reduced activity of atp synthase in mitochondria causes
Post on 16-Oct-2021
9 Views
Preview:
TRANSCRIPT
ORIGINAL ARTICLE
Reduced activity of ATP synthase in mitochondria causescytoplasmic male sterility in chili pepper
Jinjie Li • Devendra Pandeya • Yeong Deuk Jo •
Wing Yee Liu • Byoung-Cheorl Kang
Received: 8 October 2012 / Accepted: 22 November 2012 / Published online: 30 December 2012
� Springer-Verlag Berlin Heidelberg 2012
Abstract Cytoplasmic male sterility (CMS) is a mater-
nally inherited trait characterized by the inability to produce
functional pollen. The CMS-associated protein Orf507
(reported as Orf456 in previous researches) was previously
identified as a candidate gene for mediating male sterility in
pepper. Here, we performed yeast two-hybrid analysis to
screen for interacting proteins, and found that the ATP
synthase 6 kDa subunit containing a mitochondrial signal
peptide (MtATP6) specifically interacted with Orf507. In
addition, the two proteins were found to be interacted in vivo
using bimolecular fluorescence complementation (BiFC)
and co-immunoprecipitation (Co-IP) assays. Further func-
tional characterization of Orf507 revealed that the encoded
protein is toxic to bacterial cells. Analysis of tissue-specific
expression of ATP synthase 6 kDa showed that the tran-
scription level was much lower in anthers of the CMS line
than in their wild type counterparts. In CMS plants, ATP
synthase activity and content were reduced by more than half
compared to that of the normal plants. Taken together, it can
be concluded that reduced ATP synthase activity and ATP
content might have affected pollen development in CMS
plants. Here, we hypothesize that Orf507 might cause
MtATP6 to be nonfunctional by changing the latter’s con-
formation or producing an inhibitor that prevents the normal
functioning of MtATP6. Thus, further functional analysis of
mitochondrial Orf507 will provide insights into the mecha-
nisms underlying CMS in plants.
Keywords ATP synthase � Capsicum � Cytoplasmic male
sterility � Functional analysis of Orf507 � Protein–protein
interaction
Abbreviations
BiFC Bimolecular fluorescence complementation
CMS Cytoplasmic male sterility
Co-IP Co-immunoprecipitation
MtATP6 ATPase 6 kDa subunit
MRR Mitochondrial retrograde regulation
ORF Open reading frame
Y2H Yeast two hybrid
Introduction
Cytoplasmic male sterility (CMS) is characterized by
maternally inherited defects in functional pollen develop-
ment, although vegetative development remains unaffected.
J. Li and D. Pandeya contributed equally to this work.
J. Li � D. Pandeya � Y. D. Jo � W. Y. Liu � B.-C. Kang (&)
Department of Plant Science, Plant Genomics and Breeding
Institute, and Research Institute of Agriculture and Life
Sciences, College of Agricultural Sciences,
Seoul National University, Seoul, Republic of Korea
e-mail: bk54@snu.ac.kr
Y. D. Jo
e-mail: unifaith@hanmail.net
J. Li
Key Laboratory of Crop Genomics and Genetic Improvement
of Ministry of Agriculture and Beijing Key Lab of Crop Genetic
Improvement, China Agriculture University, 100094 Beijing,
China
D. Pandeya
Institute of Plant Genomics and Biotechnology, Texas A&M
University, College Station, Texas 77843, USA
W. Y. Liu
School of Biological Sciences, The University of Hong Kong,
5N01, Kadoorie Biological Sciences Building, Pokfulam Road,
Hong Kong, China
123
Planta (2013) 237:1097–1109
DOI 10.1007/s00425-012-1824-6
This type of sterility has been reported in more than 150 plant
species (Kaul 1988) and has been used for the commercial
production of F1 hybrid seeds. The failure of pollen devel-
opment in CMS is associated with mitochondrial open
reading frames (ORFs) resulting from mitochondrial DNA
rearrangement (Linke and Borner 2005; Chase 2007). Such
chimeric ORFs are composed of fragments derived from
other genes and/or non-coding sequences, leading to novel
functions in mitochondria. The mitochondrial ORF, urf13,
correlated with CMS-T (Texas type maize CMS) male-
sterile cytoplasm, was first identified in maize (Dewey et al.
1987). In petunia, the CMS-associated pcf gene is composed
of the N-terminal region of atp9, regions of cox2, and an
unidentified ORF (Young and Hanson 1987). To date, more
than 12 mitochondrial DNA regions associated with CMS
have been identified, and most of them encode subunits of
ATP synthase (Hanson and Bentolila 2004). The mito-
chondrial electron transport proteins are clustered into
complexes known as I-IV and F0F1–ATP synthase (complex
V). The F0F1–ATP synthase, a key enzyme for the synthesis
of ATP for cellular biosynthesis, comprises three parts: F0,
F1, and FA (Siedow and Umbach 1995; Xu et al. 2008). F1
carries the catalytic binding sites for ATP synthesis/hydro-
lysis, F0 is embedded in the inner membrane as a channel for
proton transport (Pedersen et al. 2000), and FA may be linked
between F1 and F0 (Wang et al. 2006). It has been reported
that alterations of mitochondrial-encoded subunits of the
F0F1–ATP synthase, such as ATP6, ATP8, and ATP9 of F0
and ATPA of F1, induce CMS in plants (Young and Hanson
1987; Hanson et al. 1989; Gagliardi and Leaver 1999; Sabar
et al. 2003; Yang et al. 2009). In sunflower, sterile plants
expressing mitochondrial ORF522 showed a specific
decreased ATP synthase activity (Sabar et al. 2003). The
chimeric mitochondrial ORF522 shares sequence similarity
with ORFB, a plant-type ATP8, which might result in
competition between two proteins leading to decreased
activity of the F0F1–ATP synthase complex (Sabar et al.
2003). In CMS-HongLian rice, sterility is associated with the
expression of atp6-OrfH79 which might disturb the forma-
tion of the F0F1–ATPase complex, resulting in decreased
activity of ATPase and pollen abortion (Zhang et al. 2007).
Besides these mitochondrial genes, nuclear genes encode
most of the subunits in this enzyme complex, for instance,
TaFAd and OsATP6 (Zhang et al. 2006; Xu et al. 2008).
However, little is known about the relationship of the nuclear
encoded subunits of F0F1–ATP synthase with CMS (Xu et al.
2008).
In plant mitochondrial genomes, it is still not clear how the
CMS-associated ORFs result in mitochondrial dysfunction
(Hanson and Bentolila 2004). One report demonstrated that
the mitochondrial OrfH79 from CMS-HongLian rice inhibits
the growth of Saccharomyces cerevisiae (Peng et al. 2009).
In addition, several studies have found that CMS-associated
genes, including T-maize urf13, sunflower Orf522, radish
Orf138 and BT-rice Orf79, encode peptides that are toxic to
E. coli (Dewey et al. 1987; Nikai et al. 1995; Duroc et al.
2005; Wang et al. 2006). However, the exact mechanism of
toxicity in E. coli has not been reported for any of the ORFs,
and how it relates to CMS is also unknown.
