser 11:549-57.
Saif LJ, Ward LA, Yuan L, Rosen BI, To TL. 1996. The gnotobiotic piglet as a model for studies of disease
pathogenesis and immunity to human rotaviruses. Arch Virol Suppl 12:153-
61. 58. 59.
Wack A, Openshaw P, O'Garra A. 2011. Contribution of cytokines to pathology and protection in virus infection.
Curr Opin Virol 1:184-95. Boer MC, Joosten SA, Ottenhoff TH. 2015. Regulatory T-Cells at the Interface between
Human Host and Pathogens in Infectious Diseases and Vaccination. Front Immunol 6:217. 60. 61. 62. Ndure J,
Flanagan KL. 2014. Targeting regulatory T cells to improve vaccine immunogenicity in early life. Front Microbiol
5:477.
Yoshioka K, Suzuki C, Tanaka A, Anas IM, Iwamura S. 2002. Birth of piglets derived from porcine zygotes
cultured in a chemically de�ned medium. Biol Reprod 66:112-
9.
Lee K, Redel BK, Spate L, Teson J, Brown AN, Park KW, Walters E, Samuel M, Murphy CN, Prather RS. 2013.
Piglets produced from cloned blastocysts cultured in vitro with GM-CSF. Mol Reprod Dev
80:145-54. 63. Erker JC, Desai SM, Schlauder GG, Dawson GJ, Mushahwar IK. 1999. A hepatitis E virus variant
from the United States: molecular characterization and transmission in cynomolgus macaques. J Gen Virol 80
( Pt 3):681-90. 64. Meng XJ, Halbur PG, Shapiro MS, Govindarajan S, Bruna JD, Mushahwar IK, Purcell RH,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 134/156
Emerson SU. 1998. Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. J
Virol 72:9714-21. 65. Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR.
2006. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus.
J Virol Methods 131:65-71.
66. Mokhtari C, Marchadier E, Haim-Boukobza S, Jeblaoui A, Tesse S, Savary J, Roque- Afonso AM. 2013.
Comparison of real-time RT-PCR assays for hepatitis E virus RNA detection. J Clin Virol 58:36-40. 67.
Subramaniam S, Pineyro P, Tian D, Overend C, Yugo DM, Matzinger SR, Rogers AJ, Haac ME, Cao Q, Heffron CL,
Catanzaro N, Kenney SP, Huang YW, Opriessnig T, Meng XJ. 2014. In vivo targeting of porcine reproductive and
respiratory syndrome virus antigen through porcine DC-SIGN to dendritic cells elicits antigen-speci�c CD4T cell
immunity in pigs. Vaccine 32:6768-75. 68.
Yuan L, Ward LA, Rosen BI, To TL, Saif LJ. 1996. Systematic and intestinal antibody- secreting cell
responses and correlates of protective immunity to human rotavirus in a gnotobiotic pig model of disease. J Virol
70:3075-
83. TABLES TABLE 1. Experimental infection of wild-type and immunoglobulin JH (-/-) knockout gnotobiotic
piglets with a genotype 3 human strain (US2) of hepatitis E virus Group Number of Pigletsa Phenotype of
Piglets Inoculab Necropsy at 4 wpi 1 5 JH Knock-out PBS 5 2 6 JH Knock-out G3 (US2) HEV 6 3 4 Wild-type
PBS 4 4 5 Wild-type G3 (US2) HEV 6 aPiglets were retrieved by hysterectomy at 111-113 days of gestation and
maintained germ-free in sterile isolators for the duration of the study. Variation in piglet numbers per groups
was due to the e�ciency in retrieval of live piglets following embryo transfer. bPiglets were inoculated with
US2 strain of HEV or mock (PBS) at 8 days of age via ear-vein injection. TABLE 2. E�cacy of CRISPR/Cas9 to
introduce targeted modi�cations in Ig heavy chain locus during embryogenesis Gene Total # injected % of
blastocysts on day 7 # of genotyped Homozygous Biallelic Genotypes a Mosaic Hetero WT Ig heavy chain 132
24 (18.2%) 15 3 12 0 0 0 aSingle embryos at blastocyst stage were used for genotyping. No wild-type allele
was found. TABLE 3. Phenotyping of Ig heavy-chain modi�ed piglets produced using CRISPR/Cas9 technology
and retrieved by hysterectomy Number of Surrogate embryos Stage of Number of ID Modi�cation transferred
into a embryo Pregnancy pigletsa surrogate 308 Ig Heavy chain 82 Day 6 Y 3 piglets and 1 mummy 68-8 Ig
Heavy chain 74 Day6 Y 5 piglets 61-12 Ig Heavy chain 89 Day5 Y 4 piglets 29-1 Ig Heavy chain 81 Day6 Y 3
piglets 61-13 Ig Heavy chain 80 Day 6 Y 4 piglets Y465 WT 83 Day 6 Y 8 piglets and 3 mummy 70-3 WT 89 Day
5,6 Y 8 piglets 55-09 WT 68 Day 6,7 Y 2 piglets 70-04 WT 105 Day 5 Y 2 piglets aA total of 21 piglets were
delivered from 5 surrogate gilts carrying the immunoglobulin heavy chain knockout JH (-/-) phenotype. The
piglets were maintained in gnotobiotic status in sterile isolators for the duration of the experimental period.
TABLE 4. Genotyping the Ig heavy chain modi�ed piglets Pig ID Mutation Genotype a
GCACACCCCCCAGGTTTTTGTGGGGCGAGCCTGGAGATTGCACCACT WT N/A
GTGATTACTATGCTATGGATCTCTGGGGCCCAGGCGTTGAAGTCGTC GTGTCCTCAGGTAAGAACGGCCC 308-1
Homozygous GCACACCCCCCAGGTTTTTAGTGGGGCGAGCCT (1bp) 308-2 Biallelic mutation
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 135/156
GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) GCACACCCCCCAGGT------GGGGCGAGCCTGGAG
(6bp) 308-3 Homozygous GCACACCCCCCAGGT-------GTGGGGCGAGCCTGGAG (4bp) 68-8-1 Biallelic mutation
GCACACCCCCCAGGT----GTGGGGCGAGCCTGGAG (4bp) GCACACCCCCCAGGTT---- (282bp) 68-8-2
Homozygous GCACACCCCCCAGGT----GTGGGGCGAGCCTGGAG (4bp) 68-8-3 Biallelic mutation
GCACACCCCCCAGGTTTTTTTTGTGGGGCGAGCCTGGAG (3bp)
GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 68-8-4 Biallelic mutation GCACACCCCCCAGG-----
GTGGGGCGAGCCTGGAG (5bp) GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 68-8-5 Biallelic
mutation GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) GCACACCCCCCAGG------
GGCGAGCCTGGAGATTGCAC (9bp) 61-12-1 Homozygous
GCACACCCCCCAGGCCACACTCACCCCTCCAGGGGCGAGCCTGGAG (14bp) 61-12-2 Homozygous
TCCCAGCCCTGCGGCCGAGGG------GTGGGGCGAGCCTGGAG (59bp) GCACACCCCCCAGG------
GGGGGCGAGCCTGGAG 61-12-3 Homozygous (6bp,1bp) Biallelic
GCACACCCCCCAGGTTTTTTGTGGGGCGAGCCTGGAG (1bp) 61-12-4 mutation GGGAAGTCAGGAGGGAGC------
AGATTGCACCAC (107bp) 29-1-1 Homozygous GCACACCCCCCAGGT----GTGGGGCGAGCCT (4bp) 29-1-2
Homozygous GCACACCCCCCA------GGGGCGAGCCT (9bp) Biallelic GCACACCCCCCA------GGGGCGAGCCT (9bp)
29-1-3 mutation GCACACCCCCCAGGTTTTTGTGGGGGCGAGCCT (1bp) GCACACCCCCCAGGTTTTT------
CTCAGGT (80bp) Biallelic GCACACCCCCCAG------GTGGGGCGAGCCTGGAGATTGCACCAT 61-13-1 mutation
GTGATTACTATGCTATGGGATCTCTGGGGCCCAGGCGTTGAAGTCGC TCGTGTCCT—GTAAGAACGGCCC (9bp,
2bp, 2bp) GCACACCCCCCAGGTTTT-------TCGTGTCCTCAGGTAAGAA Biallelic 61-13-2 CGGCCC (74bp) mutation
GCACACCCCC------CAGGTAAGAACGGCCC (91bp) GCACACCCCCCAGGTTTTTGT------CGTGTCCTCAGGT 61-13-3
Homozygous (72 bp) 61-13-4 Homozygous GCACACCCCCCAGGTTTTT------CTCAGGT (80bp) aGenotype of
each knock-out piglet with mutations on each allele individually or on both alleles. Number of base pairs for
each indicated in parentheses. Underline indicates targeting sequence. Bold letters indicate insertion or
change in nucleotides, and ‘-’ indicates deletion of a nucleotide. All piglets carried mutation on Ig heavy chain
TABLE 5. Detection of HEV RNA in the serum (fecal) samples of wild-type and Ig JH (-/-) knockout gnotobiotic
piglets experimentally infected with the US2 strain of human HEV Group Inoculum Piglet phenotype No. of
positive samples/no. tested on DPI a: 0 7 14 21 28 1 PBS 2 HEV 3 PBS 4 HEV Knock-out Knock-out Wild-type
Wild-type 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/5 (0/5) 0/6 (0/6) 4/6 (6/6) 5/6 (6/6) 4/6 (6/6) 5/6 (6/6) 0/4
(0/4) 0/4 (0/4) 0/4 (0/4) 0/4 (0/4) 0/4 (0/4) 0/6 (0/6) 1/6 (3/6) 4/6 (6/6) 3/6 (6/6) 3/6 (6/6) aDPI: days post-
inoculation. HEV RNA was detected via strain-speci�c nested RT-PCR and qPCR. The ampli�ed PCR-positive
products were sequenced to con�rm the identity as the US2 strain of HEV. TABLE 6. Primers and double-
stranded DNA (dsDNA) used for the development of Ig heavy-chain knockout piglets Name Sequence (5’-3’) Ig
Heavy chain G-block 1 (dsDNA) Ig Heavy chain G-block 2 (dsDNA) Ig Heavy chain G-block 3 (dsDNA) Ig Heavy
chain G-block 4 (dsDNA) T7_Ig Heavy chain 1F TTAATACGACTCACTATAGGCGTTGAAGTCGTCGTGTC
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTG
CTTTTTTGTTTTAGA TTAATACGACTCACTATAGGACACCCCCCAGGTTTTTG
TGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 136/156
GCTTTTTTGTTTTAGA TTAATACGACTCACTATAGGAGATTGCACCACTGTGAT
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTG
CTTTTTTGTTTTAGA TTAATACGACTCACTATAGGGTTGAAGTCGTCGTGTCC
TCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT
GCTTTTTTGTTTTAGA TTAATACGACTCACTATAGGCGTTGAAGTCGTCGTGTC T7_Ig Heavy chain 2F T7_Ig
Heavy chain 3F TTAATACGACTCACTATAGGACACCCCCCAGGTTTTTG TG
TTAATACGACTCACTATAGGAGATTGCACCACTGTGAT T7_Ig Heavy chain 4F
TTAATACGACTCACTATAGGGTTGAAGTCGTCGTGTCC TC T7_sgRNA R AAAAGCACCGACTCGGTGCC Cas9 F
TAATACGACTCACTATAGGGAGAATGGACTATAAGGA CCACGAC Cas9 R GCGAGCTCTAGGAATTCTTAC
