molecular basİs of cell agİng prof. dr. turgut ulutİn

MOLECULAR BASİS MOLECULAR BASİS OF CELL AGİNGOF CELL AGİNG

Prof. Dr. Turgut ULUTİNProf. Dr. Turgut ULUTİN

The main factors acting in aging process and the functional relationship between them

The agingThe aging of higher organisms is multi- of higher organisms is multi-factorial process. It is influenced and factorial process. It is influenced and modified by various genetic, biochemical, modified by various genetic, biochemical, regulation and other systems working at regulation and other systems working at once in close contact. Each system can once in close contact. Each system can make direct impact on aging process or make direct impact on aging process or act indirectly (e.g. through other act indirectly (e.g. through other pathway). That is why interaction between pathway). That is why interaction between mentioned systems is important too. Here mentioned systems is important too. Here we have tried to overview the influence of we have tried to overview the influence of each factor to the aging process and to each factor to the aging process and to discuss how all mentioned aging-factors discuss how all mentioned aging-factors could act as the whole complex. could act as the whole complex.

MitochondriaeMitochondriae are the main unit of chemical power supply are the main unit of chemical power supply in the cell. During the synthesis of macroergical bio-in the cell. During the synthesis of macroergical bio-molecules free radicals are being produced as the by-molecules free radicals are being produced as the by-product. Free radicals when released in large quantities product. Free radicals when released in large quantities cause intercellular oxidative stress (e.g. oxidative damage cause intercellular oxidative stress (e.g. oxidative damage of DNA, proteins and other bio-molecules). Oxidative stress of DNA, proteins and other bio-molecules). Oxidative stress is the main reason of accelerated senescence. Free radicals is the main reason of accelerated senescence. Free radicals can result tissue degeneration by damaging mitochondria can result tissue degeneration by damaging mitochondria genome and cause early apoptosis (programmed cell genome and cause early apoptosis (programmed cell death) through the damage of nuclear genome. death) through the damage of nuclear genome. Endogenous Endogenous oxidative damage and repair systemsoxidative damage and repair systems play play a big role in spontaneous a big role in spontaneous mutagenesismutagenesis. Mutated genes . Mutated genes usually encode nonfunctional products, which disturb usually encode nonfunctional products, which disturb biochemical or/and signaling pathways leading to more or biochemical or/and signaling pathways leading to more or less expressed pathological state. Free radicals attack less expressed pathological state. Free radicals attack proteins and modify them. It usually disturbs protein proteins and modify them. It usually disturbs protein function and can accelerate the aging process. function and can accelerate the aging process.

Cell cycleCell cycle is regulated by different is regulated by different specific proteins. At this moment we know specific proteins. At this moment we know lots of different proteins which regulate lots of different proteins which regulate cell cycle, phase change (cancer cell cycle, phase change (cancer supressors, cyclins, and MAP kinases). supressors, cyclins, and MAP kinases). When these proteins are damaged by When these proteins are damaged by mutations cell cycle regulation can be mutations cell cycle regulation can be disturbed. Cells could die or become not disturbed. Cells could die or become not controlled depending on the nature of controlled depending on the nature of mutation- this could lead to cancer. Cell mutation- this could lead to cancer. Cell cycle regulation disorders leads to cycle regulation disorders leads to accelerated aging and/or cell malignancy. accelerated aging and/or cell malignancy.

We know genes concerned with pathological We know genes concerned with pathological aging. When they are damaged organism ages aging. When they are damaged organism ages much faster. These genes are named much faster. These genes are named gerontogenesgerontogenes - aging genes. Genetic - aging genes. Genetic polymorphisms (determining individual's polymorphisms (determining individual's longevity) are found. The existence of longevity longevity) are found. The existence of longevity gene is still very real. Some age linked diseases gene is still very real. Some age linked diseases are known in medical practice (Werner's, Bloom's, are known in medical practice (Werner's, Bloom's, Cocaine's syndromes, progery and other). Patents Cocaine's syndromes, progery and other). Patents had damaged various gerontogenes. It was had damaged various gerontogenes. It was observed that these genes encoded replication, observed that these genes encoded replication, transcription and repair machinery components of transcription and repair machinery components of the cell. the cell.