In a previous study, a CMS-associated gene, Orf456,
was identified as a strong candidate for determining the
male-sterile phenotype in pepper (Kim et al. 2007).
Recently, it has been found that Orf456 sequence might
have been resulted from a sequencing error at 30 end of
Orf507 (Gulyas et al. 2010). To discover the molecular
mechanism of Orf507 in male sterility in pepper, we uti-
lized yeast two-hybrid (Y2H), bimolecular fluorescence
complementation (BiFC) and co-immunoprecipitation
(Co-IP) analyses and found that ATPase 6 kDa subunit
(MtATP6) specifically interacts with Orf507. The results
reported here suggest that the interaction between Orf507
and MtATP6 affects the activity of ATP synthase, resulting
in a deficiency of ATP synthesis that might cause pollen
abortion in the CMS line. This is the first report that a
CMS-associated ORF interacts with a nuclear-encoded
ATP synthase subunit and leads to reduced ATP content.
Materials and methods
Plant material
Near-isogenic male sterile (Milyang A, CMS), maintainer
(Milyang B), and male fertile restorer (Milyang K) lines of
Capsicum annuum L. were used in this study. These plants
were kindly provided by J.H. Yoo (Monsanto, Chochiwon,
Korea).
Yeast two-hybrid analysis
The full-length Orf456 cDNA was cloned into the pBD
vector (HybriZAP�-2.1 Two-Hybrid Predigested Vector
Kit, Stratagene) and used as bait in a yeast two-hybrid
screen with a Capsicum cDNA library (pAD:cDNA con-
structs). pBD:Orf456 and pAD:cDNA library constructs
were cotransformed into YRG-2 yeast strains containing
the HIS3 and lacZ reporter genes according to the manu-
facturer’s protocol. Yeast two-hybrid analysis was per-
formed on selective media lacking leucine, tryptophan, and
histidine (-Trp/-Leu/-His). Empty vectors pBD and pAD
were used as negative controls, and interaction between
pBD:WT and pAD:WT (controls from the HybriZAP�-2.1
Two-Hybrid Predigested Vector Kit) were used as positive
controls. In addition, protein interactions were determined
by detection of the expression of lacZ via filter lift assays
following the manufacturer’s protocols.
1098 Planta (2013) 237:1097–1109
123
Physical interaction of Orf507 with MtATP6 was also
tested using yeast two-hybrid analysis. Full-length cDNAs
of Orf507 and MtATP6 were fused to the sequences
encoding the Gal4 activation domain (AD) and the Gal4
DNA binding domain (BD) in pDEST22 and pDEST32
(ProQuest; Invitrogen, Carlsbad, CA, USA). The constructs
were transformed into yeast strain Mav203. Yeast trans-
formation and analyses were performed using the ProQuest
Two-Hybrid System with Gateway Technology (Invitro-
gen). Yeast transformants were cultured on synthetic
complete medium (SC) lacking leucine (-Leu) and trypto-
phan (-Trp). After 60 h incubation at 30 �C, three colonies
were inoculated and grown at 30 �C for 17 h in SC-Leu-
Trp liquid medium. The next day, 15 ll of each cell culture
was dropped onto selection plates (-Leu/-Trp/-Ura) for
screening expression of reporter genes. Interactions were
analyzed based on the growth of yeast cells on the medium.
Bimolecular fluorescence complementation (BiFC)
assays
Nicotiana benthamiana plants were grown in a growth
chamber at 25 �C with a 16 h light/8 h dark cycle. For
bimolecular fluorescence complementation (BiFC) assays,
full-length sequences of MtATP6 and Orf507 were cloned
into pSPY-NE and pSPY-CE vectors and introduced into
Agrobacterium tumefaciens strain GV3101. Agrobacterium
was grown at 28 �C overnight in LB medium containing
antibiotics (50 mg/l kanamycin and 50 mg/l rifampicin).
Agrobacterium cells were pelleted, resuspended in infil-
tration media (10 mM MgCl2, 10 mM MES, 20 lM
acetosyringone), adjusted to 0.8 OD600, and incubated at
room temperature for at least 3 h. Agrobacterium carrying
pSPY-NE-Orf507 and pSPY-CE-MtATP6 or reverse con-
structs were mixed at a 1:1 ratio and infiltrated into
N. benthamiana leaves. The leaf sections were observed
via confocal microscopy (Delta Vision RT, Applied Pre-
cision) 4 days after infiltration.
Co-immunoprecipitation (Co-IP) analysis
Full-length Orf507 and MtATP6 cDNAs were individually
cloned into Gateway Topo vectors (Invitrogen) and trans-
ferred into PEG202 and PEG201 vectors, respectively, by
LR recombination reactions. After restriction digestion and
sequence confirmation, the plasmids were transformed into
Agrobacterium strain GV3101. The overnight culture was
incubated until the OD600 value reached 1, and the pellet was
resuspended in buffer containing 10 mM MgCl2 and 10 mM
acetosyringone. The cultures containing PEG201-MtATP6
and PEG202-Orf507 were mixed 1:1 (v/v) and infiltrated into
N. benthamiana leaves twice at a 12-h interval. The leaf
samples were harvested after 2 days of infiltration, and total
protein was isolated and incubated with protein A agarose
resin (Sigma-Aldrich, St. Louis, MO, USA) overnight. Anti-
HA antibody 1/1,000 (v/v) (Sigma-Aldrich) was added and
incubated overnight at 4 �C. The next day, the resin was
collected by centrifugation and washed three times. The
protein was eluted with 29 sample buffer after boiling at
95 �C for 5 min. The proteins were separated via SDS-
PAGE and immunoblotted with anti-FLAG antibody
1/1,000 (v/v) (Sigma-Aldrich).
Genetic mapping
Seventy individuals of the AC F2 population from C. ann-
uum cv. NuMex RNaky (RNaky) 9 C. chinense PI159234
(CA4) were used for mapping the MtATP6 locus. Infor-
mation about population and genetic map used in this study
was described by Livingstone et al. (1999). The genetic
map comprised 450 molecular markers which include SSR
and RFLP markers. Allele-specific markers with two mis-
matched reverse primers developed from the sequences of
MtATP6 from RNaky and CA4 were used in genotyping
(Table 1).
Quantitative real-time RT-PCR analysis
Total RNA was isolated from stems, leaves, ovules, and
anthers (obtained from floral buds which were 3–5 mm in
size) of Milyang A, B, and K using the Hybrid-RTM RNA
extraction kit (GeneAll Biotechnology, Seoul, Republic of
Korea) according to manufacturer’s description. cDNA
was synthesized from 2 lg of total RNA using the MMLV
reverse transcription kit (Promega, Madison, WI, USA).