Genomic Primer F GACACTTTGGAGGTCAGGAACGGGAG Genomic Primer R
CTTCTCTCTCCGACATGGCTCTTTCAGAC FIGURES Fig. 1 A Ig Heavy B chain 2 3 1 4 Wild type sgRNA Targeting
sequence 1 CCAGGCGTTGAAGTCGTCGTGTC 2 ACACCCCCCAGGTTTTTGTGGGG 3
CCTGGAGATTGCACCACTGTGAT 4 GTTGAAGTCGTCGTGTCCTCAGG Homozygous C
C C C C A Wild type G G T T T T T G T G G G G C mEmutbartiyoon#1 C C C C
A Homozygous mutation (308-3)
G G T G T G G G G C G A G C
Biallelic mutation Embryo #2 C C C C A Biallelic mutation (308-2) G
G T G T T G T T G A G G C T G A G G C G
Fig. 1. Ig heavy chain targeting CRISPR sequences and representative types of Ig heavy chain mutations in this
study. (A) Disruption of Ig heavy chain in pigs by CRISPR/Cas9 with a total of 4 target sites designed using a
web-based program. Bold letters indicate PAM sequence of target sites. Black arrows indicate primers used to
amplify the target region. (B) Types of genetic mutations of the Ig heavy chain in single blastocyst. The
sequencing results indicated either homozygous or biallelic mutation of Ig heavy chain in single embryos with
no wild-type alleles observed. (C) Representative genotype of Ig heavy chain knock-out pigs. Arrows indicate
sites of mutations. Fig. 2 A B 5×10-1 5×10-1 4×10-1 *** CD79a+ B-cells Frequency of parent 4×10-1 *** 3×10-1
2×10-1 CD79a+ B-cells 3×10-1 2×10-1 1×10-1 Frequency of parent 1×10-1 0 0 knock-out wild-type knock-out
wild-type Fig. 2. B-lymphocyte cell counts in peripheral blood samples of wild-type and immunoglobulin JH
knockout gnotobiotic piglets experimentally-infected with HEV. PBMCs were collected from each piglet at 28
days post-inoculation (dpi) at necropsy. Cells were gated based on CD3 and quanti�ed for the intracellular
marker CD79a+ as a measure of the total B-cell population in the peripheral blood. Asterisks indicate statistical
signi�cance between designated groups determined by Tukey’s t-test with a p value <0.001. Fig. 3 A B 6×107 *
4×107 Fecal viral RNA copies per 1mL 10% suspension 2×107 4×106 3×106 2×106 1×106 0 0 2 4 7 9 1 1 1 4 1
6 1 8 2 1 Days post-infection K/O HEV infected W/T HEV infected 2 3 2 5 2 8 C 1×109 1×108 log10 per 1mL
10% suspension 1×107 Fecal viral RNA 1×106 1×105 1×104 1×103 1×102 1×101 * D 0 2 4 7 9 11 14 16 18 21
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 137/156
23 25 28 Days post-infection K/O HEV infected W/T HEV infected 6×107 5×107 4×107 3×107 Viral RNA (per mL
10% suspension) 2×107 1×107 2×105 1×105 0 8×103 7×103 6×103 Serum viral RNA copies per 1mL 5×103
4×103 3×103 2×103 1×103 0 * Intestinal Content Bile K/O HEV infected W/T HEV infected 0 7 1 4 1 8 Days
post-infection 2 2 K/O HEV infected W/T HEV infected Fig. 3. Quanti�cation of HEV RNA loads in serum, fecal,
and bile samples of wild-type and JH knockout gnotobiotic piglets experimentally-infected with HEV. Viral
RNAs were extracted from (A) fecal samples three times weekly, (B) intestinal contents and bile at 28 days
post-inoculation (dpi), (C) as a scatterplot of fecal viral RNA, with each symbol indicating the value for an
individual piglet, and (D) serum samples at 0, 7, 14, 21, and 28 dpi for the quanti�cation of HEV RNA copy
numbers by qRT-PCR. Data are expressed as mean +/- SEM. The detection limit is 10 viral genomic copies,
which corresponds to 400 copies per 1mL sample or per gram of tissue. Titers below the reported detection
limit were considered negative. Asterisks indicate statistical signi�cance between designated groups as
determined by two-way ANOVA and p-value <0.05. Fig. 4 A 300 200 AST (IU/L) 100 0 C 2000 1500 Alk. phos.
(IU/L) 1000 500 0 0 1 2 3 4 Weeks post-infection K/O PBS K/O HEV W/T PBS W/T HEV 0 1 2 3 4 Weeks post-
infection K/O PBS K/O HEV W/T PBS W/T HEV B 2.0 Total Bilirubin mg/dL 1.5 1.0 0.5 0.0 0 1 2 3 4 Weeks post-
infection K/O PBS K/O HEV W/T PBS W/T HEV D 250 200 * GGT (IU/L) 150 100 50 0 0 1 Weeks post-infection
2 3 4 K/O PBS K/O HEV W/T PBS W/T HEV Fig. 4. Circulating levels of liver enzymes in serum samples
collected weekly from HEV- infected wild-type and HEV-infected JH (-/-) knockout gnotobiotic piglets. Serum
was collected weekly from each piglet beginning with 0-week post-inoculation (wpi) and continuing until
necropsy at 4 wpi. Liver enzymes including (A) aspartate aminotransferase (AST), (B) total bilirubin, (C) alkaline
phosphatase, and (D) gamma-glutamyl transferase (GGT) were measured at the Iowa State University
Veterinary Diagnostic Lab. Normal limits were provided with the analysis based on the laboratory’s standards
for each speci�c test, which are indicated on each scatterplot graph as a dotted line. Each sample indicates an
individual piglet for each time point and are expressed as the mean +/- SEM. Analysis was completed using
two-way ANOVA. *p<0.05. Fig. 5 A B ns 5 ** ** 0.04 ns 4 ns ** * Histopathological lesions * 0.03 3 ns Score ** 2
ns ns 1 0 Liver weight ratio of overall BW 0.02 0.01 -1 Lymphoplasmacytic Hepatocellular 0.00 hepatitis
Necrosis K/O PBS K/O HEV W/T PBS W/T HEV inoculated infected inoculated infected K/O PBS K/O HEV W/T
PBS W/T HEV Fig. 5. Histopathological lesions in wild-type and JH knockout gnotobiotic piglets
experimentally-infected with HEV. (A) Histopathological lesions in the liver including lymphoplasmacytic
hepatitis and hepatocellular necrosis. Lymphoplasmacytic hepatitis was scored as follows:
0, no in�ammation; 1, 1- 2 focal lymphoplasmacytic in�ltrates/ 10 hepatic lobules; 2, 3- 5 focal
in�ltrates/ 10 hepatic lobules; 3, 6- 10 focal in�ltrates /10
hepatic lobules; and 4, >10 focal in�ltrates/10 hepatic lobules. Hepatocellular necrosis was characterized by
the presence of individual hepatocytes with an eosinophilic cytoplasm with or without fragmented or absent
nuclei. (B) Liver/body weight ratio: The liver weights were evaluated as a ratio of overall body weight. Asterisks
indicate statistical signi�cance as determined by two-way ANOVA.
*p<0.05, **p<0.01, ***p<0.001. Fig. 6 A
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 138/156
Mean frequencies of IFNg expressing 1.0 CD4+ T cells among CD3+ cells 0.8 0.6 0.4 0.2 0.0 blood K/O PBS
spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV B 1.0 Mean frequencies of IL-4 expressing CD4+ T
-cells among CD3+ cells 0.8 0.6 0.4 0.2 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS
W/T HEV C Mean frequencies of CD3
+CD4+ T cells 1.0 0.8 0.6 0.4 0.2
0.0 blood K/O PBS ** ** spleen K/O HEV *** ** mesenteric lymph node W/T PBS W/T HEV Fig. 6. Frequencies
of IFN-g and IL-4 intracellular cytokines in mononuclear cells isolated from spleen and mesenteric lymph node
tissues and PBMCs from peripheral blood of wild- type and JH knockout piglets experimentally-infected with
HEV. PBMCs and MNCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy. Cells
were gated on CD3 and stained for extracellular and intracellular markers CD4+ and IFN-g and IL-4,
respectively, after stimulation with HEV-speci�c capsid protein. The mean frequencies of (A) IFN-g, (B) IL-4, (C)
CD4+, are indicated and expressed as mean +/- SEM. All frequencies were determined by �ow cytometry with
100,000 events per sample. *p<0.05. Fig. 7 A 0.4 Mean frequencies of CD3+CD4+ 0.3 CD25+Foxp3 0.2 0.1 0.0
blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV B 1.0 Mean frequencies of
CD3+CD4+ 0.8 CD25-Foxp3 0.6 0.4 0.2 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS
W/T HEV C 1.0 Mean frequencies of TGF-B+CD4+ 0.8 CD25+ Treg cells 0.6 0.4 0.2 0.0 bood K/O PBS spleen
K/O HEV mesenteric lymph node W/T PBS W/T HEV D 0.4 Mean frequencies of IL-10+CD4+ CD25+ Treg cells
0.3 0.2 0.1 0.0 blood K/O PBS spleen K/O HEV mesenteric lymph node W/T PBS W/T HEV Fig. 7. Frequencies
of TGF-b and IL-10 intracellular cytokines in mononuclear cells isolated from spleen and mesenteric lymph
node tissues and PBMCs from peripheral blood of wild- type and JH knockout piglets experimentally-infected
with HEV. PBMCs and MNCs were collected from each piglet at 28 days post-inoculation (dpi) at necropsy.
Cells were gated on CD3 and stained for extracellular and intracellular markers CD4+, CD25+, Foxp3, and TGF-b
and IL- 10 respectively after stimulation with HEV-speci�c capsid protein. The mean frequencies of (A) CD25+
Foxp3+, (B) CD25- Foxp3+, (C) TGF-b, and (D) IL-10 are indicated and expressed as mean +/- SEM. All
frequencies were determined by �ow cytometry with 100,000 events per sample. Chapter V: Evidence for an
Unknown Agent Antigenically Related to the Hepatitis E Virus in Dairy Cows in the United States Danielle M.
