expression and function of kcnq channels in larval zebrafish
Post on 11-Jun-2016
216 Views
Preview:
TRANSCRIPT
Expression and Function of KCNQ Channels in LarvalZebrafish
Sally W. Chege,1 Gabriela A. Hortopan,2 Matthew T. Dinday,2 Scott C. Baraban1,2
1 PIBS Graduate Program in Neuroscience, University of California, San Francisco, San Francisco,California 94143
2 Department of Neurological Surgery, Epilepsy Research Laboratory, University of California,San Francisco
Received 6 April 2011; revised 7 June 2011; accepted 15 June 2011
ABSTRACT: Members of the Kv7 family generate
a subthreshold potassium current, termed M-current,
that regulates the excitability of principal central neu-
rons. Mutations in two members of this family, Kv7.2
(KCNQ2) and Kv7.3 (KCNQ3) are associated with a neu-
rological disorder known as benign familial neonatal
convulsion (BFNC). Despite their importance in normal
and pathological brain function, developmental expres-
sion and function of these channels remains relatively
unexplored. Here, we examined the temporal expression
of Kv7 channel subunits in zebrafish larvae using a real-
time quantitative PCR approach. Spatial expression in
the larval zebrafish brain was assessed using whole-
mount in situ hybridization. The mRNA for three mem-
bers of the Kv7 family (KCNQ2, 3 and 5) is reported in
zebrafish between two and seven days post-fertilization
(dpf). Using electrophysiological techniques, we show
that inhibitors of Kv7 channels (linopirdine and XE991)
induce burst discharge activity in immature zebrafish
between 3 and 7 dpf. This abnormal electrical activity is
blocked by a Kv7 channel opener (retigabine) and was
also shown to evoke convulsive behaviors in freely swim-
ming zebrafish. Using morpholino oligonucleotides
directed against KCNQ3, we confirmed a role for KCNQ
channels in generation of electrical burst discharges.
These results indicate that functional Kv7 channels are
expressed in the larval zebrafish nervous system and
could play a direct role in generation of seizure
activity. ' 2011 Wiley Periodicals, Inc. Develop Neurobiol 72: 186–
198, 2012
Keywords: epilepsy; morpholino; in situ; qPCR;
linopirdine
INTRODUCTION
Kv7 channels (Kv7.1-Kv7.5) are a subfamily of volt-
age-gated potassium channels, encoded by KCNQgenes. Kv7.1 (KCNQ1) is expressed predominantly in
cardiac myocytes (Sanguinetti et al., 1996) whereas
Kv7.2 - Kv7.5 (KCNQ2-5) are primarily found in the
central nervous system (CNS) (Jentsch, 2000). In the
CNS, KCNQ channels function to regulate resting
membrane potential and neuronal repolarization
(Jentsch, 2000; Cooper and Jan, 2003). KCNQ chan-
nels have the biophysical and pharmacological prop-
erties of \M-channels," first described in sympathetic
neurons (Brown and Adams, 1980), and are also
believed to be critical in controlling the responsive-
ness of a neuron to synaptic input (Brown and
Passmore, 2009). Mutations in two members of this
family, Kv7.2 (KCNQ2) and Kv7.3 (KCNQ3), are
associated with an inherited neonatal epilepsy e.g.,
Benign Familial Neonatal Convulsions (BFNC)
(Charlier et al., 1998; Singh et al., 1998).
Heterologous expression of KCNQ2 or KCNQ3 in
Xenopus ooctyes has shown that BFNC channel
mutations cause reductions in potassium current
Additional Supporting Information may be found in the onlineversion of this article.
Correspondence to: Scott C. Baraban (scott.baraban@ucsf.edu).
' 2011 Wiley Periodicals, Inc.Published online 20 June 2011 in Wiley Online Library(wileyonlinelibrary.com).DOI 10.1002/dneu.20937
186
amplitude suggesting that seizures could result from a
reduction in M-current (Cooper, 2001). Mice with
knock-in of the human KCNQ3 pore mutation exhibit
a significant reduction in IK(M) density in all hippocam-
pal CA1 pyramidal neurons and a reduced threshold
for seizures (Singh et al., 2008; Otto et al., 2009). A
functional role for Kv7 channels in seizures was further
inferred from observations that broad spectrum Kv7
blockers, linopirdine and XE991, increased and/or
induced interictal bursting in isolated hippocampal sli-
ces (Pena and Alavez-Perez, 2006; Qiu et al., 2007).