TelomeresTelomeres are the terminal parts of are the terminal parts of eukaryotic chromosomes. The influence to eukaryotic chromosomes. The influence to aging of telomeres is highly discussed. aging of telomeres is highly discussed. They are called "molecular clock" of the They are called "molecular clock" of the cell. Cell division times are correlated with cell. Cell division times are correlated with telomere length. After each cell division telomere length. After each cell division telomeres get shorter. When telomere telomeres get shorter. When telomere shortens to the critical stage, the intensity shortens to the critical stage, the intensity of cell division significantly decreases, and of cell division significantly decreases, and then cell differentiates and ages. then cell differentiates and ages. Telomeres are persistent in the not aging Telomeres are persistent in the not aging cells: cancer and germ line. cells: cancer and germ line.

The influence of The influence of transcription, transcription, translationtranslation and and posttranslational posttranslational modification systemsmodification systems to the cell is not to the cell is not static but highly regulated. For example, static but highly regulated. For example, when synthesized protein is modified when synthesized protein is modified incorrectly (wrong phosphorylation) its incorrectly (wrong phosphorylation) its function alters. If protein function is function alters. If protein function is important, appropriate intracellular important, appropriate intracellular processes or regulation could be processes or regulation could be disturbed. Such errors lower vitality of disturbed. Such errors lower vitality of organism and accelerate aging. organism and accelerate aging.

Intracellular processes are accordant and Intracellular processes are accordant and rigorous; it means cell is highly organized and rigorous; it means cell is highly organized and integrated system. Information (integrated system. Information (signal signal transductiontransduction) and the regulation of bioprocess ) and the regulation of bioprocess are the main players in the development and the are the main players in the development and the maintenance of this system and aging. When maintenance of this system and aging. When mutations or modification disturb proteins/genes mutations or modification disturb proteins/genes of signal systems, signal transduction and other of signal systems, signal transduction and other bioprocesses proceed abnormally. We should not bioprocesses proceed abnormally. We should not forget that organism is integrated system and all forget that organism is integrated system and all factors mentioned above act in-between with factors mentioned above act in-between with others. Mitochondrial metabolism process others. Mitochondrial metabolism process stimulates oxidative damage, but each cell has stimulates oxidative damage, but each cell has repair systems defeating it (reparative systems, repair systems defeating it (reparative systems, apoptosis, etc.). apoptosis, etc.).

Aging is a natural process, living organisms are Aging is a natural process, living organisms are highly adapted to the laws of nature, and highly adapted to the laws of nature, and senescent cells are being changed with juvenile. senescent cells are being changed with juvenile. The existence of not differentiated stem cells in The existence of not differentiated stem cells in every living organism has a deep meaning; they every living organism has a deep meaning; they act as a depot in the regeneration of damaged act as a depot in the regeneration of damaged cells. cells.

In the higher organisms, aging and renovation In the higher organisms, aging and renovation process is strictly regulated, anyway the source of process is strictly regulated, anyway the source of aging and renovation signal are of material aging and renovation signal are of material nature (biomolecules), which, changes during the nature (biomolecules), which, changes during the life cycle. Because of these changes life cycle. Because of these changes (modifications and mutations) organism (modifications and mutations) organism necessarily lose its battle with aging. necessarily lose its battle with aging.

CHROMOSOME

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

AATCCCAATCCC5’

3’

TELOMERE

Telomere senescent cells have shorter telomeressenescent cells have shorter telomeres length differs between specieslength differs between species in humans 8-14kb longin humans 8-14kb long telomere replication occurs late in the cell cycletelomere replication occurs late in the cell cycle

Provide protection from enzymatic degradation Provide protection from enzymatic degradation and maintain chromosome stabilityand maintain chromosome stability

Organisation of the cellular nucleus by serving Organisation of the cellular nucleus by serving as attaching points to the nuclear matrixas attaching points to the nuclear matrix

Allows end of linear DNA to be replicated Allows end of linear DNA to be replicated completelycompletely

FunctionsFunctions

Replicative senescence

• Telomeres shortens progressively with each cell division • 100 base pair lost with each cell division• Growth arrest

Go

G1

S

G2

M

C-FOS, ID-1,ID-2,E2F1

E2F5

P21,p16

incidence increases with age incidence increases with age replicative senescence tumor suppressive replicative senescence tumor suppressive

mechanismmechanism marker of malignancymarker of malignancy

Aging* extremely complex process*senescence associated gene expression*oxidative damage, replicative senescence*cell senescence can be reversed