Yugo1, Caitlin M. Cossaboom1†, C. Lynn Heffron1, Yao-Wei Huang1‡, Scott P. Kenney1§, Amelia R. Woolums2,
David J. Hurley3, Tanja Opriessnig4, Linlin Li5, Eric Delwart5, Isis Kanevsky6¶, and Xiang-Jin Meng1#
1Department of
Biomedical Sciences and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia
Polytechnic Institute and State University, Blacksburg, VA;
2Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State
University, Mississippi State, MS; 3Department of Large Animal Medicine,
College of Veterinary Medicine, University of Georgia, Athens, GA; 4Division of Infection and Immunity,
The
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 139/156
Roslin Institute, University of Edinburgh, Midlothian, Scotland; 5Department of Laboratory Medicine, Blood
Systems Research Institute, San Francisco, CA; 6Department of Dairy Sciences, Virginia Polytechnic Institute
and State University, Blacksburg, VA; †Present address: National Center for Emerging and Zoonotic Infectious
Diseases, Center for Disease Control and Prevention, Atlanta, GA; ‡Present address: College of Animal
Sciences, Zhejiang University, Hangzhou, Zhejiang, China; §Present address:
Department of Veterinary Preventive Medicine, Food Animal Health Research Program, The Ohio
State University, Wooster, OH; ¶Present address: P�zer Inc, New York City, NY Journal of Medical Virology.
201;8 Oct; DOI: 10.1002/jmv.25339 Modi�ed and reprinted with permission. ABSTRACT Genotypes 3 and 4
hepatitis E virus (HEV) strains within the species Orthohepevirus A in the family Hepeviridae are zoonotic.
Recently, a genotype 4 HEV was reportedly detected in fecal samples of cows; although, independent
con�rmation is lacking. In this study, we �rst tested serum samples from 983 cows in different regions in the
United States for the presence of IgG anti-HEV and found that 20.4% of cows were seropositive. The highest
seroprevalence rate (68.4%) was from a herd in Georgia. In an attempt to genetically identify HEV from cattle, a
prospective study was conducted in a known seropositive dairy herd by monitoring 10 newborn calves from
birth to 6 months of age for evidence of HEV infection. At least three of the 10 calves seroconverted to IgG
anti-HEV, and importantly, the antibodies present neutralized genotype 3 human HEV, thus indicating the
speci�city of IgG anti-HEV in cattle. However, our extensive attempts using broad- spectrum RT-PCR assays
and MiSeq deep-sequencing technology to genetically identify HEV- related sequences in cattle failed. The
results suggest the existence of an agent antigenically-related to HEV in cattle; although, contrary to published
reports, we showed that the IgG recognizing HEV in cattle was not caused by HEV infection. Key words:
Hepatitis E virus (HEV); Cattle; Bovine; Zoonotic transmission; Neutralizing antibodies; Seroprevalence 1.
INTRODUCTION Hepatitis E virus (HEV), the causative agent of hepatitis E, is transmitted via fecal-oral route
through contaminated water and food.1 Hepatitis E is a global disease with large waterborne outbreaks
occurring in developing countries due to poor sanitation conditions. In industrialized countries, sporadic and
cluster cases of hepatitis E due to the ingestion of contaminated animal meats and shell�sh or direct contact
with infected animals have also been reported.2 The overall mortality rate associated with HEV infection
ranges from 0.5%-4% in immunocompetent individuals; however, concurrent pregnancy accounts for increases
in mortality up to 28%.3 4 Immunocompromised individuals infected with HEV, such as organ transplant
recipients,5 lymphoma and leukemia patients,6; 7 or patients with HIV infection,8 tend to progress into
chronicity.9 HEV is a recognized zoonotic agent with numerous known animal reservoirs.10 Among the well-
characterized animal strains of HEV are the genotypes 3 and 4 swine HEV within species Orthohepevirus A in
domestic and wild pigs,11; 12 and the genotypes 1-4 avian HEV within species Orthohepevirus C in
chickens.13; 14 The recent identi�cation of genetically-diversi�ed strains of HEV across a wide range of animal
species including bat,15 �sh, 16 rat,17 ferret,18 rabbit,19 wild boar,12 moose,20 mongoose,21 deer,22 and
camel23 greatly expanded the host range and diversity of the virus. Ruminant species including deer,22
goats,24 sheep, and cattle25 have been implicated as potential reservoir as either IgG anti-HEV or viral RNA
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 140/156
have been detected in these species. In 2016, genotype 4 HEV RNA was reportedly detected in cows in China,
and raw milk was shown to be contaminated with infectious HEV.26 Surprisingly, the HEV sequence from cows
were more than 99% identical across the entire genome to the HEV sequences from humans and pigs in
China.26 Unfortunately, independent con�rmation of this �nding is lacking. Likewise, Yan et al. reported 8 of
254 yellow cattle in Shandong, China with detectable genotype 4 strain HEV RNA from serum.27 However, two
more recent and independent studies failed to identify HEV RNA in milk and fecal samples from >10% of cows
in Belgium28 or from bulk milk samples from dairy herds in Germany29.
Therefore, the main objective of this study was to determine if cattle in the
United States are infected with HEV. 2. MATERIALS AND METHODS 2.1. Bovine
serum samples A total of 1,168 serum samples were collected from
983 cows in different regions of the United States including 223 serum samples from a university dairy herd in
Virginia, 732 archived serum samples from feed lot cattle herds located in Texas, Oklahoma,
New Mexico, South Dakota, North Dakota, Montana, Wyoming, Iowa, and
Nebraska, and a longitudinal study including 213 serum samples from 38 cows in a cattle herd in Georgia
collected at different timepoints (Table 1). 2.2. A prospective �eld study to genetically identify HEV from calves
In an attempt to genetically identify HEV from cows, we conducted a prospective study in a known HEV IgG
seropositive university dairy herd in Virginia by following 10 newborn calves from birth to 6 months of age
when they were moved to pasture. Weekly blood and fecal samples were collected from each of the 10 calves.
Newborn calves were housed in individual hutches until 12 weeks of age, when they were moved to group barn
housing under the standard operating procedures at this farm. The weekly serum and fecal samples were
tested for the presence of HEV RNA by a nested universal RT-PCR assay that is capable of detecting genotypes
1-4 HEV strains (Table S1) and the weekly serum samples were also tested by a commercial ELISA kit (Wantai,
China) for the presence of IgG anti-HEV (Fig. 1). Additionally, the serum level of liver enzymes, including
gamma-glutamyl transferase (GGT), glutamate dehydrogenase (GLDH), and aspartate aminotransferase (AST),
were also measured (Fig. 2). 2.3. Collection of environmental samples from an HEV IgG positive dairy farm A
total of 100 environmental samples were collected from an HEV IgG seropositive dairy farm in Virginia and
stored at -80C until testing. These included composite fresh fecal samples from the milking parlor �oor,
pastures, �oors and bedding from cow and calf barns, run-off water and fecal samples from the waste
collection tanks of the associated barns, and standing pools of cleaning water. All environmental samples
were tested for the presence of HEV RNA by a broad-spectrum nested RT-PCR assay. 2.4. Enzyme-linked
immunosorbent assay (ELISA) to detect IgG anti-HEV in bovine sera The bovine serum samples were tested for
IgG anti-HEV using the commercial Wantai Double Antigen Sandwich ELISA kit (Beijing Wantai Biological
Pharmacy Enterprise CO; https://www.szabo-scandic.com/�leadmin/content/images/AAH/HEV/HEV-
IgG_CE_IFU_1_.pdf). This commercial assay has been shown to be superior to other assays in detecting HEV
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 141/156
antibodies in a previous study.30 10µL of each serum sample was diluted into 100µL of provided diluent,
tested in duplicate wells coated with recombinant HEV antigens to ORF2 (aa 394-606), and HEV antibodies
bound using horse-radish peroxidase (HRP-) conjugated rabbit anti-human IgG secondary antibody, according
to the manufacturer’s instructions. Substrate conversion absorbance was read using a Tecan Sapphire 2.0
instrument using Magellan software. Speci�c signal was collected using 405 nm with a light scatter reference
wavelength of 630 nm. The results for each serum sample were calculated by comparing each individual
sample’s optical density (S) to the cut-off value (C.O.) following the manufacturer’s instructions and quality
control criteria. Serum samples with S/C.O.>1.0 were considered positive for IgG binding HEV. Results were
declared borderline when S/C.O. between 0.9 and 1.1 was measured, and these samples were re-tested for
con�rmation. Samples with S/C.O.<1.0. were declared negative for IgG binding HEV. All sera from herds from
different states (Table 1), the Virginia dairy milking herd (Table 1), and the intensively studied calves and their
respective dams (Table 2) were tested for the presence of IgG binding HEV by ELISA (Fig. 1). 2.5. Serum level
of liver enzyme analyses All sera from the calves in the prospective study (ID #’s 5078, 5079, 5080, 5081, 5082,
5083, 5084, 5086, 5088, and 5091) were tested by the Cornell Animal Health Diagnostic Center (Ithaca, NY)
using standard methods for serum levels of liver enzymes including gamma-glutamyl transferase (GGT),
glutamate dehydrogenase (GLDH), and aspartate aminotransferase (AST). Reference intervals of each enzyme
speci�cally for bovine as determined by Cornell AHDC are as follows: AST 61-162 U/L, GLDH 11-83 u/L, and
GGT 9-50 U/L (Fig. 2). 2.6. Broad-spectrum nested RT-PCR assays to detect HEV RNA in bovine samples
Selected serum, fecal, and environmental
samples were tested for the presence of HEV using a broad-spectrum RT-PCR assay that
is known to detect RNA of multiple HEV genotypes as previously described.31 Additionally, degenerate primer
sets were also designed based on the alignment of known HEV strains (Table S1) and used for the detection of
HEV RNA in the same nested RT-PCR assay. Furthermore, published primers used successfully to identify novel
animal strains of HEV20; 32 were similarly used in the same RT-PCR assay. RNA was extracted from
approximately 100 µL of the 10% fecal suspension or 100 µL of serum samples using TriReagent (Molecular
Research Center, Cincinnati, OH, USA).