Augmenting M-channel function with retigabine, an
activator of potassium channels encoded by KCNQ2-5but not KCNQ1 (Main et al., 2000; Schenzer et al.,
2005; Wuttke et al., 2005), lead to a cessation of burst-
ing. This transition to ictal-like epileptiform bursting
was not a general effect of potassium channel blockade,
as blockers of calcium-dependent potassium channels,
and an inwardly rectifying potassium channel, did not
yield similar results. More recently, retigabine and a
second KCNQ channel activator flupirtine, were shown
to exhibit anticonvulsant activity in vivo (Raol et al.,
2009; Fritch et al., 2010) presumably mediated by a
critical tryptophan residue in Kv7.3 (KCNQ3)(Schenzer et al., 2005).
Despite accumulating evidence that KCNQ-encoded voltage-gated potassium channels have a
significant role in regulation of excitability and sei-
zure activity in the CNS, expression and function of
these channels in the immature nervous system is
relatively unknown (Tinel et al., 1998; Geiger et al.,
2006; Kanaumi et al., 2008). Using a simple verte-
brate species, Danio rerio (zebrafish), commonly
used in developmental neurobiology (Eisen, 1991;
Key and Devine, 2003; Dorsky, 2008) and recently
adapted to epilepsy research (Baraban et al., 2005;
Winter et al., 2008; Hortopan et al., 2010), this study
investigated KCNQ expression at RNA levels in
developing zebrafish and assessed whether KCNQchannel manipulations induce seizure activity in vivo.
MATERIALS AND METHODS
Animal Care and Maintenance
Zebrafish of the TL strain were maintained according to
standard procedures (Westerfield, 1995), and following
guidelines approved by the University of California, San
Francisco Institutional Animal Care and Use Committee
Table 1 Primer Sequences
Gene name Gene symbol GeneBank Sequence Amplicon(bp)
Beta actin b-act AF057040 F, 50 GGACTCTGGTGATGGTGTGA 30 569
R, 50 CACCGATCCAGACGGAGTAT 30
F, 50 GCTACAGCTTCACCACCACA 30 596
R, 50 GGTTGGTCGTTCGTTTGAAT 30
Potassium voltage-gated
channel,
kcnq2 XM_694873 F, 50 GGTGAAGAAATCCGCCAAC 30* 258
KQT-like subfamily,
member 2
R, 50 CGCTCCAGAGCATTATACAGG 30*
F, 50 CGCTACAGAGGATGGAGAGG 30 * 736
R, 50 CCTTCAGAGCAAACCCTGAG 30 *XM_003198845 F, 50 TGCAGTCCAGAGTGGATCAG 30 317
R, 50 GTTGGAGCGGATGATTTTGT 30
Potassium voltage-gated
channel,
kcnq3 XM_692257 F, 50 GTGGTACATCGGCTTCCTG 30 * 1247
KQT-like subfamily,
member 3
R, 50 CGGCGGATGTGTGTAGTA 30 *
F, 50 GAGCTGATCACAGCGTGGTA 30 547
R, 50 GAGTCGACAGACGAACACGA 3 0
Potassium voltage-gated
channel,
kcnq5 XM_679763 F, 50 GTGTTGCAGAAAGGCTCCTC 30* 947
KQT-like subfamily,
member 5
R, 50 TCTCTTGGTCCAGCCTGACT 30 *
F, 50 ATTTGAAGGCGTTGCATACC 30 419
R, 50 CTTTTTGGCCACATGGAACT 30
kcnq5b XM_691989 F, 50 CTCCGTCTCAAGAGCCAATC 30 376
R, 50 GCATGCTCACATCTTCCAGA 30
KCNQ Channels in Larval Zebrafish 187
Developmental Neurobiology
(AN-080522-03). Zebrafish embryos and larvae were main-
tained in egg water (0.03% Instant Ocean) unless otherwise
stated.
Electrophysiology
Zebrafish larvae at 3–7 dpf were immobilized in 1.2% low-
melting temperature agarose in zebrafish egg water. Larvae
were embedded so that the dorsal aspect of the brain was
accessible for electrode placement. Embedded larvae were
bathed in egg water and visualized using a Leica stereo-
microscope. Under direct visual guidance, a glass micro-
electrode (*1.2 lm tip diameter, 2–7 MO) was placed in
the optic tectum, the largest midbrain structure in the zebra-
fish. Electrodes were filled with 2M NaCl and electrical ac-
tivity was recorded using an Axopatch 1D amplifier (Axon
Instruments). Voltage records were low-pass filtered at 1–2
kHz (�3 dB, 8-pole Bessel), high-pass filtered at 0.1–0.2
Hz, digitized at 5–10 kHz using a Digidata 1300 A/D inter-
face, and stored on a PC computer running pClamp soft-
ware (Axon Instruments). Electrophysiological recordings
were analyzed post hoc using Clampfit software (Axon
Instruments). Spontaneous gap-free recordings, 5–10 min
in duration, were analyzed for all fish. A threshold for
detection of spontaneous events was set at 33 noise (peak-
to-peak amplitude) and 100 ms (duration); all events
exceeding these thresholds were analyzed.