Cancer

What are telomeres?What are telomeres? Telomeres are…Telomeres are…

• Repetitive DNA sequences at the ends of all human chromosomesRepetitive DNA sequences at the ends of all human chromosomes

• They contain thousands of repeats of the six-nucleotide sequence, They contain thousands of repeats of the six-nucleotide sequence,

TTAGGGTTAGGG

• In humans there are 46 chromosomes and thus 92 telomeres (one In humans there are 46 chromosomes and thus 92 telomeres (one

at each end)at each end)

• senescent cells have shorter telomeressenescent cells have shorter telomeres

• length differs between specieslength differs between species

• in humans 8-14kb longin humans 8-14kb long

• telomere replication occurs late in the cell cycletelomere replication occurs late in the cell cycle

Telomere functionTelomere function......

Telomeres are also thought to be the "clock" Telomeres are also thought to be the "clock" that regulates how many times an individual that regulates how many times an individual cell can divide. Telomeric sequences shorten cell can divide. Telomeric sequences shorten each time the DNA replicates.each time the DNA replicates.

How are telomeres linked to aging?How are telomeres linked to aging?

Once the telomere shrinks to a certain Once the telomere shrinks to a certain level, the cell can no longer divide. Its level, the cell can no longer divide. Its metabolism slows down, it ages, and dies.metabolism slows down, it ages, and dies.

How Does Telomerase Work?How Does Telomerase Work?

Telomerase works by adding back Telomerase works by adding back telomeric DNA to the ends of telomeric DNA to the ends of chromosomes, thus compensating chromosomes, thus compensating for the loss of telomeres that for the loss of telomeres that normally occurs as cells divide. normally occurs as cells divide.

Most normal cells do not have this Most normal cells do not have this enzyme and thus they lose enzyme and thus they lose telomeres with each division. telomeres with each division.

Telomeres & AgingTelomeres & Aging

Healthy human cells are mortal Healthy human cells are mortal because they can divide only a finite because they can divide only a finite number of times, growing older each number of times, growing older each time they divide. Thus cells in an time they divide. Thus cells in an elderly person are much older than elderly person are much older than cells in an infant. cells in an infant.

Think of it like this…Think of it like this…

• For the cell, having a long telomere can For the cell, having a long telomere can be compared to having a full tank of gas be compared to having a full tank of gas in your automobile; having a short in your automobile; having a short telomere is like running on empty. Each telomere is like running on empty. Each time a cell divides, its telomeres time a cell divides, its telomeres become a little shorter until the cells become a little shorter until the cells simply can no longer divide (e.g., it runs simply can no longer divide (e.g., it runs out of fuel).out of fuel).

CELL DEATH CELL DEATH

(APOPTOSİS)(APOPTOSİS)

Prof. Dr. Turgut ULUTİNProf. Dr. Turgut ULUTİN

More than one way to die: Necrosis and Apoptosis

rapid membrane permeablization

release of intracellular content

cell implosion and formation of apoptotic bodies

osmotic shock

swelling of thecytoplasm

Swelling of the nucleus Apoptosis

Necrosis

recognition and engulfment of apoptotic bodies by phagocytic cells

cytoplasmic, nuclearcondensation

chromatin margination

membrane blebbing

More than one way to die: Necrosis and Apoptosis

cytoplasmic, nuclearcondensation

chromatin margination

membrane blebbing

cell implosion and formation of apoptotic bodies

recognition and engulfment by phagocytic cells

Apoptosis

Necrosisosmotic shock

rapid membrane permeablization

swelling of thecytoplasm

Swelling of the nucleus

release of intracellular content

Phagocyte

ApoptoticCell

RAC-1

DOCK 180

CRKII

ELMO

CytoskeletalReorganization for

Engulfment

C1q Receptor

BridgeC1q

C1qBindingSite

PS

Phosphatidyl-serineReceptors

ScavengerReceptors

? Oxidized LDL-like Site

Apoptosis and Phagocytosis

• Phagocytes recognize “eat-me” or cell corpse signals on the apoptotic cell surface. These signal the phagocyte to activate cellular engulfment machinery.

• Phosphatidylserine exposure on the target cell surface and the phosphatidylserine receptor on the phagocyte are essential for phagocytosis.

• Defining other receptors, bridge molecules, “eat-me” signals and signaling molecules involved in initiating the cytosolic changes needed for engulfment are very active areas of research. The articles listed below review current knowledge and are the sources for this diagram.