cDNA was prepared using Superscript II reverse transcriptase (Life Technologies;
Thermo Fisher, Waltham, MA). Multiple primer sets were utilized for both the �rst and second rounds of nested
RT-PCR (Table S1) using AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA). For the serum
samples from calves in the prospective study, an additional hemi-nested touchdown RT-PCR was utilized with
degenerate primers BatHEVF4228 and BatHEVR4598 (Table S1) according to the published protocol.15 The
second round of the nested RT-PCR was completed using 5µL of �rst round DNA product as the template and
degenerate primers BatHEVF4228 and Bat HEVR4565 (Table S1).15 2.7. In vitro neutralization assay for HEV A
subclone of the Huh7 human liver cell line, Huh7-S10-3,33 was utilized to propagate the genotype 3 human
HEV Kernow P6 strain.34 Human hepatocellular carcinoma cells HepG2/C3A (ATCC, Manassas, VA) were
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 142/156
maintained in Dulbecco's Modi�ed Eagle Medium (DMEM; ThermoFisher Scienti�c, Ontario, Canada) with 10%
FBS on collagen coated �asks and used for all in vitro infectivity assays as described previously35; 36 on
selected bovine sera that were tested positive by ELISA. Brie�y, the genotype 3 HEV Kernow P6 virus stock 37
was incubated in duplicate with PBS as the negative control, Chimp 1313 hyperimmune anti-HEV serum as the
positive control, or selected bovine serum samples at 1:10, 1:100, and 1:1000 dilutions. The mixture was then
added onto the HepG2/C3A liver cells and incubated for 2 hr at 37°C. Afterwards, the samples were removed,
cells washed with PBS, and fresh DMEM medium was added and incubated for 5-6 days. Cells were stained at
5-6 days post-infection by immuno�uorescence assay (IFA) with a rabbit antisera against a bacterially-derived
6x His capsid protein containing a 111 N-terminal amino acid truncation from the HEV Kernow-C1-P6 strain34;
38 as the primary antibody and AlexaFluor 488 goat anti-rabbit IgG (H&L) (Molecular Probes, Life Technologies,
Carlsbad, CA, USA) as the secondary antibody. The number of positive cells were counted and recorded as the
number of �uorescein focus units (FFU). Serum samples were compared to the negative control (PBS) to
generate a value for overall percent decrease in HEV infectivity, which represented the ability of the bovine
serum to neutralize genotype 3 human HEV. Sera were scored as effective if there was greater than 50%
reduction in infectivity and further titered at 1:2 to 1:8192 serial dilutions using the same procedure (Table 3).
2.8. Deep sequencing of serum and fecal samples attempting to genetically identify HEV sequences from
bovine samples Selected serum samples from calves in the prospective study were deep-sequenced using
MiSeq at the Biocomplexity Institute of Virginia Tech, Blacksburg VA, and the Blood Systems Research Institute
at the University of California, San Francisco, CA. Serum samples from calf numbers 5082 and 5091 were
selected for deep-sequencing by MiSeq techniques over the time course of collection. Additionally, serum
samples from all calves (5078, 5079, 5080, 5081, 5082, 5083, 5084, 5086, 5088, and 5091) were pooled and
deep-sequenced via MiSeq for the presence of HEV- related sequences across the trial as well. Furthermore,
100 serum samples representing all of the different geographic regions collected were randomly selected, and
5 µL from each serum was used to assemble a single pool that was subsequently deep-sequenced. Selected
fecal samples from calves in the prospective study including calves #s 5082 and 509, were deep-sequenced
using MiSeq at Columbia University, New York, NY. Library preparation and deep-sequencing analysis was
performed as described previously.39-41 3. RESULTS 3.1. Prevalence of IgG binding HEV antigen in bovine
herds in the United States Serum samples from a total of 983 individual cows including feedlot cows from 9
different States, a dairy herd in Virginia, and a herd in Georgia were tested for IgG that bound HEV antigen
using a commercial ELISA assay. The overall seroprevalence rate across all herds was 20.4% with a range of
16.1% to 68.4% as associated with the geographic locations of the herds (Table 1). The herd from Georgia was
unique in that sequential serum samples were collected from each of the 38 cows over the course of 9
months. The seroprevalence rate across all 213 serum samples from the 38 cows within the Georgia herd was
24.4%. However, this corresponded to 68.4% of individual cows being seropositive at least once during the
study. Of the 223 individual cows from the Virginia Dairy herd, 10 serum samples were from the dams of the
calves participating in the prospective study. Dam numbers 4682, 4810, and 4700, the mothers of calf numbers
5086, 5091, and 5088, were positive for IgG anti-HEV within 2 weeks of calving. In contrast, dam numbers
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 143/156
4832, 4855, 4517, 4854, 4852, 5686, and 4344 were not positive for IgG recognizing HEV (Table 2). 3.2.
Seroconversion to IgG binding HEV antigen in serum of calves from a prospective study in a Virginia Dairy herd
For the prospective study in a dairy herd, the 10 female calves were born from both seropositive dams (#’s
4682, 4810, and 4700) and seronegative dams (#’s 4832, 4855, 4517, 4854, 4852, 4686, and 4344) (Table 2).
Calf numbers. 5079, 5080, 5081, 5084, and 5088 did not seroconvert to HEV at any time point during the study,
and were considered negative (Fig. 1a). Calf numbers 5078, 5082 and 5091 had varying levels of
seroconversion. Calf #5078 brie�y seroconverted by producing IgG recognizing HEV at 31 days of age for 1
week, and again at the age of 71 days for 2 weeks with a relatively low level of antibody (Fig. 1b). Calf #5082
brie�y seroconverted at 28 days of age for 1 week, and again at 78 days of age with a high level of IgG
recognizing HEV observed and lasting 9 weeks. Calf #5091 seroconverted at 106 days of age, with a high level
of HEV IgG observed for 3 weeks. The remaining two calves 5083 and 5086 both had only transient
seroconversion with very low levels of antibodies (Fig. 1b). The prospective study ended with the movement of
calves to pasture at 6 months of age. None of the 10 calves were positive for maternal IgG anti-HEV at the time
of birth or within the �rst 3 weeks after birth (Table 2). Dam numbers 4682, 4700, 4810, corresponding to calf
numbers 5086, 5088, and 5091, had HEV IgG within 2 weeks prior to calving. No correlation between the
seropositive dames and the seroconversion of calves was observed in this study (Table 2). 3.3. Elevation of
serum level of glutamate dehydrogenase (GLDH) liver enzyme in calves that seroconverted to IgG anti-HEV
Since at least three calves in the prospective study seroconverted to HEV, we measured the serum levels of the
liver enzymes; AST, GLDH, and GGT in all serum samples from each of the ten calves on a bi-monthly basis in
(Fig. 2). The results showed that the AST values remained within normal limits (62-162U/L) for all calves
throughout the study. The GGT values were initially elevated on the day of birth, and during the �rst two weeks
of life in calf numbers 5088 and 5091. This is expected in neonates. However, all subsequent samples
remained within normal limits for all calves (11-83 u/L). There appears to be a correlation between peaks in
serum levels of GLDH and the levels of IgG recognizing HEV among the calves that seroconverted in this
prospective study (Fig. 3). Calf numbers 5078, 5082, and 5091, which had relatively high levels of IgG
recognizing HEV, also had high serum levels of GLDH at the same time points (Fig. 3). 3.4. Failure to detect
HEV-related sequences in calves from the prospective study by broad- spectrum nested RT-PCR assays In an
attempt to detect HEV RNA from calves in the prospective study, we utilized broad-spectrum nested RT-PCR
assays with different sets of primers to test selected fecal and serum samples from all calves. PCR primers
targeting the sequences from known HEV strains in the conserved regions of ORF1 (RNA-dependent RNA
polymerase region), ORF2 (capsid gene region), and ORF3 were used for the RT-PCR assays. Furthermore,
published RT-PCR primers and protocols utilized for recent detection of bat,15 rat,31 and rabbit HEV32 strains,
and degenerate pan-primers used for detection of multiple HEV genotypes were also used in our repeated
attempts to amplify HEV RNA (Table S1). Serum and fecal samples used for these RT-PCR assays included
three calves (ID no. 5078, 5082, and 5091) that had seroconverted to HEV (Fig. 1b). Additional samples
collected from many time points from the remaining calves were assayed as well. Despite repeated testing
with different sets of primers and protocols, none of the bovine serum or fecal samples in the prospective
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 144/156
study were positive for HEV RNA. A serum sample containing rabbit HEV was used as the positive control and
was positive in all RT-PCR reactions. Similarly, environmental samples from the dairy herd including water run-
off, surface fecal samples, and combined samples from the sick cow area, calf hutches, calving pen, and free-
stall barns all tested negative using these RT-PCR assays. 3.5. MiSeq deep-sequencing of various bovine
serum and fecal samples did not reveal the
presence of HEV- related sequence The failure to detect HEV RNA
by broad-spectrum RT-PCR assays from serum and fecal samples of calves that apparently seroconverted to
HEV prompted us to employ a deep-sequencing strategy. First, we deep-sequenced pooled sera from the
calves that seroconverted to HEV including samples collected at the week of seroconversion, three time points
prior to seroconversion, and the week following seroconversion. However, analysis of the deep sequence reads
did not identify any HEV-related sequences from the samples. Therefore, we performed additional MiSeq deep
sequencing on combined serum samples collected from calves 5082 and 5091 at all time points from the date
of birth to the end of the prospective study. Again, HEV- related sequences were not identi�ed. Additionally, we
performed MiSeq deep sequencing on fecal samples from calves 5082 and 5091 at all time points, but did not
identify any HEV-related sequence. Sequences from numerous other viruses were identi�ed in the serum and
fecal samples of both calves (data not shown),41 indicating that the MiSeq deep-sequencing technique was
successfully applied. Furthermore, MiSeq deep sequencing was performed on a pooled serum sample from all
time points of all ten calves in the prospective study, again with HEV-related sequence was not detected.
