graphical comparison of sequences using “dotplots”....
Post on 16-Dec-2015
220 Views
Preview:
TRANSCRIPT
Graphical comparison of sequences using “Dotplots”.
ACCTGCCCTGTCCAGCTTACATGCATGCTTATAGGGGCATTTTACAT
ACCTGCCGATTCCATATTACGCATGCTTCTGGGTTACCGTTCAGGGCATTTTACATGTGCTG
1+1+1+1+1+1+0+1+0+1+1=9
Basic Principles.
A T G CA 1 0 0 0T 0 1 0 0G 0 0 1 0C 0 0 0 1
A “word size” (11 say)
A “Scoring scheme”(1 for a match,0 for a mismatch, say)
A “Cut-off score” (8 say)
ATGCTTCTGGG
ATGCTTATAGG
Diagonal runs of dots indicate similar regions
Summary: Dotplots provide a comprehensive overview but NO detail.
Graphical comparison of sequences using “Dotplots”.
DNA: Simplest Scheme is the Identity Matrix.
A T G CA 1 0 0 0T 0 1 0 0G 0 0 1 0C 0 0 0 1
More complex matrices can be used.For example, the default EMBOSS DNA scoring matrix is:
A T G CA 5 -4 -4 -4T -4 5 -4 -4G -4 -4 5 -4C -4 -4 -4 5
The use of negative numbers is only pertinentwhen these matrices are use for computingtextual alignments.
Using a wider spread of scores eases theExpansion of the scoring matrix to sensiblyinclude ambiguity codes.
Scoring Schemes.
Graphical comparison of sequences using “Dotplots”.
A C G T S W R Y K M B V H D N UA 5 -4 -4 -4 -4 1 1 -4 -4 1 -4 -1 -1 -1 -2 -4C -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5 G -4 -4 5 -4 1 -4 1 -4 1 -4 -1 -1 -4 -1 -2 -4T -4 -4 -4 5 1 -4 -4 1 -4 1 -1 -1 -1 -4 -2 -4S -4 -4 1 1 -1 -4 -2 -2 -2 -2 -1 -1 -3 -3 -1 -4W 1 1 -4 -4 -4 -1 -2 -2 -2 -2 -3 -3 -1 -1 -1 1R 1 -4 1 -4 -2 -2 -1 -4 -2 -2 -3 -1 -3 -1 -1 -4Y -4 -1 -4 1 -2 -2 -4 -1 -2 -2 -1 -3 -1 -3 -1 1K -4 1 1 -4 -2 -2 -2 -2 -1 -4 -1 -3 -3 -1 -1 1M 1 -4 -4 1 -2 -2 -2 -2 -4 -1 -3 -1 -1 -3 -1 -4B -4 -1 -1 -1 -1 -3 -3 -1 -1 -3 -1 -2 -2 -2 -1 -1V -1 -4 -1 -1 -1 -3 -1 -3 -3 -1 -2 -1 -2 -2 -1 -4H -1 -1 -4 -1 -3 -1 -3 -1 -3 -1 -2 -2 -1 -2 -1 -1D -1 -1 -1 -4 -3 -1 -1 -3 -1 -3 -2 -2 -2 -1 -1 -1N -2 -2 -2 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2 U -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5
IUB DNA Alphabet
Code Meaning
ACGT/UM `aMino` A|CR `puRine` A|GW `Weak` A|TS `Strong` C|GY `pYrimidine` C|TK `Keto` G|TV `not T` A|C|GH `not G` A|C|TD `not C` A|G|TB `not A` C|G|TN `aNy` A|C|G|T
For Protein sequence dotplots more complex scoring schemes are required.Scores must reflect far more than alphabetic identity.
A B C D E F G H I K L M N P Q R S T V W Y ZA 2 0 -2 0 0 -4 1 -1 -1 -1 -2 -1 0 1 0 -2 1 1 0 -6 -3 0B 0 2 -4 3 2 -5 0 1 -2 1 -3 -2 2 -1 1 -1 0 0 -2 -5 -3 2C -2 -4 12 -5 -5 -4 -3 -3 -2 -5 -6 -5 -4 -3 -5 -4 0 -2 -2 -8 0 -5 D 0 3 -5 4 3 -6 1 1 -2 0 -4 -3 2 -1 2 -1 0 0 -2 -7 -4 3E 0 2 -5 3 4 -5 0 1 -2 0 -3 -2 1 -1 2 -1 0 0 -2 -7 -4 3F -4 -5 -4 -6 -5 9 -5 -2 1 -5 2 0 -4 -5 -5 -4 -3 -3 -1 0 7 -5G 1 0 -3 1 0 -5 5 -2 -3 -2 -4 -3 0 -1 -1 -3 1 0 -1 -7 -6 -1H -1 1 -3 1 1 -2 -2 6 -2 0 -2 -2 2 0 3 2 -1 -1 -2 -3 0 2I -1 -2 -2 -2 -2 1 -3 -2 5 -2 2 2 -2 -2 -2 -2 -1 0 4 -5 -1 -2K -1 1 -5 0 0 -5 -2 0 -2 5 -3 0 1 -1 1 3 0 0 -2 -3 -4 0L -2 -3 -6 -4 -3 2 -4 -2 2 -3 6 4 -3 -3 -2 -3 -3 -2 2 -2 -1 -3 M -1 -2 -5 -3 -2 0 -3 -2 2 0 4 6 -2 -2 -1 0 -2 -1 2 -4 -2 -2N 0 2 -4 2 1 -4 0 2 -2 1 -3 -2 2 -1 1 0 1 0 -2 -4 -2 1P 1 -1 -3 -1 -1 -5 -1 0 -2 -1 -3 -2 -1 6 0 0 1 0 -1 -6 -5 0Q 0 1 -5 2 2 -5 -1 3 -2 1 -2 -1 1 0 4 1 -1 -1 -2 -5 -4 3R -2 -1 -4 -1 -1 -4 -3 2 -2 3 -3 0 0 0 1 6 0 -1 -2 2 -4 0S 1 0 0 0 0 -3 1 -1 -1 0 -3 -2 1 1 -1 0 2 1 -1 -2 -3 0T 1 0 -2 0 0 -3 0 -1 0 0 -2 -1 0 0 -1 -1 1 3 0 -5 -3 -1V 0 -2 -2 -2 -2 -1 -1 -2 4 -2 2 2 -2 -1 -2 -2 -1 0 4 -6 -2 -2W -6 -5 -8 -7 -7 0 -7 -3 -5 -3 -2 -4 -4 -6 -5 2 -2 -5 -6 17 0 -6Y -3 -3 0 -4 -4 7 -5 0 -1 -4 -1 -2 -2 -5 -4 -4 -3 -3 -2 0 10 -4Z 0 2 -5 3 3 -5 -1 2 -2 0 -3 -2 1 0 3 0 0 -1 -2 -6 -4 3
Using a wider spread of scores eases theexpansion of the scoring matrix to sensiblyinclude ambiguity codes.