After a fivefold dilution of the reverse transcription prod-
ucts, real-time PCR was performed according to the
methods of Kang et al. (2012) with minor modification
using gene-specific primer sets for Actin, ATP synthase
6 kDa subunit, and ATP synthase ß subunit (listed in
Table 1). The standard curves for each primer set were
generated by RT-PCR reactions in which serially diluted
(1:1, 1:5, 1:25, 1:125, and 1:625) cDNAs were used as
templates. Real-time PCR reactions were performed in
20 ll with 10 mM Tris–HCl (pH 8.3), 50 mM KCl,
1.5 mM MgCl2, 0.25 mM each dNTP, 5 pmol each primer,
1.25 lM Syto9 (Invitrogen), 5 ll diluted reverse tran-
scription products, and 1 unit rTaq polymerase (Takara,
Shiga, Japan) using a Roter-GeneTM 6000 thermocycler
(Corbett, Mortlake, Australia). Amplifications were carried
out under the following conditions: 95 �C for 4 min fol-
lowed by 55 cycles of 95 �C for 15 s, 57 �C for 15 s, and
72 �C. The relative expression levels for ATP synthase
6 kDa subunit and ATP synthase ß subunit to Actin were
calculated based on the Ct value analyzed in thrice-repe-
ated reactions of real-time PCR for each sample.
Planta (2013) 237:1097–1109 1099
123
Subcellular localization and in vivo interaction assays
The subcellular localization was performed according to Li
et al. (2010) with minor modification. The MtATP6–GFP
construct was introduced via particle gun bombardment into
onion epidermal cell layers on agar plates for transient gene
expression. After 20-h incubation at 25 �C, the epidermal
cells were stained with 50 nM of MitoTracker (Invitrogen),
a mitochondrial marker, for 30 min and then washed three
times with PBS buffer (137 mM NaCl, 1.4 mM KH2PO4,
4.3 mM Na2HPO4, 2.7 mM KCl, pH 7.4). Fluorescence was
observed using a confocal scanning microscope (Zeiss,
http://www.zeiss.com) with excitation wavelengths of
488 nm for GFP and 578 nm for MitoTracker.
Mitochondrial protein extraction and histochemical
staining
About 40 g of etiolated seedlings of Milyang A and B was
used for isolation of mitochondria as described by Kim
et al. (2007). Mitochondrial membranes isolated from
seedlings of Milyang A and B were resuspended by vor-
texing with protein extraction buffer (50 mM Tris–HCl
(pH 7.5), 100 mM NaCl, 10 mM MgCl2, 2 mM EDTA,
10 % glycerol, 0.5 % Triton X-100, 1 mM PMSF, 1 mM
DTT), and subsequently sonicated for 20 s. The homoge-
nates were centrifuged for 15 min at 1,600g at 4 �C. The
supernatants were recovered, and the protein concentration
was determined with the Protein Assay reagent (Bio-Rad,
Hercules, CA, USA). Equal amounts of protein samples
(200 lg) were loaded onto 12 % native polyacrylamide
gels, and gel electrophoresis was carried out at 4 �C. His-
tochemical staining was performed as described by Zerb-
etto et al. (1997). For complex V (ATPase) activity
determination, the gel was incubated overnight in 35 mM
Tris, 270 mM glycine, 14 mM MgSO4, 0.2 % Pb(NO3)2,
and 8 mM ATP, pH 7.8. For complex II (succinate dehy-
drogenase) activity determination, the gel was incubated
for 2 h with 4.5 mM EDTA, 10 mM KCN, 0.2 mM
phenazine methasulfate, 84 mM succinic acid, and 50 mM
NTB in 1.5 mM phosphate buffer (pH 7.4). All the gels
were fixed in 50 % methanol and 10 % acetic acid for
15 min and preserved in 10 % acetic acid. Gels were
photographed and band intensities were estimated as the
volume of optical density (OD)/ml squared of band area
using Image J software.
Mitochondrial ATP determination
Mitochondrial ATP was extracted from etiolated seedlings
of CMS and restorer lines in lysis buffer without protease
inhibitors (50 mM Tris–HCl, pH 7.5, 100 mM NaCl,
1 mM EDTA, 0.2 % TritonX-100, and 2 % glycerol). ATP
was quantified based on the requirement of luciferase for
ATP in producing light (emission maximum *560 nm at
pH 7.8) according to the manufacturer’s protocol (ATP
Determination Kit, Invitrogen). A standard curve of ATP
concentrations from 10 nM to1 lM was used in the
analysis.
Bacterial growth inhibition tests and protein expression
A full-length cDNA, 114 bp N-terminal region (1–114 bp),
276 bp middle region (115–390 bp), and 117 bp C-termi-
nal region (391–507 bp) of Orf507 were introduced into
Gateway-mediated expression vector pDEST17 (Invitro-
gen) by LR recombination reactions. The expression clones
were transformed into BL21, Rosseta2, RossetaDE3, and
Codonplus competent cells. Overnight grown cultures were
incubated at 37 �C till OD600 values of 0.6 were reached.
0.5 mM IPTG was added to the cultures, and they were
grown at 30 �C. OD values were measured at 30-min
Table 1 Primers used in this study
Gene Forward primer (50 ? 30) Reverse primer (50 ? 30)
RNaky MtATP6a atgaggcaattcgatccatggcc gttcttcctatcctccgctgcc
CA4 MtATP6a atgaggcaattcgatccatggcc gttcttcctatcctccgctgca
ATP synthase 6 kDa subunitb cccaacatgcgggattttatgca ggatgctactttaccagagacgg
ATP synthase beta subunitb gccttggtgatgacctcgtc gtgcccctggaaagtacgtc
Actinb cttctcggattcaccatggc gacttgcttttgcttttcctcg
Pro35S:ATP synthase-GFPc tctagaatgaggcaattcgatccatggcc ggatccgttcttatgcctctgcgcaaatcg
pSYNE:ATP synthasec tctagaatgaggcaattcgatccatggcc ggatccgttcttatgcctctgcgcaaatcg
pSYCE:CoxIVOrf507c tctagaatgcccaaaagtcccatgtatttc ggatccctcggttgctccattgttttttaga
a Allele-specific markers with two mismatched reverse primers used for genetic mapping of MtATP6. Nucleotides which are designed to be
mismatched to nuclear DNA sequence were underlinedb Gene-specific primer sets for RT-PCRc Primer sets used for vector construction
1100 Planta (2013) 237:1097–1109
123
intervals. The experiment was repeated three times. Protein
extraction and SDS-PAGE analysis were performed
according to the manufacturer’s (Invitrogen) protocol.
Results
Orf507 physically interacts with MtATP6
To isolate mitochondrial Orf456-interacting proteins, we
utilized yeast two-hybrid analysis. Yeast two-hybrid
screening of a Capsicum cDNA library, using pBD:Orf456
as bait, identified a number of interactors including a prey
clone encoding mitochondrial ATP synthase 6 kDa subunit
(MtATP6; Table 2). Yeast cells transformed with
pBD:Orf456 and pAD:MtATP6 grew normally on selec-
tion media (-Trp/-Leu/-His), indicating that Orf456
strongly interacts with MtATP6. When the interaction was
measured in a b-galactosidase activity filter assay, yeast
cells containing pBD:Orf456 and pAD:MtATP6 showed
strong b-galactosidase activity compared to the negative
control (Fig. 1a). These results demonstrated that MtATP6
specifically interacts with Orf456. Recently, it has been
found that Orf456 sequence might have been resulted from
a sequencing error at 30 end of Orf507 (Gulyas et al. 2010).