Finally, we performed MiSeq deep sequencing on a combined serum sample from a total of 100 cattle
randomly selected from 9 different states, and again HEV-related sequence was not identi�ed. 3.6. IgG
antibody recognizing HEV antigen present in calves are capable of neutralizing genotype 3 human HEV A virus
neutralization assay was performed to further validate the ELISA results. We found that serum samples with
individual ELISA S/C.O. values ranging from 0.145-0.957 (1.0 is considered seropositive) were unable to
neutralize genotype 3 human HEV in HepG2/C3 cells (data not shown). However, three selected serum
samples from the Virginia dairy herd with individual S/C.O. values of 2.270, 20.851, and 2.658 (Table 3),
respectively, consistently reduced the infection of genotype 3 human HEV by >50% (Table 3). Reductions of
~50% corresponded with virus neutralization titers of 1:16 for calves no. 5078 and 5082 (S/C.O. values 2.658
and 2.270, respectively). 4. DISCUSSION HEV has been genetically identi�ed from more than a dozen animal
species.2 Genotypes 3 and 4 HEV strains within the species Orthohepevirus A infect across species barriers
and are zoonotic. Swine represent the primary natural reservoir for genotypes 3 and 4 HEV,10 and chronic and
neurologic cases of hepatitis E in humans are almost exclusively caused by the zoonotic genotype 3 HEV of
likely animal origins.5; 42 Since the discovery of swine HEV from pigs in the United States in 1997,11
genotypes 3 and 4 HEV have been detected worldwide from both wild and domestic swine.43 The ubiquitous
nature of swine HEV in pigs worldwide has led to contamination of pork products including the United
States,44 the Netherlands,45 the United Kingdom,46 and Japan.47 Food-borne transmission of swine HEV has
been de�nitively
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 145/156
linked to the consumption of raw or undercooked pork products.45 The known host range of HEV
is rapidly expanding with the genetic identi�cation of novel HEV strains from a wide range of species. HEV IgG
has also been identi�ed in several other species including cats, dogs, cattle, horses,25; 48 and goats,24
although the sources of virus inducing seroconversion in these species are unclear. Recently, a genotype 4 HEV
was reportedly detected from fecal samples of cows, and surprisingly the infected cows reportedly excreted
virus into milk.26 This report, although still lacking independent con�rmation, raises serious concerns
regarding milk and beef safety. On the contrary, reports from Germany29 and Belgium28 failed to identify the
presence of HEV in milk samples and dairies. Therefore, it is imperative to de�nitely determine the nature and
extent of HEV infection in cattle. In this study, �rst we utilized a commercial ELISA assay to determine the
seroprevalence of IgG recognizing HEV antigen in cattle in the United States. Serum samples from a total of
983 individual cows from 9 different states were tested, and the results showed that the overall seroprevalence
rate was 20.4% with herd seroprevalence rates ranging from 16.1% to 68.4% depending upon the geographic
locations. The seroprevalence in cattle was similar to those reported in other animal species.43; 48 We also
tested 213 sequential serum samples collected from 38 cows in Georgia over a period of 9 months, and found
that 68.4% of the cows were seropositive at least once during that period, which is similar to the levels
observed in some swine herds.49; 50 The results suggest that there is an HEV-related agent in the bovine
population. In our attempt to identify HEV from cattle, we conducted a prospective study in a known HEV-
seropositive dairy herd by monitoring 10 newborn calves from the time of birth to 6 months of age for evidence
of HEV infection. We showed that at least three of the 10 calves temporarily seroconverted to IgG against HEV
at different time points during the course of the prospective study, suggesting that a HEV-related agent is
present in these calves. Importantly, we demonstrated that the IgG anti-HEV present in the seropositive calves
show some neutralizing activity against the genotype 3 human HEV. This indicates that HEV IgG present in the
cattle can target antigenic epitopes found on HEV. Interestingly, the serum level of liver enzyme GLDH appears
to correlate with the seroconversion to HEV IgG in the calves. This is suggestive of potential liver damage
associated with infection by the HEV-related agent. Our repeated and extensive attempts to genetically identify
the source of seropositivity in the cattle were unsuccessful. Both HEV-speci�c and broad-spectrum degenerate
primers that are known to amplify sequences from multiple HEV genotypes with the species Orthohepevirus
A31 as well as published RT-PCR primers that were successfully used to identify other novel animal strains of
HEV from moose,20 rabbit,32 and bat15 all failed to amplify HEV RNA from serum or fecal samples collected
from the three calves that had seroconverted to HEV and the seven seronegative calves. Similarly, broad-
spectrum RT-PCR assays also failed to amplify HEV RNA from the environmental samples collected in the
seropositive Virginia dairy herd. Detection of viral RNA from ruminant species, especially from fecal samples,
present hurdles when utilizing RT-PCR due to the presence of potential inhibitors.51; 52 While serum samples,
which typically do not have PCR inhibitors, were also used for RT-PCR detection in the study, viremia is
transient during HEV infection and thus it is possible that the window of HEV RNA detection may have been
missed. It is also possible that the HEV responsible for the seropositivity in cattle is genetically highly
divergent, and therefore these broad-spectrum RT- PCR assays still may not be able to detect the virus. For
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 146/156
example, the avian HEV in chickens shares only approximately 50% nucleotide sequence identity with
mammalian HEVs.53; 54 The HEV from cutthroat trout shares <27% identity16 with mammalian HEVs, and the
moose HEV shares only approximately 37-63% identity with other known HEV strains.20 Therefore, deep
sequencing of the bovine samples was also performed to identify all viral sequences present in cattle. MiSeq
deep sequencing was performed on serum samples from the calves that had seroconverted to HEV in the
prospective study including calf numbers 5082 and 5091 at all time points, fecal samples from calves 5082
and 5091, and on pooled serum samples from 100 cows in different geographic regions of the United States.
Despite repeated attempts, no HEV-related sequence was identi�ed from the deep sequencing reads, even
though speci�c sequences from other bovine viruses were successfully identi�ed in the samples, indicating
that the MiSeq deep sequencing procedures worked well. In conclusion, we demonstrate serological evidence
for the existence of an HEV-related agent in cattle, as documented by the relatively high seroprevalence rate of
IgG recognizing HEV in cattle. Further, seroconversion to HEV in newborn calves born seronegative over the
course of their calf-hood, and the ability of that antibody to neutralize genotype 3 human HEV in cell culture
strongly indicate an antigenic relationship with an agent related to HEV. The failure of our repeated attempts to
genetically identify HEV from cows and calves using broad-spectrum RT-PCR assays and MiSeq deep
sequencing technology suggests an important limitation in the interpretation of HEV serological data reported
in a large number of animal species including cattle. It is possible that the seroconversion in cattle is caused
by antigenic cross-reaction with a related, but as yet unknown agent or alternatively is due to antigenic cross-
reactivity with unknown host protein(s). Unless HEV can be de�nitively and reproducibly identi�ed from cattle,
we must be very cautious in speculating the role of cattle, if any, in HEV transmission and potential zoonotic
disease. ACKNOWLEDGEMENTS This study is supported by grants from the National Institutes of Health
(R01AI074667, and R01AI050611). Danielle M. Yugo is supported by a Ruth L. Kirschstein National Research
Service Award Institutional Research Training Grant (T32OD010430). We thank Drs. Suzanne U. Emerson and
Robert H. Purcell at NIAID, NIH, Bethesda, MD for kindly providing us with the human HEV genotype 3 Kernow
P6 strain, Huh7-S10-3 cells, and anti-HEV hyperimmune chimpanzee 1313 antiserum. We also thank Dr. Amit
Kapoor of Columbia University, NY, and Dr. Saikumar Karyala and Dr. Bob Settlage of Biocomplexity Institute of
Virginia Tech for their expert assistance in MiSeq deep sequencing of the bovine samples. Con�icts of interest:
The authors declare that they have no competing interests.
Disclaimers: This paper has not been published elsewhere in part or in entirety, and is not under consideration
for publication by another journal. REFERENCES 1 Purcell RH, S.U. Hepatitis E Virus. In: Knipe D, Howley P,
Gri�n D, Lamb R, Martin M, Roizman B, al. e, editors. Fields Virology 4th ed. Philadelphia, PA: Lippincott:
Williams and Wilkins. 2001. p 3051-3061. 2 Meng XJ. Expanding Host Range and Cross-Species Infection of
Hepatitis E Virus. PLoS Pathog 2016; 12(8):e1005695. 3 Navaneethan U. Seroprevalence of hepatitis E
infection in pregnancy - more questions than answers. Indian J Med Res 2009; 130(6):677-679. 4 Navaneethan
U, Al Mohajer M, Shata MT. Hepatitis E and pregnancy: understanding the pathogenesis. Liver Int 2008;
28(9):1190-1199. 5 Kamar N, Izopet J, Dalton HR. Chronic hepatitis e virus infection and treatment. J Clin Exp
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 147/156
Hepatol 2013; 3(2):134-140. 6 le Coutre P, Meisel H, Hofmann J, Röcken C, Vuong G, Neuburger S, Hemmati P,
Dörken B, Arnold R.
Reactivation of hepatitis E infection in a patient with acute lymphoblastic leukaemia after allogeneic stem cell
transplantation. Gut 2009; 58(5):699- 702.
7 Ollier L, Bigaillon C, Tieulie N, Tesse S, Heudier P, Sanderson F, Giordanengo V, Nicand E, Fuzibet J-G.
[Hepatitis E initially serologically silent with prolonged evolution in a patient treated for a lymphoma]. Presse
Med 2009; 38(11):1700-1704. 8 Dalton HR, Bendall RP, Keane FE, Tedder RS, Ijaz S. Persistent carriage of
hepatitis E virus in patients with HIV infection. N Engl J Med 2009; 361(10):1025-1027. 9
Teshale EH, Hu DJ, Holmberg SD. The two faces of hepatitis E virus. Clin Infect Dis 2010; 51(
3):328-334. 10
Pavio N, Meng X-J, Renou C. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res
2010; 41(6):46. 11 Meng XJ, Purcell R, Halbur P, Lehman J, Webb D, Tsareva T, Haynes J, Thacker B, Emerson S.
A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci U S A 1997; 94(
18):9860-9865. 12 de Deus N, Peralta B, Pina S, Allepuz A, Mateu E, Vidal D, Ruiz-Fons F, Martín M, Gortázar C,
Segalés J. Epidemiological study of hepatitis E virus infection in European wild boars (Sus scrofa) in Spain. Vet
Microbiol 2008; 129(1-2):163-170. 13 Payne CJ, Ellis TM, Plant SL, Gregory AR, Wilcox GE. Sequence data
suggests big liver and spleen disease virus (BLSV) is genetically related to hepatitis E virus. Vet Microbiol
1999; 68(1-2):119-125. 14 Zhang X, Bilic I, Troxler S, Hess M. Evidence of genotypes 1 and 3 of avian hepatitis
E virus in wild birds. Virus Res 2017; 228:75-78. Drexler J, Seelen A, Corman V, Fumie Tateno A, Cottontail V,
Melim Zerbinati R, Gloza-Rausch F, Klose S, Adu-Sarkodie Y, Oppong S, Kalko E, Osterman A, Rasche A, Adam A,
Müller M, Ulrich R, Leroy E, Lukashev A, Drosten C. Bats worldwide carry hepatitis E virus-related viruses that
form a putative novel genus within the family Hepeviridae. J Virol 2012; 86(17):9134-9147. 16 17 Batts W, Yun
S, Hedrick R, Winton J. A novel member of the family Hepeviridae from cutthroat trout (Oncorhynchus clarkii).
Virus Res 2011; 158(1-2):116-123.
Johne R, Heckel G, Plenge-Bönig A, Kindler E, Maresch C, Reetz J, Schielke A, Ulrich R. Novel hepatitis E
virus genotype in Norway rats, Germany. Emerg Infect Dis 2010; 16(9):1452-1455.