Savill, J. and Fadok, V. 2000. Nature. 407:784.Canradt, B. 2002. Nature Cell Biol. 4:E139.

Apoptosis Oxygen Society Education Program Tome & Briehl 5

1.

2.

3.

4.

Engulfment

Phagocyte ApoptoticCell

With "eat me"signals

Phagocyte HealthyCell

Phagocyte ApoptoticCell

With "eat me"signals

PhagocytePrecursor

ApoptoticCell

With "eat me"signals

Phagocyte inducesapoptotic machinery

in healthy cell

Apoptotic cell inducesphagocytic machinery

in phagocyte

Apoptotic cell inducesmaturation of precursor

into phagocyte

Apoptosis and Phagocytosis

• The first pathway shows the engulfment of an apoptotic cell exposing “eat-me” signals.

• Data from mammalian systems and genetic studies from Caenorhabditis elegans have shown that phagocytes and target cells have several types of interactions.

• Conradt has proposed several models (2-4) to indicate the more complex phagocyte-target interactions.

Conradt, B. 2002. Nature Cell Biol. 4:E139.Greene, D.R. and Beere, H.M. 2001. Nature. 412:133.

Apoptosis Oxygen Society Education Program Tome & Briehl 6

THE APOPTOTIC PATHWAY

Triggers Modulators Effectors Substrates DEATH

. FADD

. TRADD

. FLIP

. Bcl-2 family

. Cytochrome c

. p53

. Mdm2

. Caspases . Many cellular proteins. DNA

. Growth factor Deprivation. Hypoxia. Loss of adhesion. Death receptors . Radiation . Chemotherapy

CASPASESCASPASESCaspase-1 (ICE)Caspase-1 (ICE)

Caspase-2 (ICH-1, Nedd-2)Caspase-2 (ICH-1, Nedd-2)

Caspase-3 (CPP32, Apopain, Yama)Caspase-3 (CPP32, Apopain, Yama)

Caspase-4 (ICH-2, TX, ICEreCaspase-4 (ICH-2, TX, ICEreıııı))

Caspase-5 (ICErelCaspase-5 (ICErelıııııı, TY), TY)

Caspase-6 (Mch2)Caspase-6 (Mch2)

Caspase-7 (ICE-LAP3, Mch3, CMH-1)Caspase-7 (ICE-LAP3, Mch3, CMH-1)

Caspase-8 (FLICE, Mch5, MACH)Caspase-8 (FLICE, Mch5, MACH)

Caspace-9 (Mch6, ICE-LAP6)Caspace-9 (Mch6, ICE-LAP6)

Caspase-10 (Mch4)Caspase-10 (Mch4)

SUBSTRATES for CASPASES

... PARP

... DNA-PK

... pRb

... Lamins

... NuMA

... Fodrin

... -Aktin

... Mdm2

... Cyclin A2

... Presenilin

... Others

Why should a cell commit suicide?

There are two different reasons.

1. Programmed cell death is as needed for proper development as mitosis is.

Examples:

- The resorption of the tadpole tail at the time of its metamorphosis into a frog occurs by apoptosis.

- The sloughing off of the inner lining of the uterus (the endometrium) at the start of menstruation occurs by apoptosis. - The formation of the proper connections (synapses) between neurons in the brain requires that surplus cells be eliminated by apoptosis

2. Programmed cell death is needed to destroy cells that represent a threat to the integrity of the organism.Examples:

- Cells infected with viruses One of the methods by which cytotoxic T lymphocytes (CTLs) kill virus-infected cells is by inducing apoptosis. (And some viruses mount countermeasures to thwart it.)

- Cells with DNA damage Damage to its genome can cause a cell * to disrupt proper embryonic development leading to birth defects * to become cancerous. Cells respond to DNA damage by increasing their production of p53. p53 is a potent inducer of apoptosis. Is it any wonder that mutations in the p53 gene, producing a defective protein, are so often found in cancer cells (that represent a lethal threat to the organism if permitted to live)?

What makes a cell decide to commit suicide?