Hence, we tested whether Orf507 also interacts with
MtATP6 in yeast two-hybrid assays, and found that there
was a strong interaction between Orf507 and MtATP6
(Fig. 1b).
In vivo interaction between MtATP6 and Orf507 was
also tested using BiFC and Co-IP analyses. Yellow fluo-
rescence signals were observed in leaf tissues via confocal
microscopy when plants were transformed with Agrobac-
teria harboring MtATP6 and Orf507 fused to split halves of
the yellow fluorescent protein (Fig. 1c), indicating that
there is physical interaction between the proteins that
reconstitutes the fluoroprotein. Hence, BiFC assays support
a physical interaction between Orf507 and MtATP6.
For Co-IP analysis, MtATP6 was cloned into PEG201
(HA-tagged), and Orf507 was cloned into PEG202 (FLAG
tagged) vectors. Anti-HA antibody was used for resin
binding (immunoprecipitation), and anti-FLAG antibody
was used for immunoblot analysis. A signal was detected at
22 kDa by anti-FLAG antibody (Fig. 1d), which is possible
only if there is a complex including FLAG-Orf507 and
HA-MtATP6, brought about by the physical interaction of
MtATP6 and Orf507 proteins.
MtATP6 is a mitochondria-targeted protein encoded
in chromosome 4
We next sought to characterize the MtATP6 gene. To map
MtATP6 using a mapping population, we cloned MtATP6
from two parents, RNaky and CA4. The sequencing results
indicated that MtATP6 comprises 278 bp (RNaky) or
275 bp (CA4) with two exons and one intron. A three base
pair deletion was detected in the intron of MtATP6 from
CA4. Based on the sequence variation, allele-specific
markers with two mismatched reverse primers (Table 1)
were designed for genotyping. MtATP6 was mapped on a
region between two markers, NP1234 and TG132 on
chromosome 4 (Fig. 2a).
The Ipsort (http://ipsort.hgc.jp/), TargetP (http://www.
cbs.dtu.dk/services/TargetP/), and ChloroP (http://www.
cbs.dtu.dk/services/ChloroP/) programs were used to pre-
dict the cellular localization of Orf507 interactors, as
shown in Table 2. To confirm this prediction, MtATP6,
NAD-malate dehydrogenase, and ubiquitin carrier like
protein with predicted mitochondrial transit peptides at
their N-termini were fused to GFP. Transient expression of
GFP fusion proteins in the leaves of N. benthamiana was
observed by confocal microscopy. Only MtATP6-GFP
fusion protein was visualized in a mitochondrion-like
organelle (data not shown). To confirm this result, onion
epidermal cell layers were bombarded with the MtATP6-
GFP construct, and stained with MitoTracker. As shown in
Fig. 2b, the co-localization of MtATP6-GFP with mito-
chondrion-specific MitoTracker revealed that the MtATP6-
GFP fusion was found in the mitochondria.
The full-length MtATP6 cDNA consists of a 168 bp
ORF encoding 55 amino acids with a predicted molecular
mass of 6.7 kDa (GenBank Accession number: FJB22040).
Analysis of the predicted amino acid sequence of MtATP6
showed that it has a mitochondrial targeting sequence at the
N-terminus (predicted by PSORT) and one transmembrane
domain (predicted by ENSEMBLE; http://pongo.biocomp.
unibo.it/pongo). In the NCBI GenBank database, MtATP6
homologs were identified in monocotyledonous plants
such as rice (Oryza sativa) and barley (Hordeum vulgare),
as well as in dicotyledonous plants such as A. thaliana
and tomato (Solanum lycopersicum), indicating that
MtATP6 has been highly conserved among higher plants
(Fig. 2c, d).
The transcript of MtATP6 is upregulated in the CMS
line
The expression pattern of MtATP6 was analyzed using
real-time RT-PCR for tissues of Milyang A (CMS line),
Milyang B (maintainer line), and Milyang K (restorer line).
In Milyang A, the transcription level of MtATP6 was about
two times higher than those of other tissues including leaf,
stem, and ovule (Fig. 3a). However, expression of MtATP6
was significantly higher in anthers of Milyang B and
Milyang K (11.8- and 9.1-fold higher, respectively) com-
pared to those of Miyang A or other tissues of Milyang B
Planta (2013) 237:1097–1109 1101
123
and Milyang K. Except for a 2.9-fold difference between
Milyang B and Milyang K stems, expression levels of
MtATP6 were relatively similar in leaves and stems of
Milyang A, Milyang B, and Milyang K (Fig. 3b). Expres-
sion patterns of the gene encoding the b subunit of the F1
section of F0F1–ATP synthase among pepper lines and
tissues were similar to that of MtATP6 (Fig. 3c).
Mitochondria F1F0–ATP synthase activity and ATP
synthesis in the CMS line
The rice homolog of MtATP6 was previously identified as
a subunit of the mitochondrial F1F0–ATP synthase
(Heazlewood et al. 2003). To determine whether the
interaction between Orf507 and MtATP6 affects the
activity of the F1F0–ATP synthase, we tested the activity
of the native ATP synthase in mitochondria isolated from
etiolated seedlings of CMS and restorer lines. Histo-
chemical staining indicated that the activity of F1F0–ATP
synthase in the CMS line was less than half than that of
the restorer line (Fig. 4a). However, similar activity of
succinate dehydrogenase was found in CMS and restorer
lines (Fig. 4a).
To confirm whether mitochondrial ATP synthesis was
also affected in the CMS line, we measured the mito-
chondrial ATP content in etiolated seedlings of CMS and
restorer lines. Mitochondrial ATP levels were decreased in
the CMS line compared to the restorer line (Fig. 4b),
indicating a deficiency of ATP synthesis in CMS
mitochondria.
Bacterial growth inhibition and binding domains reside
in N-terminal and middle regions of Orf507
Previously, it was reported that the CMS-associated ORF
of rice, OrfH79, has a toxic effect in yeast cells (Peng et al.
2009). Here, we found that there was growth inhibition of
bacterial cells harboring Orf507 peptides (Fig. 5a). To
study which part of the Orf507 peptide has a toxic effect on
bacterial growth, partial sequences of Orf507 were cloned
into an expression vector and transformed into the bacteria.
The results showed that the N-terminal sequence has the
highest inhibition activity, although the middle sequence
also showed growth inhibition activity. In contrast, the
bacteria harboring the C-terminal sequence did not show
growth inhibition (Fig. 5a). SDS-PAGE followed by Coo-
massie blue staining showed that the N-terminal and mid-
dle region sequences of Orf507 were expressed abundantly.
However, full-length and C-terminal sequences were not
expressed (Fig. 5b).
As the N-terminal and middle regions of Orf507
exhibited bacterial growth inhibition activity, we per-
formed yeast two-hybrid analyses using partial sequences
of Orf507 and MtATP6 to see whether there is a link
between bacterial growth inhibition and binding activity.