18 19 Raj V, Smits S, Pas S, Provacia L, Moorman-Roest H, Osterhaus A, Haagmans B. Novel hepatitis E virus in
ferrets, the Netherlands. Emerg Infect Dis 2012; 18(8):1369-1370. Zhao C, Ma Z, Harrison TJ, Feng R, Zhang C,
Qiao Z, Fan J, Ma H, Li M, Song A, Wang Y. A novel genotype of hepatitis E virus prevalent among farmed
rabbits in China. J Med Virol 2009; 81(8):1371-1379. 20 21 Lin J, Norder H, Uhlhorn H, Belak S, Widen F. Novel
hepatitis E like virus found in Swedish moose. J Gen Virol 2014; 95(Pt 3):557-570.
Nakamura M, Takahashi K, Taira K, Taira M, Ohno A, Sakugawa H,
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 148/156
Arai M, Mishiro S.
Hepatitis E virus infection in wild mongooses of Okinawa, Japan: Demonstration of anti- HEV antibodies and a
full-genome nucleotide sequence. Hepatol Res 2006; 34(
3):137- 140. 22
Matsuura Y, Suzuki M, Yoshimatsu K, Arikawa J, Takashima I, Yokoyama M, Igota H, Yamauchi K, Ishida S,
Fukui D, Bando G, Kosuge M, Tsunemitsu H, Koshimoto C, Sakae K, Chikahira M, Ogawa S, Miyamura T, Takeda N,
Li TC. Prevalence of antibody to hepatitis E virus among wild sika deer, Cervus nippon, in Japan. Arch Virol
2007; 152(7):1375-1381. 23 24 Sridhar S, Teng JLL, Chiu TH, Lau SKP, Woo PCY. Hepatitis E Virus Genotypes
and Evolution: Emergence of Camel Hepatitis E Variants. Int J Mol Sci 2017; 18(4):869. Sanford BJ, Emerson
SU, Purcell RH, Engle RE, Dryman BA, Cecere TE, Buechner- Maxwell V, Sponenberg DP, Meng XJ. Serological
Evidence for a Hepatitis E Virus- Related Agent in Goats in the United States. Transbound Emerg Dis 2012;
60(6):538- 545. 25 Arankalle V, Joshi M, Kulkarni A, Gandhe S, Chobe L, Rautmare S, Mishra A, Padbidri V.
Prevalence of anti-hepatitis E virus antibodies in different Indian animal species. J Viral Hepat 2001; 8(3):223-
227.
26 Huang F, Li Y, Yu W, Jing S, Wang J, Long F, He Z, Yang C, Bi Y, Cao W, Liu C, Hua X, Pan Q. Excretion of
infectious hepatitis E virus into milk in cows imposes high risks of zoonosis. Hepatology 2016; 64(2):350-359.
Yan B, Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang M, Xu A.
Hepatitis E Virus in Yellow Cattle, Shandong, Eastern China.
Emerg Infect Dis 2016; 22(12):2211- 2212. 28 Vercouter AS, Sayed IM, Lipkens Z, De Bleecker K, De Vliegher S,
Colman R, Koppelman M, Supre K, Meuleman P. Absence of zoonotic hepatitis E virus infection in Flemish dairy
cows. Int J Food Microbiol 2018; 281:54-59. 29 Baechlein C, Becher P. No evidence for zoonotic hepatitis E
virus infection through dairy milk in Germany. Hepatology 2017; 65(1):394-395. 30 Norder H, Karlsson M,
Mellgren A, Konar J, Sandberg E, Lasson A, Castedal M, Magnius L, Lagging M. Diagnostic Performance of Five
Assays for Anti-Hepatitis E Virus IgG and IgM in a Large Cohort Study. J Clin Microbiol 2016; 54(3):549-555. 31
Johne R, Plenge-Bönig A, Hess M, Ulrich R, Reetz J, Schielke A. Detection of a novel hepatitis E-like virus
in faeces of wild rats using a nested broad-spectrum RT-PCR. J Gen Virol 2010; 91 (Pt 3):750-
758. 32 Cossaboom C, Cordoba L, Dryman B, Meng X-J. Hepatitis E virus in rabbits, Virginia, USA. Emerg Infect
Dis 2011; 17(11):2047-2049. 33 Emerson SU, Nguyen HT, Torian U, Burke D, Engle R, Purcell RH. Release of
genotype 1 hepatitis E virus from cultured hepatoma and polarized intestinal cells depends on open reading
frame 3 protein and requires an intact PXXP motif. J Virol 2010; 84(18):9059- 9069. 34
Shukla P, Nguyen HT, Torian U, Engle RE, Faulk K, Dalton HR, Bendall RP, Keane FE, Purcell RH, Emerson SU.
Cross-species infections of cultured cells by hepatitis E virus and discovery of an infectious virus-host
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 149/156
recombinant. Proc Natl Acad Sci U S A 2011; 108(6):2438-
2443. 35
Wang L, Cao D, Wei C, Meng XJ, Jiang X, Tan M.
A dual vaccine candidate against norovirus and hepatitis E virus. Vaccine 2014; 32(4):445-452. 36 Xia M, Wei C,
Wang L, Cao D, Meng XJ, Jiang X, Tan M.
A trivalent vaccine candidate against hepatitis E virus, norovirus, and astrovirus. Vaccine 2016; 34(7):905-913.
37 Cordoba L, Feagins AR, Opriessnig T, Cossaboom CM, Dryman BA, Huang YW, Meng XJ. Rescue of a
genotype 4 human hepatitis E virus from cloned cDNA and characterization of intergenotypic chimeric viruses
in cultured human liver cells and in pigs. J Gen Virol 2012; 93(Pt 10):2183-2194. 38 Kenney SP, Meng XJ. The
lysine residues within the human ribosomal protein S17 sequence naturally inserted into the viral nonstructural
protein of a unique strain of hepatitis E virus are important for enhanced virus replication. J Virol 2015;
89(7):3793- 3803. 39 Zhang Y, Gong W, Zeng H, Wang L. Genetic Evolution of Hepatitis E Virus. Adv Exp Med
Biol 2016; 948:73-88. Li L, Deng X, Mee ET, Collot-Teixeira S, Anderson R, Schepelmann S, Minor PD, Delwart E.
Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent. J Virol
Methods 2015; 213:139-146. 41 Sadeghi M, Kapusinszky B, Yugo DM, Phan TG, Deng X, Kanevsky I, Opriessnig
T, Woolums AR, Hurley DJ, Meng XJ, Delwart E. Virome of US bovine calf serum. Biologicals 2017; 46:64-67. 42
43 44 McLean BN, Gulliver J, Dalton HR. Hepatitis E virus and neurological disorders. Pract Neurol 2017;
17(4):282-288. Yugo DM, Meng XJ. Hepatitis E virus: foodborne, waterborne and zoonotic transmission. Int J
Environ Res Public Health 2013; 10(10):4507-4533. Feagins A, Opriessnig T, Guenette D, Halbur P, Meng X.
Inactivation of infectious hepatitis E virus present in commercial pig livers sold in local grocery stores in the
United States. Int J Food Microbiol 2008; 123(1-2):32-37. 45 Colson P, Borentain P, Queyriaux B, Kaba M, Moal
V, Gallian P, Heyries L, Raoult D, Gerolami R. Pig liver sausage as a source of hepatitis E virus transmission to
humans. J Infect Dis 2010; 202(6):825-834. 46
Berto A, Backer JA, Mesquita JR, Nascimento MS, Banks M, Martelli F, Ostanello F, Angeloni G,
Di Bartolo I, Ruggeri FM, Vasickova P, Diez-Valcarce M, Hernandez M, Rodriguez-Lazaro D, van der Poel WH.
Prevalence and transmission of hepatitis E virus in domestic swine populations in different European countries.
BMC Res Notes 2012; 5:
190. 47 48 Takahashi M, Okamoto H. Features of hepatitis E virus infection in humans and animals in Japan.
Hepatol Res 2014; 44(1):43-58. Geng JB, Fu HW, Wang L, Wang XJ, Guan JM, Chang YB, Li LJ, Zhu YH, Zhuang
H, Liu QH, Peng XC.
[Hepatitis E virus (HEV) genotype and the prevalence of anti-HEV in
8 species of animals in the suburbs of Beijing].
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 150/156
Zhonghua Liu Xing Bing Xue Za Zhi 2010; 31(1):
47-50. 49
Blacksell SD, Myint KS, Khounsy S, Phruaravanh M, Mammen MP, Jr., Day NP, Newton PN. Prevalence of
hepatitis E virus antibodies in pigs: implications for human infections in village-based subsistence pig farming in
the Lao PDR. Trans R Soc Trop Med Hyg 2007;
101(3):305-307. 50
Seminati C, Mateu E, Peralta B, de Deus N, Martin M. Distribution of hepatitis E virus infection and its
prevalence in pigs on commercial farms in Spain. Vet J 2008; 175(1):130-132.
51 Thornton CG, Passen S. Inhibition of PCR ampli�cation by phytic acid, and treatment of bovine fecal
specimens with phytase to reduce inhibition. J Microbiol Methods 2004; 59(1):43-52.
Rapp D. DNA extraction from bovine faeces: current status and future trends. J Appl Microbiol 2010;
108(5):1485-1493.
53 Bilic I, Jaskulska B, Basic A, Morrow C, Hess M. Sequence analysis and comparison of avian hepatitis E
viruses from Australia and Europe indicate the existence of different genotypes. J Gen Virol 2009; 90(Pt 4):863-
873. 54 Billam P, Pierson F, Li W, LeRoith T, Duncan R, Meng X. Development and validation of a negative-
strand-speci�c reverse transcription-PCR assay for detection of a chicken strain of hepatitis E virus:
identi�cation of nonliver replication sites. J Clin Microbiol 2008; 46(8):2630-2634. TABLES Table 1. Prevalence
of IgG binding to HEV in cattle from different geographic regions of the United States Year Herd Locationa No
of cows samples collected sampled Percent (%) Range of positive for Individual IgG anti-HEV S/C.O. valuesb
TX, OK, NM SD, ND, MT, WY SD, IA, NE GA VA Dairy 2010 352 2010 250 2010 130 2009 38 2012 223 17.84 0.16-
21.5 19.60 0.15-26.5 22.30 0.15-14.4 68.4 0.18-24.8 16.1 0.07-7.56 aSamples listed by geographic locations as
follows:
Texas (TX), Oklahoma (OK), New Mexico (NM), South Dakota (SD),
North Dakota (ND), Montana (MT), Wyoming (WY), Iowa (IA), Nebraska (NE), Georgia (GA), and Virginia (VA).
bAll sera were tested by an established commercial ELISA assay (Wantai ELISA kit). Individual ELISA S/C.O.