Behavioral Monitoring
Single zebrafish larvae (5–7 dpf) were placed individually
in 96-well Falcon culture dishes (BD Biosciences, Franklin
Lakes, NJ). Each well-contained 100 lL embryo medium.
Swimming behavior was monitored for 2 min epochs for all
pharmacological treatments by using a 1/3" (Sentec BJ, Ja-
pan) or 1/2" (Hamamatsu C-2400, Japan) CCD camera and
EthoVision 3.0 locomotion tracking software (Noldus In-
formation, Inc., Leesburg, VA). The locomotion tracking
software detects objects darker than background and
detection parameters are set at baseline for each fish.
Locomotion tracking data for the LPD dose-response
studies [Fig. 4(A-B)] was obtained using the more sensitive
Hamamatsu CCD camera equipped with a separate camera
controller (C2741-62) providing additional contrast
enhancement, noise reduction and shadow correction. Pre-
vious studies (Baraban et al., 2005, 2006) established a sei-
zure scoring system whereby zebrafish larvae freely swim-
ming in 15 mM PTZ progress through three stages of sei-
zure behavior (i) Stage I, increased swim activity, (ii) Stage
2, whirlpool-like circling, and (iii) Stage 3, clonus-like
whole-body convulsions followed by a brief loss of posture.
RNA Isolation, PCR, Cloning, andSequencing
Total RNA was isolated from 10 pools of larvae (between
5-10 fish/pool) at different stages of development (2–7 dpf
or adult) using Trizol1 Reagent (Invitrogen, Carlsbad,
CA), treated by RNase-free DNase to remove possible
genomic DNA contamination and quantified with Nanodrop
ND-1000 Spectrophotometer. 1 lg RNA was used to gener-
ate cDNA using SuperScript2 III First-Strand Synthesis
System (Invitrogen) according to the manufacturer’s proto-
col. Primers pairs, forward and reverse, were specifically
designed using Primer 3 web software (http://frodo.wi.mi-
t.edu/primer3/) for each investigated gene (primer sequen-
ces are available in Table 1). Further, the cDNA was ampli-
fied in a polymerase chain reaction (PCR), each reaction
cycle (32 loops) consisted of incubations at 948C (30 s),
608C (30 s), and 728C (60 s) with Taq DNA Polymerase
(Taq PCR Core kit, Qiagen). A 2% agarose gel electropho-
resis stained with ethidium bromide was used to separate
Table 2 Probe Sequences
Gene name Gene symbol GeneBank Sequence Amplicon(bp)
Beta actin b-act AF057040 F, 50 CATCCATCGTTCACAGGAAGTG 30 83
R, 50 TGGTCGTTCGTTTGAATCTCAT 30
Potassium voltage-gated
channel,
kcnq2 XM 694873 F, 50 CATCGCTCACAAGAGAAACG 30 6 6
KQT-like subfamily,
member 2
R, 50 CGCTCCAGAGCATTATACAGG 3 0
kcnq2 XM 003198845 F, 50 GCAGTATTCAGCCGGACATC 30 62
R, 50 CCACTCTGGACTGCAGGTTT 30
Potassium voltage-gated
channel,
kcnq3 XM 692257 F, 50 CGGTGGTTGCCGTACGTAAT 30 84
KQT-like subfamily,
member 3
R, 5 GCAGCATCCGGAGGATCTG 30
Potassium voltage-gated
channel,
kcnq5 XM 67 97 63 F, 50 AGTGTGTGTGGCGTAGCTATGC 30 82
KQT-like subfamily,
member 5
R, 50 GTATGCAACGCCTTCAAATGAG 30
kcnq5b XM 691989 F, 50 TGCCAAGGTCCAGAAGAGTTG 30 81
R, 50 GACCGTGATTGGCTCTTGAGA 30
188 Chege et al.
Developmental Neurobiology
the PCR products which were further cloned using TOPO
TA Cloning System (Invitrogen) according to the manufac-
turer’s specifications. DNA sequencing was performed by
Elim Biopharmaceuticals, Inc. (Hayward, CA).