Table 2 Orf456 interactors identified in yeast two-hybrid screening
Selective
media
b-gal
activity
Gene functiona Localizationb
H H Rice mitochondrial ATP
synthase 6 kDa subunit
Mitochondria
L L NAD-malate dehydrogenase Mitochondria
M M Voltage-dependent anion-
selective channel
Mitochondria
H H 60S acidic ribosomal protein With signal
peptide
M L 60S ribosomal RNA L1 Cytosol
M M 60S ribosomal protein, L13 like
protein
No signal
peptide
H H 60S ribosomal protein L15 Mitochondria
L M Elongation factor 1-alpha
subunit
No signal
peptide
L L Elongation factor 1-alpha
subunit
No signal
peptide
M L Elongation factor 1-alpha
subunit
No signal
peptide
L M GDP dissociation inhibitor With signal
peptide
L L Unknown No signal
peptide
L M Unknown No signal
peptide
L M Putative d-adenosylmethionine
decarboxylase proenzyme
No signal
peptide
H H Putative mrp protein, function in
ATP binding
Chloroplast
H H PUR alpha-1 protein No signal
peptide
H M Unknown No signal
peptide
L L Pepper 60S rRNA protein L13a Mitochondria
L L eIF4A No signal
peptide
L L Translation initiation factor No signal
peptide
L L 26S proteasome regulatory
subunit
Chloroplast
L L Histon H3 like mRNA No signal
peptide
M H RNA polymerase No signal
peptide
M L Pepper ATP citrate lyase mRNA Mitochondria
M M Ubiquitin carrier like protein Mitochondria
H high, M medium, L lowa Putative gene function was analysed by SGN website (http://
solgenomics.net/)b Protein localization was predicted by iPSORT, TargetP, and ChloroP
software
1102 Planta (2013) 237:1097–1109
123
The results of the analysis using partial sequences of
MtATP6 revealed that the full-length sequence is required
for physical interaction with Orf507 (data not shown).
However, the results of the analysis using partial sequences
of Orf507 revealed that all of the partial sequences
(N-terminal, middle, and C-terminal) interacted with full-
length MtATP6, albeit with different intensity. The N-ter-
minal region has the highest and C-terminal region has the
lowest binding affinity (Fig. 5c).
Discussion
The failure of CMS lines to develop functional pollen is
associated with mitochondrial DNA rearrangement
(Hanson 1991; Linke and Borner 2005). Rearrangement of
ORFs in chili pepper due to the recombination of mtDNA
was reported by Kim et al. (2001), and a new ORF, Orf456,
was identified and characterized as a candidate gene for
mediating CMS in pepper (Kim et al. 2007). Recently,
further characterization of Orf456 revealed that Orf456
sequence might have been resulted from a sequencing error
at 30 end of Orf507 (Gulyas et al. 2010).
In the present work, yeast two-hybrid screening of a
Capsicum cDNA library, using Orf456 as bait, identified a
number of interacting proteins, including MtATP6 (Fig. 1;
Table 2). Orf507 was also found to physically interact with
MtATP6 in yeast two-hybrid assays. Interaction was fur-
ther verified by in vivo studies, including BiFC and Co-IP
analyses. The interaction between a mitochondrion-enco-
ded protein, Orf507, and a nuclear-encoded protein,
MtATP6, leads us to speculate that regulation of MtATP6
by Orf507 might lead to a decrease or absence of MtATP6
function.
The analysis of interaction between MtATP6 and
Orf507 using the yeast two-hybrid system has limitations,
in that the yeast two-hybrid system often results in false
positives and Orf507, which is a mitochondrial membrane
Fig. 1 Physical interaction of Orf507 with MtATP6. a Interaction of
Orf456, a truncated form of Orf507, with MtATP6 by yeast two-
hybrid analysis. pBD:Orf456 was used as bait and pAD:MtATP6 was
used as prey. Yeast transformants expressing both ‘bait’ and ‘prey’
recombinant proteins were grown on control plates (-Trp/-Leu). Three
different concentrations of yeast cells were then cultured on selective
media (-Trp/-Leu/-His). Protein interactions determined by detection
of the activity of ß-gal are shown in the middle panel. Empty pBD
(bait) and pAD (prey) plasmids were used as negative controls (NC).
pBD:WT and pAD:WT were used as positive controls (PC).
b Interaction of Orf507 with MtATP6 by Yeast two-hybrid analysis.
pDEST32:Orf507 was used as a bait and pDEST22:MtATP6 was used
as prey. Three different concentrations of the yeast grown on selective
media (-Leu/-Trp) were cultured onto Sc-Leu-Trp-Ura plates and
interaction was determined according to the growth of the yeast cells.
Self activation tests were also performed (3rd and 4th panels). PC
(positive control), NC (negative control, empty vectors). c Bimolec-
ular fluorescence complementation (BiFC) assay for the in vivo
interaction of Orf507 with MtATP6. Confocal micrographs of N.benthamiana leaf sections infiltrated with positive control (PC),
negative control (NC), and pSPYNE:Orf507 and pSPYCE:MtATP6
(third panel) are shown. DIC (Differential interference contrast), Chl
(chlorophyll autofluorescence), YFP (Yellow fluorescent protein),
merged (DIC, Chl and YFP). d Co-Immunoprecipitation (Co-IP)
assay to test in vivo interaction of Orf507 with MtATP6. Total protein
obtained from plants infiltrated with PEG201/PEG202, PEG201-
MtATP6, PEG202-Orf507, or PEG201-MtATP6/PEG202-Orf507
was immunoprecipitated with antiHA antibody. The eluted protein
samples were loaded in 15 % SDS-PAGE and immunoblotted with
antiFLAG antibody
Planta (2013) 237:1097–1109 1103
123
protein that may show a different interaction pattern in the
nucleus where protein–protein interaction occurs in the
yeast two-hybrid system (Bruckner et al. 2009). In this
study, five candidates were selected through primary
screening using the yeast two-hybrid method (Table 2).
Among them, only MtATP6 showed strong and specific
interaction with Orf507 in other analyses using BiFC and
Co-IP methods. Interaction of several mitochondrial pro-
teins in yeast two-hybrid assays has also been reported by
other research groups (Marzo et al. 1998; Naithani et al.
2003; Aphasizhev et al. 2003). For example, yeast two-
hybrid analysis was used to determine the interaction of
Bax, which is a mitochondrial membrane protein, with
adenine nucleotide translocator. This interaction was fur-
ther confirmed by co-immunoprecipitation analysis using
solubilized mitochondria, which demonstrated in vivo
interaction (Marzo et al. 1998).