value >1.0 is considered positive. Table 2. Serological evidence of HEV IgG in dams and their corresponding
calf from the prospective study in a university dairy herd Date of Dam S/C.O. Calf S/C.O. Dam ID sample anti-
HEV Calf ID anti-HEV collectionb valueb value at birthc Seroconversion of calf to IgG anti- HEVcd 4832 4855
4517 4682a 4810a 4854 4852 4686 4344 4700a 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12 11/7/12
11/7/12 11/7/12 11/7/12 0.4879 0.3532 0.263 5.668a 2.5926a 0.3444 0.693 0.4826 0.5624 7.5513a 5078d
5082d 5083d 5086d 5091d 5079 5080 5081 5084 5088 0.2070 0.1925 0.1590 0.5790 0.2248 0.1850 0.2217
0.1632 0.2008 0.3733 Yes Yes Transient Transient Yes No No No No No a Dams and their individual S/C.O.
values considered positive for IgG recognizing HEV. bEach of the calves was born between November 4th and
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 151/156
November 25th, 2012 with the Dams sampled within 2 weeks of the expected calving dates. cIgG anti-HEV
ELISA O.D. (optical density) values reported as a ratio of the sample to the average of three negative controls
plus 0.12 as instructed by the commercial Wantai ELISA assay. Individual ELISA S/C.O. >1.0 is considered
positive. dCalves seroconverted to HEV by producing IgG during the course of the prospective study. Two
calves (no. 5083, and 5086) only transiently seroconverted for only 1 or 2 weeks. Table 3. Neutralizing
capability of selected bovine serum samples from calves on the infectivity of a genotype 3 human HEV
(Kernow P6 strain) in HepG2/C3A human liver cells Bovine Serum ID and controls Date of sample collection
ELISA O.D. value Individual % Decrease S/C.O. in HEV value infectivitya Sample neutralizing antibody titer PBS
Chimp 1313 5078 5082 5082 N/A N/A 1/14/13 12/5/12 1/10/13
N/A N/A N/A N/A 0. 411 2.658 0.
340 2.270 3.125 20.851 0 91.87 48.56 46.9 49.28 N/A N/A 1:16 1:4 1:16 aAll bovine sera were tested in
dilutions 1:10, 1:100 and 1:1000, and were also titered in serial dilutions from 1:2 to 1:8192 in a serum virus
neutralization assay. Chimp 1313 is a hyperimmune HEV antisera as a positive control with at least 105 IgG
ELISA titer against HEV from a chimpanzee experimentally-infected with HEV. Supplementary Table 1. Oligo
primers used for the detection of HEV RNA in fecal and serum samples by broad-spectrum nested RT-PCR
assays Primer IDa Sequence Tm Size (bp) Pan F1 Pan R1 Pan F2 Pan R2 USRAB DEG F1 USRAB DEG R1
USRAB DEG F2 USRAB DEG R2 ORF2 BOVF1 ORF2 BOVR1 ORF2 BOVF2 ORF2 BOVR2 ESP MOOSE F EAP
MOOSE R BATHEVF4228 BATHEVR4598 BATHEVR4565 5’-TCGCGCATCACMTTYTTCCARA-3’ 5’-
GCCATGTTCCAGACDGTRTTCCA-3’ 5’-TGTGCTCTGTTTGGCCNTGGTTYMG-3’ 5’-
CCAGGCTCACCRGARTGYTTCTTCCA-3’ 5’-GCMACACGKTTYATGAARGA-3’ 5’-ACYTTRGACCATCVAGRGARC-3’
5’-GCTGAYACRCTTCTYGGYG-3’ 5’-TGAMGGRGTRGGYGRTCYTG-3’ 5’-GGBCTNCCGACAGAATTRAT-3’ 5’-
TRCCHGCTTCCCAGRAGGAV-3’ 5’-CYGTYGTSTCRGCCAATGG-3’ 5’-GWGWAAASCCAMARMACATCA-3’ 5’-
CATGGTAAAGTGGGTCAGGGTAT-3’ 5’-AGGGTGCCGGGCTCGCCGGA-3’ 5’-ACYTTYTGTGCYYTITTT
GGTCCITGGTT-3’ 5’-GCCATGTTCCAGAYGGTGTTCCA-3’ 5’-CCGGGTTCRCCIGAGTGTTTCTTCCA-3’ 58.6 59.0
62.7 63.4 53.4 55.8 56.2 58.7 54.0 59.7 57.7 52.4 56.4 71.7 470 470 330 330 200 200 200 200 406 406 225
225 383 383 63.8 371/338 60.8 371 65.2 338 a F1, F2, R1, and R2 indicated �rst round forward, second round
forward, �rst round reverse, second round reverse, respectively. FIGURES Fig.1. Seroconversion to IgG anti-HEV
in calves in a closed university dairy herd in Virginia in a prospective study. Ten newborn calves born to both
IgG anti-HEV seropositive and seronegative dams were monitored for evidence of HEV infection from the day
of birth to 6 months of age. The weekly serum samples from all calves were tested by the commercial Wantai
ELISA assay for IgG anti-HEV. (A): Calves tested negative for IgG anti-HEV in the prospective study; (B): Calves
tested positive for IgG anti-HEV in the prospective study. The speci�c signal (individual ELISA O.D.) values were
collected and plotted as S/C.O.
(Y-axis) as a function of the ages of the
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 152/156
animals (days after birth) indicating when the samples were collected. The ELISA cut- off value indicating
seropositivity to IgG anti-HEV is indicated as a dotted line at 1.0 based on the commercial Wantai ELISA assay
standard. Fig. 2. Serum levels of liver enzymes over time in the prospective study in calves from the time of
birth to 6 months of age. Serum samples were collected weekly from each calf beginning with the day of birth
and continuing prospectively until approximately 6 months of age. Serum levels of liver enzymes including (A)
aspartate aminotransferase (AST), (B) glutamate dehydrogenase (GLDH), and (C) gamma-glutamyl transferase
(GGT) were measured in each serum samples at the Cornell University Animal Health Diagnostic Center.
Normal limits of each enzyme were provided with the analysis based on the diagnostic laboratory’s standards
for each speci�c test, which are indicated on each scatterplot graph as a dotted line. Each sample indicates an
individual calf serum sample for each time point and are expressed as the mean +/- SEM. Analysis was
completed using two-way ANOVA. Fig. 3. Correlation between seroconversion and serum levels of GLDH in
serum samples collected prospectively from calves from the time of birth to 6 months of age. Calves (A)
#5078, (B) 5082, (C) 5083, (D) 5086, and (E) 5091 seroconversion to IgG anti-HEV correlated with the
elevations in serum levels of GLDH. The speci�c signal (individual ELISA O.D.) values were plotted as S/C.O.
(left
y-axis) as a function of the age of the
animal (days after birth). The ELISA cut-off value indicating seropositivity to IgG anti-HEV is indicated as a
dotted line at 1.0 based on the commercial Wantai ELISA assay standard. The serum levels of GLDH were
plotted (right
y-axis) as a function of the age of the
animal (days after birth). The upper normal limit was provided with the analysis based on the diagnostic
laboratory’s standard for GLDH in bovine species and indicated as the dotted line at 83 u/L. Chapter VI
GENERAL DISCUSSION As discussed throughout the dissertation research, many underlying mechanisms of
HEV infection including pathogenesis of disease, immune dynamics during the acute stage, transmission and
reservoir species, and the host factors and virus determinants leading to progressive disease, are not well
understood. The zoonotic risk of HEV is well established (1-3); however, the ever- expanding host range and
identi�cation of new animal reservoir species pose a signi�cant public health concern. Additionally, current
animal models for HEV research do not adequately replicate the course of infection seen in infections in
humans (4), nor do they develop the level of pathogenicity and progression of disease seen in
immunocompromised (5, 6) and pregnant populations (7). The �rst objective of the dissertation research was
to establish an immunoglobulin (Ig) heavy chain JH (-/-) knockout gnotobiotic pigs using CRISPR/Cas9
technology. This model aimed to deplete the B-lymphocyte population resulting in an inability to elicit a
humoral response. The resultant gnotobiotic piglets with challenged with a genotype 3 human strain of HEV
(US-2). The dynamics of acute HEV infection were then systematically determined in this unique and novel
gnotobiotic pig model in an attempt to better mimic the course of acute HEV infections observed in humans.
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 153/156
As the natural host for genotypes 3 and 4 (2, 8, 9) HEV infections in humans, the outbred conventional piglet
model has long been used in HEV research to study HEV biology and cross-species infection (2, 10, 11).
However, infection with HEV in conventional pigs is clinically asymptomatic with only mild to moderate hepatic
lesions (12, 13). Compared to the wild-type gnotobiotic piglets, the frequencies of B-lymphocytes in Ig heavy
chain JH (-/-) knockout pigs were signi�cantly lower despite retaining normal levels of other innate and
adaptive T-lymphocyte cell populations. After infection with HEV, the wild-type gnotobiotic piglets had higher
viral RNA loads in feces and sera when compared with the JH (-/-) knockout piglets, which suggests that the Ig
heavy chain JH (-/-) knockout pigs decreased the level of HEV replication within the host. Both the HEV-
infected wild-type and JH (-/-) knockout gnotobiotic piglets induced more pronounced lymphoplasmacytic
hepatitis and hepatocellular necrosis lesions in the liver with discernible difference when compared with a
conventional pig model. The HEV-infected JH (-/-) knockout pigs had signi�cantly enlarged livers both grossly
and as a ratio of liver/body weight when compared with the PBS mock-infected groups. Additionally, the serum
level of the liver enzyme GGT was signi�cantly elevated in the HEV-infected JH (-/-) knockout pigs and may
indicate liver damage, since the predominant source of GGT is the biliary epithelium. Therefore, the novel
gnotobiotic piglet model is a valuable tool to aid in future studies into HEV pathogenicity, an aspect which has
been di�cult to reproduce in the available animal model systems, thus far. HEV has been genetically identi�ed
from more than one dozen animal species (14). Swine serve as the primary animal reservoir for zoonotic
genotypes 3 and 4 within the species Orthohepevirus A (15, 16) and are
de�nitively linked to human infections through zoonotic and foodborne transmission of HEV (17, 18). Recently
reported identi�cation of genotype 4 HEV in fecal samples of cows and excretion of virus into cow milk (19,
20) raises concerns regarding milk and beef safety. Contradictory reports from Europe (21, 22) failed to identify
evidence of HEV infection in dairy cows. Therefore, in the second project of the dissertation, the main objective
was to determine if cattle in the United States are infected with a bovine strain of HEV. We demonstrated
evidence of an HEV-related agent in cattle with a high overall level of seroprevalence at 20.4% and herd
seroprevalence rates ranging from 16.1-68.4% depending on geographic location. In a prospective animal
study, three of the 10 calves seroconverted to IgG against HEV and this antibody was capable of neutralizing
genotype 3 human HEV. Interestingly, the elevated serum levels of GLDH appeared to correlate with the peak of
seroconversion, which is suggestive of potential liver damage. The failure to provide de�nitive evidence of
virus in cattle using broad-spectrum RT-PCR assays and MiSeq deep sequencing technology suggests a
limitation in the interpretation of HEV serological data in species such as cattle. Additionally, without de�nitive
genetic identi�cation of virus in cattle, we must be cautious in speculating the role of cattle, if any, in HEV
transmission and potential zoonotic infection. In summary, much knowledge related to HEV infection,
pathogenesis, and progression of disease is currently lacking. A challenge in �lling these knowledge gaps lies
in the extensive genetic diversity of animal strains of HEV and the unresolved determination of all potential
reservoirs capable of transmitting virus to the human population. Additionally, the lack of an adequate cell
culture model for in vitro work and limited availability of commercial diagnostic assays for all strains of HEV
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 154/156
makes understanding the course of infection di�cult. As this dissertation research has presented, the
identi�cation of better animal models for research and the identi�cation of all animal reservoirs are key in fully
understanding HEV and its impacts on public health. All projects included in this dissertation provided many
unforeseen complications and identi�ed numerous limitations in this �eld. While some portions of this
dissertation work carried a negative result connotation, the projects provided groundwork for follow-up studies
in the areas of novel strain identi�cation and transmission, immune responses of HEV, and novel animal model
development. Future directions of this work lead directly to the use of the gnotobiotic piglet model in a
prolonged experimental period study
in order to ascertain an understanding of the full course of infection.