Scoring Schemes.
If the maximum possible cut-off score (still 11) is not achievedOnly if the maximum possible cut-off score (11) is achieved
Graphical comparison of sequences using “Dotplots”.
To detect perfectly matching words, a dotplot program has a choice of strategies
Select a scoring scheme
A T G CA 1 0 0 0T 0 1 0 0G 0 0 1 0C 0 0 0 1
ATGCTTATAGG
ATGCTTCTGGG
1+1+1+1+1+1+1+1+1+1+1=11
1)
For every pair of words, compute a word match score in the normal way
and a word size (11, say)
ATGCTTATAGG
ATGCTTCTGGG
1+1+1+1+1+1+0+1+0+1+1=9
Celebrate with a dot Do not celebrate with a dot
Faster plots for perfect matches.
Graphical comparison of sequences using “Dotplots”.
To detect perfectly matching words, a dotplot program has a choice of strategies
2)OR
If they are notIf they areATGCTTATAGG
ATGCTTCTGGG
For every pair of words, ……… see if the letters are exactly the same
ATGCTTATAGG
ATGCTTCTGGGCelebrate with a dot Do not celebrate with a dot
To detect exactly matching words, fast character string matching can replacelaborious computation of match scores to be compared with a cut-off score
Many packages include a dotplot option specifically for detecting exactlymatching words.
Particular advantage when seeking strong matches in long DNA sequences.
Faster plots for perfect matches.
Graphical comparison of sequences using “Dotplots”.
There are three parameters to consider for a dotplot:
1)The scoring scheme.
2)The cut-off score
3)The word size
Dotplot parameters.
Graphical comparison of sequences using “Dotplots”.
The Scoring scheme.
DNA
Usually, DNA Scoring schemes award a fixed reward for each matchedpair of bases and a fixed penalty for each mismatched pair of bases.
Choosing between such scoring schemes will affect only the choice ofa sensible cut-off score and the way ambiguity codes are treated.
Protein
Protein scoring schemes differ in the evolution distance assumedbetween the proteins being compared. The choice is rarely crucialfor dotplot programs.
Dotplot parameters.
Graphical comparison of sequences using “Dotplots”.
The Cut-off score.
The lower the cut-off score the more dots will be plotted.But, dots are more likely to indicate a chance match (noise).
The higher the cut-off score the less dots will be plotted.But, each dot is more likely to be significant.
Dotplot parameters.
Scoring Scheme: PAM 250, Word Size: 25, Cut-off score: 3020510
Graphical comparison of sequences using “Dotplots”.
The Cut-off score.
4 clear strong regions apparent
4 regions become clearer, some other weaker features appear
More “features”, probably noise, appear obscuring the original 4 clear regions.
Cut-off now clearly too low. Too much noise to see interesting regions.
Dotplot parameters.
Graphical comparison of sequences using “Dotplots”.
The Word size.
Large words can miss small matches.Smaller words pick up smaller features.
The smallest “features” areoften just “noise”.
Dotplot parameters.
Graphical comparison of sequences using “Dotplots”.
The Word size.
For sequences with regions of smallmatching features.
Small words pick small featuresIndividually.
Larger words show matching regions more clearly.
The lack of detail can be an advantage
Dotplot parameters.
Displaying the word 11 plot alone shows that major features are drawn in more “carefully”.
Arguably, less usefully if a broad overview is the objective.
Graphical comparison of sequences using “Dotplots”.
Using a relatively large word size of 25, features are drawn with a broad brush.
Detail can be missed
Superimposing a plot with a smaller word size of 11 shows the emergence of extra dots.
In this case probably all noise.
The Word size.Dotplot parameters.
Graphical comparison of sequences using “Dotplots”.Detection of RepeatsOther uses of dotplots.
Graphical comparison of sequences using “Dotplots”.Detection of RepeatsOther uses of dotplots.
Graphical comparison of sequences using “Dotplots”.Detection of RepeatsOther uses of dotplots.
Graphical comparison of sequences using “Dotplots”.Detection of RepeatsOther uses of dotplots.
Graphical comparison of sequences using “Dotplots”.Other uses of dotplots. Detection of Stem Loops
Graphical comparison of sequences using “Dotplots”.Other uses of dotplots. Detection of Stem Loops
The End.
top related