Mitochondrial F0F1–ATP synthase produces and
hydrolyzes most of the cell’s energy; therefore, it is critical
for the survival of all living organisms. In previous studies,
plant mitochondrial F0F1–ATP synthases were separately
purified from spinach, potato, and Arabidopsis, and some
of the genes encoding subunits of the F1 complex were
identified and sequenced (Hamasur and Glaser 1991, 1992;
Jansch et al. 1996; Millar et al. 2001). However, less is
known about the composition of the F0 complex. Rice
MtATP6 (RMtATP6) was purified from the F0 part of
F0F1–ATP synthase by blue native polyacrylamide gel
(Heazlewood et al. 2003), and the gene encoding this
subunit was cloned and identified by Zhang et al. (2003,
2006). RMtATP6 was localized in mitochondria and
increased RMtATP6 was shown to have a role in main-
taining or enhancing the activity of the F0F1–ATP synthase
under salt and osmotic stresses (Zhang et al. 2006). In this
study, we cloned MtATP6 in pepper and mapped it to
chromosome 4. It encodes a protein with 69 % amino acid
identity to RMtATP6. The pepper MtATP6 also was tar-
geted to the mitochondria. Therefore, we conclude that the
nuclear-encoded pepper MtATP6 may be a subunit of F0 in
the mitochondrial F0F1–ATP synthase complex.
Nuclear control of the expression of mitochondrial
proteins is well documented. For instance, a nuclear gene
encoding a mitochondrial protein plays a role in restoration
of fertility (Chase 2007). Mitochondrial regulation of
Fig. 2 Genetic mapping, localization, and sequence analysis of
MtATP6. a Genetic mapping of the MtATP6 locus with allele-
specific markers. The MtATP6 gene was mapped to within a region
between two markers, NP1234 and TG132, on chromosome 4 in
pepper. PCR-based allele-specific marker information is listed in
Table 1. b Transient expression of the MtATP6-GFP fusion in onion
epidermal cells. The left panel shows the differential interference
contrast (DIC) image. The second panel shows the epidermal cells
stained with Mitotracker, a mitochondrial marker. The third panelshows the GFP fluorescence image. The merging of the three images
is shown in the right panel. Scale bar, 10 lm. c Amino acid sequence
alignment of MtATP6 homologs prepared using the ClustalW
program. The transmembrane domain (TMD) is indicated with
asterisks. Hv ATP syn (barley, Hordeum vulgare ATP synthase
6 kDa subunit, cDNA accession number: AK252871); Os (rice, Oryzasativa, GAN: AB055076); Zm (maize, Zea mays, GAN: ACG36451);
At (Arabidopsis thaliana, At3g4643); Ca (pepper, Capsicum annuum,
GAN: FJB22040), Sl (tomato, Solanum lycopersicum, cDNA number:
AK224636); Lu (linseed, Linum usitatissimum, GAN:EU829257).
d Cladogram based on the alignment in c
1104 Planta (2013) 237:1097–1109
123
nuclear genes which is known as mitochondrial retrograde
regulation (MRR) in CMS anthers has been reported sev-
eral times, and some nuclear genes show altered expression
patterns in CMS lines (Carlsson et al. 2007). Expression of
TaFAd encoding the FAd subunit of the F0F1–ATP synthase
is repressed in anthers of CMS plants with Timopheevii
cytoplasm (Xu et al. 2008). MRR may regulate the tran-
scription of nuclear genes involved in pollen and/or
microspore development, energy metabolism, and signal
transduction by altering the expression of nuclear
transcription factors (Linke and Borner 2005; Carlsson
et al. 2007). The expression level of pepper MtATP6 was
much lower in anthers of the CMS lines than anthers from
restorer and fertile lines in which MtATP6 expression was
highly up-regulated compared to leaf and stem tissues.
Another nuclear DNA-encoded gene for an F0F1–ATP
synthase subunit, ATP synthase ß subunit, showed a similar
expression pattern with MtATP6, implying that expression
of genes for complete assembly of the F0F1–ATP synthase
complex may be under MRR. It is not understood clearly
Fig. 3 Expression profiles of MtATP6 in fertile and sterile lines.
Plants were grown for 3 months after germination in green house. The
transcription of MtATP6 and ATP synthase ß subunit was examined
using real-time RT-PCR. Values for expression were normalized to
those of Actin. a Quantification of MtATP6 expression in anthers,
leaves, stems, and ovules in Milyang A. b Quantification of MtATP6expression in anthers, leaves, and stems of Milyang A, Milyang B,
and Milyang K. c Quantification of ATP synthase ß subunitexpression in anthers, leaves, and stems of Milyang A, Milyang B,
and Milyang K
Planta (2013) 237:1097–1109 1105
123
how mitochondria transduce the signal to control the
transcription of nuclear genes in plants. Reduction of
mitochondrial transmembrane potential has been suggested
as one of the signals that affect expression of target genes
in the nucleus (Kuzmin et al. 2004). In yeast, control of
nuclear gene expression by the RTG-dependent pathway
has been well studied using respiratory-deficient cells
lacking mtDNA (Butow and Avadhani 2004). Failure in the
operation of the TCA cycle cues signal transduction to
induce the expression of many nuclear genes, most of
which are required for metabolic compensation. An alter-
native signaling pathway that is independent from regula-
tion of RTG genes has been also suggested. For example,
Fig. 4 Activities of mitochondrial ATP synthase in fertile and sterile
lines. a Histochemical enzymatic staining in native-PAGE gels.
Solubilized mitochondrial proteins (250 lg) isolated from seedlings
of the restorer (F, Milyang B) and sterile (S, Milyang A) lines were
fractioned by native polyacrylamide gel electrophoresis. Gels were
stained with Coomassie brilliant blue (CBB) or incubated with
appropriate reagents to visualize the activities of ATP synthase and
succinate dehydrogenase (Succinate DHase). Quantification of the
enzyme activities is shown below the gels. Data are average of three
independent experiments (average ± SD). b Mitochondrial ATP
contents in fertile and sterile lines (average ± SD)
Fig. 5 Bacterial growth inhibition and binding activity of Orf507.
a The graph represents the growth of bacteria harboring constructs for
expression of the full length (FL), N-terminal region (N0), middle
region (M0), or C-terminal region (C0) of Orf507 before and after
IPTG induction. b Coomassie Brilliant Blue (CBB)-stained gel
showing expression at 3 h after IPTG induction of N0 and M0 regions
of Orf507 (asterisks), but not of FL or C0. M, molecular weight
markers. c Physical interaction of MtATP6 with full-length and
partial sequences of Orf507. Different concentrations of yeast cells
harboring full-length MtATP6 and full-length or partial sequences of
Orf507 were cultured on Sc-Leu-Trp-Ura selection medium. Protein
interaction was determined based on the growth of the yeast cells on
the selection medium. NC represents negative control (empty vectors)
and PC represents positive control
1106 Planta (2013) 237:1097–1109
123
mutation of the Oxa1 protein, which functions in the
assembly of the ATP synthase complex and cytochrome C
oxidase, induces the expression of a nuclear DNA-encoded
ABC-transporter, PDR5 (Zhang and Moye-Rowley 2001).
It is possible that mitochondrial dysfunction that was
caused by the action of Orf507 induced the transduction of
signaling to affect the transcription pattern of nuclear genes
including those for F0F1–ATP synthase subunits. Further
studies are required to explore the direct relationships of
the CMS-related proteins in pepper.
In higher plants, the demand for ATP is highly increased
during pollen development (Sabar et al. 2003), and
decreased mitochondrial ATP synthesis may be a causal
factor in disruption of pollen or microspore development
(Yang et al. 2009). The total amount of ATP is decreased in
reproductive and vegetative tissues of CMS lines compared
to those in maintainer lines of tobacco (Bergman et al.
