innovation summit 08 science commons

life sciences infrastructure

john wilbanksvp for science @ creative commons

innovation summit11 january 2008

palo alto, ca

how to deliver drugs to cellsdisease mechanismstoxicity mechanisms

what we don’t know:

how to deliver drugs to cellsdisease mechanismstoxicity mechanisms

what we don’t know:

it’s a knowledge problem, and thus more money doesn’t translate to more drugs

the messaging doesn’t help

look, it’s a linear process!

drug discovery, development, and approval

$800,000,000-$1,ooo,000,000 per success

15-17 years

drug discovery, development, and approval

think of the total number of transactions

and how to disaggregate them outside the context ofa massive single corporate entity?

drug discovery, development, and approval

drug discovery, development, and approval

infrastructure needed: legal, technical, social, business

not: “open source biology” a la GPL

drug discovery, development, and approval

“open science” - commons-based, technologically enabled, lots of small transactions and collaborations

infrastructure to enable the emergence of open innovation systems in the life sciences

national systems are vastly unequal - the financial barriers to playing are so high - but that’s changing as the cost of life

sciences research drops

significant collaboration is needed to take life science innovation to the “next level” - reproducible drug discovery

collaborative innovation is a non-miraculous approach to increasing the odds of reproducible discovery

legal, technical, and policy elements are required to wrench life sciences into the network form of collaboration

Open Access Content

Open SourceKnowledge Management

Open AccessResearch Tools

innovation

moving to a digital infrastructure for publishing and using knowledge in science

or, why “paper” is the wrong metaphor

the impact of copyrights on innovation in scientific publishing:

http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf

legal infrastructure technical infrastructure

legal infrastructure technical infrastructure

social infrastructure: carrots and sticks

Open Access Content

Open SourceKnowledge Management

Open AccessResearch Tools

innovation

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

distinct “silos” of funded research

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

bilateral contracts and deals

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

“one to many” offers / networks

traits of legal protocols:

legally accuratesimple for scientists

low transaction costsfacilitate interoperability

business friendly

change requires a new legal infrastructure to encourage collaboration

ibridge

contractualreconstruction

of the research

exemption

Provider Lab

biobank

Recipient Lab

MTA

deposittracking

fulfillment

searching / ordering

takes a full e-commerce infrastructure

Open Access Content

Open SourceKnowledge Management

Open AccessResearch Tools

innovation

knowledge management

what you get

DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`

what you want

NeuronDBBAMS

Literature

Homologene

SWAN

Entrez Gene

Gene Ontology

Mammalian Phenotype

PDSPki

BrainPharm

AlzGene

Antibodies

PubChem

MESH

Reactome

Allen Brain Atlas

NeuronDB

BAMS

Literature

Homologene

SWAN

Entrez Gene

Gene Ontology

Mammalian Phenotype

PDSPki

BrainPharm

AlzGene

Antibodies

PubChem

MESH

Reactome

Allen Brain Atlas

prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>

prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>

prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>

select ?genename ?processnamewhere

{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D017966 .

?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article.

} graph <http://purl.org/commons/hcls/goa>

{ ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function.

?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as.

?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations>

{{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union

{?process rdfs:subClassOf go:GO_0007166 }} ?protein rdfs:subClassOf ?parent.

?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene.