This research will provide an understanding of the immune dynamics during the acute and chronic stages of
infection. With the ability to develop classical liver lesions seen in humans, the gnotobiotic piglet will �ll much-
needed knowledge gaps in HEV research. Additionally, the lack of a bovine strain of HEV identi�ed during the
course of this work, points to the need to develop better diagnostic assays with consistent analysis for HEV.
Prior con�icting studies from several countries around the world, lead the scienti�c community to consider
bovine as a potential reservoir for HEV. However, this study de�nitively determines that cattle herds in the
United States do not carry a bovine strain of HEV. Overall, the projects in this dissertation answer important
questions for the scienti�c community and will be directly linked to HEV studies carried out in our laboratory.
REFERENCES 1. Meng X-J. 2011. From barnyard to food table: the omnipresence of hepatitis E virus and risk
for zoonotic infection and food safety. Virus Res 161:23-30. 2. Meng XJ. 2010. Hepatitis E virus: animal
reservoirs and zoonotic risk. Vet Microbiol 140:256-265. 3. Kasorndorkbua C, Guenette D, Huang F, Thomas P,
Meng XJ, Halbur P. 2004. Routes of transmission of swine hepatitis E virus in pigs. J Clin Microbiol 42:5047-
5052. 4. Yugo DM, Cossaboom CM, Meng XJ. 2014. Naturally occurring animal models of human hepatitis E
virus infection. ILAR J 55:187-199. 5. Singh A, Seth R, Gupta A, Shalimar, Nayak B, Acharya SK, Das P. 2016.
Chronic hepatitis E - an emerging disease in an immunocompromised host. Gastroenterol Rep (Oxf)
doi:10.1093/gastro/gow024. 6. Haagsma EB, van den Berg AP, Porte RJ, Benne CA, Vennema H, Reimerink JH,
Koopmans MP. 2008. Chronic hepatitis E virus infection in liver transplant recipients. Liver Transpl 14:547-553.
7. Navaneethan U, Al Mohajer M, Shata MT. 2008. Hepatitis E and pregnancy: understanding the pathogenesis.
Liver Int 28:1190-1199. 8. Meng XJ, Halbur P, Shapiro M, Govindarajan S, Bruna J, Mushahwar I, Purcell R,
Emerson S. 1998. Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. J
Virol 72:9714-9721. 9. Sanford BJ, Dryman BA, Huang YW, Feagins AR, Leroith T, Meng XJ. 2011. Prior infection
of pigs with a genotype 3 swine hepatitis E virus (HEV) protects against subsequent challenges with
homologous and heterologous genotypes 3 and 4 human HEV. Virus Res 159:17-22. 10. Cao D, Huang Y-W,
Meng X-J. 2010. The nucleotides on the stem-loop RNA structure in the junction region of the hepatitis E virus
genome are critical for virus replication. J Virol 84:13040-13044. 11. Cao D, Cao QM, Subramaniam S, Yugo
DM, Heffron CL, Rogers AJ, Kenney SP, Tian D, Matzinger SR, Overend C, Catanzaro N, LeRoith T, Wang H,
Pineyro P, Lindstrom N, Clark-Deener S, Yuan L, Meng XJ. 2017. Pig model mimicking chronic hepatitis E virus
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 155/156
infection in immunocompromised patients to assess immune correlates during chronicity. Proc Natl Acad Sci
U S A 114:6914-6923. 12. Williams TP, Kasorndorkbua C, Halbur PG, Haqshenas G, Guenette DK, Toth TE, Meng
XJ. 2001. Evidence of extrahepatic sites of replication of the hepatitis E virus in a swine model. J Clin Microbiol
39:3040-6. 13. Emerson S, Purcell R. 2003. Hepatitis E virus. Rev Med Virol 13:145-154. 14. Meng XJ. 2016.
Expanding Host Range and Cross-Species Infection of Hepatitis E Virus. PLoS Pathog 12:e1005695. 15. Pavio
N, Meng X-J, Renou C. 2010. Zoonotic hepatitis E: animal reservoirs and emerging risks. Vet Res 41:46. 16.
Takahashi M, Nishizawa T, Miyajima H, Gotanda Y, Iita T, Tsuda F, Okamoto H. 2003. Swine hepatitis E virus
strains in Japan form four phylogenetic clusters comparable with those of Japanese isolates of human
hepatitis E virus. The Journal of general virology 84:851-862. 17. Feagins AR, Opriessnig T, Guenette DK, Halbur
PG, Meng XJ. 2007. Detection and characterization of infectious Hepatitis E virus from commercial pig livers
sold in local grocery stores in the USA. J Gen Virol 88:912-7. 18. Colson P, Borentain P, Queyriaux B, Kaba M,
Moal V, Gallian P, Heyries L, Raoult D, Gerolami R. 2010. Pig liver sausage as a source of hepatitis E virus
transmission to humans. J Infect Dis 202:825-834. 19. Huang F, Li Y, Yu W, Jing S, Wang J, Long F, He Z, Yang C,
Bi Y, Cao W, Liu C, Hua X, Pan Q. 2016. Excretion of infectious hepatitis E virus into milk in cows imposes high
risks of zoonosis. Hepatology 64:350-359. 20. Yan B, Zhang L, Gong L, Lv J, Feng Y, Liu J, Song L, Xu Q, Jiang
M, Xu A. 2016. Hepatitis E Virus in Yellow Cattle, Shandong, Eastern China. Emerg Infect Dis 22:2211- 2212. 21.
Vercouter AS, Sayed IM, Lipkens Z, De Bleecker K, De Vliegher S, Colman R, Koppelman M, Supre K, Meuleman
P. 2018. Absence of zoonotic hepatitis E virus infection in Flemish dairy cows. Int J Food Microbiol 281:54-59.
22. Baechlein C, Becher P. 2017. No evidence for zoonotic hepatitis E virus infection through dairy milk in
Germany. Hepatology 65:394-395. 23. Halbur PG, Kasorndorkbua C, Gilbert C, Guenette D, Potters MB, Purcell
RH, Emerson SU, Toth TE, Meng XJ. 2001. Comparative pathogenesis of infection of pigs with hepatitis E
viruses recovered from a pig and a human. J Clin Microbiol 39:918-923. 24. Meng XJ, Purcell R, Halbur P,
Lehman J, Webb D, Tsareva T, Haynes J, Thacker B, Emerson S. 1997. A novel virus in swine is closely related
to the human hepatitis E virus. Proc Natl Acad Sci U S A 94:9860-9865. 25. Feagins A, Opriessnig T, Huang Y,
Halbur P, Meng XJ. 2008. Cross-species infection of speci�c-pathogen-free pigs by a genotype 4 strain of
human hepatitis E virus. J Med Virol 80:1379-1386. 26. Feagins AR, Cordoba L, Sanford BJ, Dryman BA, Huang
YW, LeRoith T, Emerson SU, Meng XJ. 2011. Intergenotypic chimeric hepatitis E viruses (HEVs) with the
genotype 4 human HEV capsid gene in the backbone of genotype 3 swine HEV are infectious in pigs. Virus Res
156:141-146. 27. Shukla P, Nguyen HT, Faulk K, Mather K, Torian U, Engle RE, Emerson SU. 2012. Adaptation of
a genotype 3 hepatitis E virus to e�cient growth in cell culture depends on an inserted human gene segment
acquired by recombination. J Virol 86:5697-5707. 28. Shukla P, Nguyen HT, Torian U, Engle RE, Faulk K, Dalton
HR, Bendall RP, Keane FE, Purcell RH, Emerson SU. 2011. Cross-species infections of cultured cells by hepatitis
E virus and discovery of an infectious virus-host recombinant. Proc Natl Acad Sci U S A 108:2438-2443. 29.
Nguyen HT, Torian U, Faulk K, Mather K, Engle RE, Thompson E, Bonkovsky HL, Emerson SU. 2012. A naturally
occurring human/hepatitis E recombinant virus predominates in serum but not in faeces of a chronic hepatitis
E patient and has a growth advantage in cell culture. J Gen Virol 93:526-530. 30. Meng X, Halbur P, Haynes J,
Tsareva T, Bruna J, Royer R, Purcell R, Emerson S. 1998. Experimental infection of pigs with the newly identi�ed
12/19/2018 Summary Report
https://app.ithenticate.com/en_us/report/42517373/summary 156/156
swine hepatitis E virus (swine HEV), but not with human strains of HEV. Arch Virol 143:1405-1415. 31. Meng
XJ, Halbur PG, Shapiro MS, Govindarajan S, Bruna JD, Mushahwar IK, Purcell RH, Emerson SU. 1998. Genetic
and experimental evidence for cross-species infection by swine hepatitis E virus. J Virol 72:9714-9721. 32.
Huang YW, Haqshenas G, Kasorndorkbua C, Halbur PG, Emerson SU, Meng XJ. 2005. Capped RNA transcripts
of full-length cDNA clones of swine hepatitis E virus are replication competent when transfected into Huh7
cells and infectious when intrahepatically inoculated into pigs. J Virol 79:1552-1558. 16. 29. 41. 56. 69. 81. 93.
15 27 40 52 1 2 4 6 7 8 10 11 12 13 14 15 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80
81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111
112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136
137 138 139 140 141 142 143 144 145 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162
163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187
188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204
top related