2000) and rapeseed (Teixeira et al. 2005) although the ATP
to ADP ratio is specifically decreased in floral buds of
CMS tobacco or does not show significant differences
between tissues of rapeseed lines. In addition, the reduced
activity of ATP synthase in etiolated seedlings of CMS
sunflower implies that normal ATP production may be
hampered by CMS-associated gene products (Sabar et al.
2003). However, the link between the action of CMS-
associated gene products and impaired activity of ATP
synthase has not been elucidated experimentally. It was
reported that Arabidopsis transgenic plants expressing
Orf456 in mitochondria display defective pollen develop-
ment and maturation (Kim et al. 2007). The enzyme
activity of F0F1–ATP synthase in the CMS line was spe-
cifically reduced to 38 % that of its restorer line (Fig. 4a).
Mitochondrial ATP synthesis is driven by electron trans-
port in the inner membrane. Destruction of the F0F1–ATP
synthase may also affect electron transport, which would
intensify the disruptions of ATP synthesis. In our experi-
ment, the mitochondrial ATP content in the CMS line was
one half of that in the normal line (Fig. 4b). In a similar
experiment, it was reported that ATP levels are decreased
by 41 % in Saccharomyces cerevisiae expressing OrfH79
from CMS-HongLian rice (Peng et al. 2009). Although our
experiments were performed using mitochondria from eti-
olated seedlings, impaired activity of ATP synthase and
reduced amounts of ATP likely resulted from the action of
the CMS-associated gene product, Orf507, because Orf507
was shown to be normally expressed in etiolated seedlings
(Kim et al. 2007). Therefore, we speculate that the cyto-
plasmic male sterility of Milyang A might be caused by
reduced activity of MtATP6. Thus, our functional analysis
of mitochondrial Orf507 could provide new insights into
the mechanisms responsible for CMS in plants.
Though several studies have been performed to eluci-
date the underlying mechanism of CMS in plants, the exact
mechanism is not known. In one of these studies, it was
reported that a mitochondrial gene, OrfH79, from CMS-
HongLian rice has toxicity to yeast cells, causing growth
inhibition (Peng et al. 2009). We introduced Orf507 into an
E. coli strain and also observed growth inhibition. The
N-terminal region of Orf507 displayed the highest bacterial
growth inhibition. This result is consistent with previous
reports, as CMS-associated genes including T-maize urf13,
sunflower Orf522, radish Orf138, and BT-rice Orf79
encode peptides that are toxic to E. coli (Dewey et al. 1987;
Nikai et al. 1995; Duroc et al. 2005; Wang et al. 2006).
However, the exact link between toxicity of ORFs and
CMS is not understood. It is possible that proteins encoded
by the CMS-associated ORFs disrupt the functions of
proteins required for the pollen development via a mech-
anism that also has toxic effect in bacteria.
The N-terminal and middle region peptides of Orf507
were expressed in E. coli (Fig. 5b). However, expression of
the full length and the C-terminal region was not detected.
To express full length and C-terminal regions of the pro-
tein, we analyzed the frequency of rare codons in the
Orf507 sequence and used different E. coli strains. How-
ever, the sequences were still not expressed. At this point,
we do not know the reason behind the failure of full length
and C-terminal region protein expression in E. coli. The
C-terminal peptide might have a role in inhibiting Orf507
expression, since the protein was able to be expressed in
E. coli when the C-terminal sequence was absent. Fur-
thermore, the yeast two-hybrid data using the partial
sequences of Orf507 showed that the N-terminal region has
the highest binding activity and the C-terminal region has
the lowest binding activity with MtATP6. This suggests
that the N-terminal and middle regions of Orf507 bind
MtATP6 causing it to be nonfunctional and leading to
defective pollen development and consequently CMS.
In conclusion, F0F1–ATP synthase activity was found to
be affected in a CMS line, probably resulting from the
interaction between mitochondrial Orf507 and nuclear-
encoded MtATP6. Dysfunction of this enzyme complex
might impact the increased energy demands during pollen
development, resulting in pollen abortion in the CMS line.
Further molecular analyses of the CMS line expressing
mitochondrial Orf507 should provide insights regarding the
role of MtATP6 in the regulation of F0F1–ATP synthase
activity, as well as the mechanisms underlying CMS in
plants.
Acknowledgments This research was supported by a grant (code:
0636-20120009) from the Vegetable Breeding Research Center
through R&D Convergence Center Support Program, Ministry for
Food, Agriculture, Forestry and Fisheries, Republic of Korea and by
Technology Development Program for Agriculture and Forestry
(code:308020-5), Ministry for Food, Agriculture, Forestry and Fish-
eries, Republic of Korea.
Planta (2013) 237:1097–1109 1107
123
References
Aphasizhev R, Aphasizheva I, Nelson RE, Simpson L (2003) A
100 kD complex of two RNA-binding proteins from mitochon-
dria of Leishmania tarentolae catalyzes RNA annealing and
interacts with several RNA editing components. RNA 9:62–76
Bergman P, Edqvist J, Farbos I, Glimelius K (2000) Male-sterile
tobacco displays abnormal mitochondrial atp1 transcript accu-
mulation and reduced floral ATP/ADP ratio. Plant Mol Biol
42:531–544
Bruckner A, Polge C, Lentze N, Auerbach D, Schlattner U (2009)
Yeast two-hybrid, a powerful tool for systems biology. Int J Mol
Sci 10:2763–2788
Butow RA, Avadhani NG (2004) Mitochondrial signaling: the
retrograde response. Mol Cell 14:1–15
Carlsson J, Lagercrantz U, Sundstrom J, Teixeira R, Wellmer F,
Meyerowitz EM, Glimelius K (2007) Microarray analysis
reveals altered expression of a large number of nuclear genes
in developing cytoplasmic male sterile Brassica napus flowers.
Plant J 49:452–462
Chase CD (2007) Cytoplasmic male sterility: a window to the world of
plant mitochondrial–nuclear interactions. Trends Genet 23:81–90
Dewey RE, Timothy DH, Levings CS (1987) A mitochondrial protein
associated with cytoplasmic male sterility in the T-cytoplasm of
maize. Proc Natl Acad Sci USA 84:5374–5378
Duroc Y, Gaillard C, Hiard S, Defrance M-C, Pelletier G, Budar F
(2005) Biochemical and functional characterization of ORF138,
a mitochondrial protein responsible for ogura cytoplasmic male
sterility in Brassiceae. Biochimie 87:1089–1100
Gagliardi D, Leaver CJ (1999) Polyadenylation accelerates the
degradation of the mitochondria mRNA associated with cyto-
plasmic male sterility in sunflower. EMBO J 18:3757–3766
Gulyas G, Shin Y, Kim H, Lee JS, Hirata Y (2010) Altered transcript
reveals an Orf507 sterility-related gene in chili pepper (Capsi-cum annum L.). Plant Mol Biol Rep 28:605–612
Hamasur B, Glaser E (1991) F1F0-ATPase of plant mitochondria:
isolation and polypeptide composition. Biochem Biophys Res
Commun 170:1352–1358
Hamasur B, Glaser E (1992) Plant mitochondrial F1F0-ATPase:
identification of the individual subunits and properties of the
purified spinach leaf mitochondrial ATP synthase. Eur J
Biochem 205:409–416
Hanson MR (1991) Plant mitochondrial mutations and male sterility.