} graph <http://purl.org/commons/hcls/gene>

{ ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416>

{ ?process rdfs:label ?processname}}

Mesh: Pyramidal Neurons

Pubmed: Journal Articles

Entrez Gene: Genes

GO: Signal Transduction

running code

DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway

this functionality is not infrastructure for anyone outside of pharma, and it’s

artisanally created inside pharma

Many of the genes are indeed related to Alzheimer’s Disease through gamma

secretase (presenilin) activity

DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`

http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E%0Aprefix%20rdfs%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2000%2F01%2Frdf-schema%23%3E%0Aprefix%20owl%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2002%2F07%2Fowl%23%3E%0Aprefix%20mesh%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Frecord%2Fmesh%2F%3E%0Aprefix%20sc%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fscience%2Fowl%2Fsciencecommons%2F%3E%0Aprefix%20ro%3A%20%3Chttp%3A%2F%2Fwww.obofoundry.org%2Fro%2Fro.owl%23%3E%0A%0Aselect%20%3Fgenename%20%3Fprocessname%0Awhere%0A%7B%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fpubmesh%3E%0A%20%20%20%20%20%7B%20%3Fpaper%20%3Fp%20mesh%3AD017966%20.%0A%20%20%20%20%20%20%20%3Farticle%20sc%3Aidentified_by_pmid%20%3Fpaper.%0A%20%20%20%20%20%20%20%3Fgene%20sc%3Adescribes_gene_or_gene_product_mentioned_by%20%3Farticle.%0A%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgoa%3E%0A%20%20%20%20%20%7B%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fres.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AonProperty%20ro%3Ahas_function.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AsomeValuesFrom%20%3Fres2.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AonProperty%20ro%3Arealized_as.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AsomeValuesFrom%20%3Fprocess.%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%2Fclassrelations%3E%0A%20%20%20%20%20%7B%7B%3Fprocess%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2Fobo%23part_of%3E%20go%3AGO_0007166%7D%0A%20%20%20%20%20%20%20union%0A%20%20%20%20%20%20%7B%3Fprocess%20rdfs%3AsubClassOf%20go%3AGO_0007166%20%7D%7D%0A%20%20%20%20%20%20%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fparent.%0A%20%20%20%20%20%20%20%3Fparent%20owl%3AequivalentClass%20%3Fres3.%0A%20%20%20%20%20%20%20%3Fres3%20owl%3AhasValue%20%3Fgene.%0A%20%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgene%3E%0A%20%20%20%20%20%7B%20%3Fgene%20rdfs%3Alabel%20%3Fgenename%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%3E%0A%20%20%20%20%20%7B%20%3Fprocess%20rdfs%3Alabel%20%3Fprocessname%7D%0A%7D&format=&maxrows=50

prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>

prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>

prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>

select ?genename ?processnamewhere

{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D009369 . ?article sc:identified_by_pmid ?paper.

?gene sc:describes_gene_or_gene_product_mentioned_by ?article. }

graph <http://purl.org/commons/hcls/goa> { ?protein rdfs:subClassOf ?res.

?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2.

?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process.

graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166}

union {?process rdfs:subClassOf go:GO_0006610 }}

?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3.

?res3 owl:hasValue ?gene. }

graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename }

graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname}

}

“view source” effect: beneficial output of releasing control

the cost of doing this has dropped to the point that a non profit can do it and give it away

infrastructure we need:

API to the public domain“one-click” for research

default rule: the right to hack (tools, data, papers)non-artisanal contract culture

if we are successful:

more eyes creating more knowledgeless funding of redundant research

use what is known to drive rates of innovation

china, brazil, EU: innovation law (bayh-dole variants)OECD GBRCN

US massive investment in bio-it at NCBI, NIH“post-national” in many ways

collaborative incentives, tax credits, letting scientists patent, private r&d resources, “credit database,” etc.

costs are dropping, and a lot of countries have a chip on their shoulder: drug prices, developed world focus

the biology “peace dividend”:

we know a lot less about evolved systems like human bodies than we need, but the technologies we have built for studying those systems are going to drive

innovation we can’t even imagine

atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa

if we can’t deal with the data we create in a classic drug discovery context, how will we deal with the

data that comes from new sources and user-generated biology?

retail: $79.95 + shippingages ten and up

DNA Discovery Explorer Kit

thank you

wilbanks@creativecommons.orghttp://sciencecommons.org

funded by: Kauffman Foundation, MacArthur Foundation, Omidyar Network, HighQ