The balance between:

- the withdrawal of positive signals; that is, signals needed for continued survival

- the receipt of negative signals

Withdrawal of positive signals

The continued survival of most cells requires that they receive continuous stimulation from other cells and, for many, continued adhesion to the surface on which theyare growing. Some examples of positive signals:

- growth factors for neurons - Interleukin-2 (IL-2), an essential factor for the mitosis of lymphocytes

Receipt of negative signals

- increased levels of oxidants within the cell - damage to DNA by these oxidants or other agents like * ultraviolet light * x-rays * chemotherapeutic drugs - molecules that bind to specific receptors on the cell surface and signal the cell to begin the apoptosis program. These death activators include: * Tumor necrosis factor - alpha (TNF-a ) that binds to the TNF receptor; * Lymphotoxin (also known as TNF-b) that also binds to the TNF receptor; * Fas ligand (FasL), a molecule that binds to a cell-surface receptor named Fas (also called CD95)

Apoptosis

For every cell, there is a time to live and a time to die.

There are two ways in which cells die:

• they are killed by injurious agents • they are induced to commit suicide

Death by injury

Cells that are damaged by injury, such as by

• mechanical damage • exposure to toxic chemicals

undergo a characteristic series of changes:

• they (and their organelles like mitochondria) swell • the cell contents leak out, leading to • inflammation of surrounding tissues

Death by suicide

Cells that are induced to commit suicide:

- shrink - have their mitochondria break down with the release of cytochrome c - develop bubble-like blebs on their surface - have the chromatin (DNA and protein) in their nucleus degraded - break into small, membrane-wrapped, fragments - The phospholipid phosphatidylserine, which is normally hidden within the plasma membrane is exposed on the surface. - This is bound by receptors on phagocytic cells like macrophages and dendritic cells which then engulf the cell fragments. - The phagocytic cells secrete cytokines that inhibit inflammation.

The pattern of events in death by suicide is so orderly that the process is often called programmed cell death or PCD. The cellular machinery of programmed celldeath turns out to be as intrinsic to the cell as, say, mitosis. Programmed cell death is also called apoptosis

The Mechanisms of Apoptosis

There are 2 different mechanisms by which a cell commits suicide by apoptosis.

- one generated by signals arising within the cell - the other triggered by death activators binding to receptors at the cell surface. * TNF-a * Lymphotoxin * Fas ligand (FasL)

Apoptosis triggered by internal signals

- In a healthy cell, the outer membranes of its mitochondria express the protein Bcl-2 on their surface.

- Bcl-2 is bound to a molecule of the protein Apaf-1.

- Internal damage in the cell causes Bcl-2 * to release Apaf-1 * to no longer keep cytochrome c from leaking out of the mitochondria

- The released cytochrome c and Apaf-1 bind to molecules of caspase 9.

Major Apoptotic Pathways in Mammalian Cells

Hengartner, M.O. 2000. Nature. 407:770.Green, D. and Kroemer, G. 1998. Trends Cell Biol. 8:267.

Mitochondrial PathwayDeath Receptor Pathway

FasL

Caspase 3

DDD D

Fas/Apo1/CD95

FADD

Procaspase 8

DISC

Caspase 8

BID

oxidants ceramide others

Bcl-2D

Cytochrome c

dATP

Procaspase 9

Apaf -1

dATP

Apaf -1

Caspase 9

Procaspase 3

apoptosome

DNA damage

Cellular targets

Apoptosis Oxygen Society Education Program Tome & Briehl 3

- The resulting complex of * cytochrome c * Apaf-1 * caspase 9 * (and ATP) is called the apoptosome.

- These aggregate in the cytosol.

- Caspase 9 is one of a family of over a dozen caspases. They are all proteases. They get their name because they cleave proteins - mostly each other - at aspartic acid (Asp) residues).

- Caspase 9 cleaves and, in so doing, activates other caspases.

- The sequential activation of one caspase by another creates an expanding cascade of proteolytic activity (rather like that in blood clotting and complement activation) which leads to * digestion of structural proteins in the cytoplasm * degradation of chromosomal DNA and

- phagocytosis of the cell

Apoptosis triggered by external signals

- Fas and the TNF receptor are integral membrane proteins with their receptor domains exposed at the surface of the cell - binding of the complementary death activator (FasL and TNF respectively) transmits a signal to the cytoplasm that leads to activation of caspase 8 - caspase 8 (like caspase 9) initiates a cascade of caspase activation leading to - phagocytosis of the cell.

The early steps in apoptosis are reversible - at least in C. elegans. In some cases, final destruction of the cell is guaranteed only with its engulfment by a phagocyte.