Annu Rev Genet 25:461–486
Hanson MR, Bentolila S (2004) Interaction of mitochondria and
nuclear genes that affect male gametophyte development. Plant
Cell 16:S154–S169
Hanson MR, Pruitt KD, Nivison HT (1989) Male sterility loci in plant
mitochondrial genes. Plant Mol Cell Biol 6:61–85
Heazlewood JL, Howell KA, Whelan J, Millar AH (2003) Towards an
analysis of the rice mitochondrial proteome. Plant Physiol
132:230–242
Jansch L, Kruft V, Schmitz UK, Braun HP (1996) New insights into
the composition, molecular mass and stoichiometry of the
protein complexes of plant mitochondria. Plant J 9:357–368
Kang WH, Seo JK, Chung BN, Kim KH, Kang BC (2012) Helicase
domain encoded by Cucumber mosaic virus RNA1 determines
systemic infection of Cmr1 in pepper. PLoS One 7:e43136
Kaul MLH (1988) Male sterility in higher plants. Springer, Berlin
Kim DH, Kang JG, Kim S, Kim BD (2001) Identification of coxII and
atp6 regions as associated to CMS in Capsicum annuum by using
RFLP and long accurate PCR. J Korean Soc Hort Sci 2:121–127
Kim DH, Kang JG, Kim BD (2007) Isolation and characterization of
the cytoplasmic male sterility associated orf456 gene of chili
pepper (Capsicum annuum L.). Plant Mol Biol 63:519–532
Kuzmin EV, Karpova OV, Elthon TE, Newton KJ (2004) Mitochon-
drial respiratory deficiencies signal up-regulation of genes for
heat shock proteins. J Biol Chem 279:20672–20677
Li J, Pandeya D, Nath K, Zulfugarov S, Yoo SC, Zhang H, Yoo JH,
Cho SW, Koh HJ, Kim DS, Seo HS, Kang BC, Lee CH, Paek NC
(2010) Zebra-Necrosis, a thylakoid-bound protein, is critical for
photoprotection of developing chloroplasts during early leaf
development. Plant J 62:713–725
Linke B, Borner T (2005) Mitochondrial effects on flower and pollen
development. Mitochondrion 5:389–402
Livingstone KD, Lackney VK, Blauth JR, van Wijk R, Jahn MK
(1999) Genome mapping in Capsicum and the evolution of
genome structure in the Solanaceae. Genetics 152:1183–1202
Marzo I, Brenner C, Zamzami N, Jurgensmeier JM, Susin SA, Vieira
HL, Prevost MC, Xie Z, Matsuyama S, Reed JC, Kroemer G
(1998) Bax and adenine nucleotide translocator cooperate in the
mitochondrial control of apoptosis. Science 281:2027–2031
Millar AH, Sweetlove LJ, Giege P, Leaver CJ (2001) Analysis of the
Arabidopsis mitochondrial proteome. Plant Physiol 127:1711–1727
Naithani S, Saracco SA, Butler CA, Fox TD (2003) Interactions
among COX1, COX2, and COX3 mRNA-specific translational
activator proteins on the inner surface of the mitochondrial inner
membrane of Saccharomyces cerevisiae. Mol Biol Cell
14:324–333
Nikai S, Noda D, Kondo M (1995) High level expression of a
mitochondrial orf522 gene from the male sterile sunflower is
lethal to E. coli. Breed Sci 45:233–236
Pedersen PL, Ko YH, Hong S (2000) ATP synthase in the year 2000;
evolving views about the structures of these remarkable enzyme
complexes. J Bioenerg Biomembr 32:325–332
Peng X, Li F, Li S, Zhu Y (2009) Expression of a mitochondrial gene
orfH79 from the CMS-HongLian rice inhibits Saccharomycescerevisiae growth and causes excessive ROS accumulation and
decrease in ATP. Biotechnol Lett 31:409–414
Sabar M, Gagliardi D, Balk J, Leaver C (2003) ORFB is a subunit of
F1F0-ATP synthase: insight into the basis of cytoplasmic male
sterility in sunflower. EMBO Rep 4:381–385
Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer
and molecular biology. Plant Cell 7:821–831
Teixeira RT, Knorpp C, Glimelius K (2005) Modified sucrose, starch,
and ATP levels in two alloplasmic male-sterile lines of B. napus.
J Exp Bot 56:1245–1253
Wang Z, Zou Y, Li X, Zhang Q, Chen L, Wu H, Su D, Chen Y, Guo J,
Luo D, Long Y, Zhong Y, Liu YG (2006) Cytoplasmic male
sterility of rice with Boro II cytoplasm is caused by a cytotoxic
peptide and is restored by two related PPR motif genes via
distinct modes of mRNA silencing. Plant Cell 18:676–687
Xu P, Yang YW, Zhang ZZ, Chen WH, Zhang CQ, Zhang LX, Zou
SX, Ma ZQ (2008) Expression of the nuclear gene TaFAd is
under mitochondrial retrograde regulation in anthers of male
sterile wheat plants with Timopheevii cytoplasm. J Exp Bot
59:1375–1381
Yang JH, Huai Y, Zhang MF (2009) Mitochondrial atpA gene is
altered in a new orf220-type cytoplasmic male-sterile line of
stem mustard (Brassica juncea). Mol Biol Rep 36:273–280
Young EG, Hanson MR (1987) A fused mitochondrial gene
associated with cytoplasmic male sterility is developmentally
regulated. Cell 50:41–49
Zerbetto E, Vergani L, Dabbeni-Sala F (1997) Quantification of
muscle mitochondrial oxidative phosphorylation enzymes via
histochemical staining of blue native polyacrylamide gels.
Electrophoresis 18:2059–2064
Zhang XX, Liu SK (2003) Identification and characterization of
mitochondrial ATP synthase small subunit gene in rice (Oryzasativa L.). Mol Breed 1:605–612
1108 Planta (2013) 237:1097–1109
123
Zhang X, Moye-Rowley WS (2001) Saccharomyces cerevisiaemultidrug resistance gene expression inversely correlates with
the status of the F(0) component of the mitochondrial ATPase.
J Biol Chem 276:47844–47852
Zhang XX, Takano T, Liu SK (2006) Identification of a mitochondrial
ATP synthase small subunit gene (RMtATP6) expressed in
response to salts and osmotic stresses in rice (Oryza sativa L.).
J Exp Bot 56:1–8
Zhang H, Li SQ, Li P, Wan CX, Chen ZY, Zhu YG (2007) A
Honglian CMS line of rice displays aberrant F0 of F0F1-ATPase.
Plant Cell Rep 26:1065–1071
Planta (2013) 237:1097–1109 1109
123
top related