Quantitative Real-Time PCR (qPCR)
Gene expression levels were determined by real-time qPCR
using SybrGreen1 fluorescent master mix on StepOne-
Plus2 Real-Time PCR System (Applied Biosystems). The
cDNA templates were diluted 1:2 with DEPC (Diethyl
pyrocarbonate) sterile water before qPCR applications to
minimize the presence of potential inhibitors. Primer
Express v3.0 software (Applied Biosystems) was used to
design all primers on our own sequenced cDNA (Table 2)
and then synthesized by Invitrogen. Samples were run in
triplicate in 10 lL of 13 SYBR green master mix contain-
ing 100 nM of each primer and RNAse free water. Control
samples without reverse transcriptase and samples without
RNAs were run for each reaction as negative controls. Cy-
cling parameters were as follows: 508C 3 2min, 958C 3 10
min, then 45 cycles of the following 958C 3 15 s, 608C 31 min. For each sample a dissociation step was performed
at 958C 3 15 s, 608C 3 20 s and 958C 3 15 s. Dissociation
(melting) curve analysis showed no sign of primer-dimers
or nonspecific products. A four-fold serial dilution of
pooled cDNA (5 standards assayed in triplicate: 1/1; 1/4; 1/
16; 1/64; 1/256) was used to estimate the qPCR efficiencies
for all investigated genes. A separate assay was done to
identify the most stable reference gene as described in Hor-
topan et al., 2010; b-actin was used in our studies for data
normalization. Relative quantification of the target genes
with b-act was made following both the Comparative
DDCT (Livak and Schmittgen, 2001) and the Efficiency
Based method (Pfaffl, 2001). Similar results were obtained
with both types of analyses.
Whole-Mount In Situ Hybridization(WISH)
Antisense and sense RNA probes (Table 2) were generated
from plasmids corresponding to each of the three KCNQgenes using specific restriction enzymes for linearization
(New England Biolabs, UK). The linearized DNA template
(1 lg) was purified (QIAquick1, Qiagen) and incubated for
3 h at 378C in a solution containing 10X transcription
buffer, dithiothreitol (DTT; 100 mM), 10X Dig NTP Mix
(Roche), RNAse inhibitor (20 U/lL), and RNA polymerase
(20 U/lL) T7 or SP6. After digestion of the DNA template
with DNase (10 U/lL) for 15 min at 378C and incubation,
the product was purified using a mix of RNAse-free water
and LiCl (30 lL, 1:2) and left overnight at �208C. At theend, after centrifugation at 48C and washing with 70% etha-
nol (RNAse free), the pellet was dried and stored in hybrid-
ization mix solution at �208C until use. At 2–7 dpf larvae
were sorted and fixed in 4% paraformaldehyde (PFA) then
stored in 100% methanol at �208C. Following storage at
�208C, fixed larvae were rehydrated in a series of methanol
and PBS-0.1%Tween20 (PBST) washes. Whole-mount insitu hybridization was performed as previously described
(Hortopan et al., 2010).
Morpholino Injections
Morpholino-based antisense oligonucleotides (MOs) were syn-
thesized by Gene Tools (Philomath, Oregon). One KCNQ3
MO (referred to here as ATG) targeted the predicted translation
start methionine of KCNQ3 and had 25 residues with the
following sequence: 50CGGCATTTCTGGACCTGATCCCCAT-30. A second KCNQ3 MO (referred to here as Ex4) tar-
geted the splice junction between exon 4 and intron 4 with the
sequence: 50CACATCACATTCGGATACCTTGCTG-30. To
control for nonspecific effects of oligonucleotide injection, a
negative control \vivo-MO" provided by Gene Tools with the
sequence 50CCTCTTACCTCAGTTACAATTTATA-30 was
used. This MO targets a human b-globin intron mutation and
has not been reported to have significant biological activity in
zebrafish (Bill et al., 2009). Vehicle-injected and un-injected
embryos also served as controls. All MOs were pressure-
injected as a bolus * 1/6 of egg volume into one-to-four cell
stage embryos at concentrations ranging between 8 and 16 mMin 1X Danieau’s buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mMMgSO4, 0.6 mM Ca(NO3)2, and 5 mM HEPES pH 7.6).
Abnormal splicing for the KCNQ3 splice-blocking morpholino
was confirmed by qPCR (data not shown). MOs were eval-
uated between 3 and 5 dpf.
Microscopy and Imaging
Pictures of whole-mount in situ hybridization embryos
mounted in 70% glycerol were taken using a Zeiss Axio-
skop microscope equipped with Optronics MicroFire cam-
era computer controlling system. Raw images were
imported into Adobe Photoshop and slightly adjusted for
contrast and sharpness.
Figure 1 Schematic showing phylogenetic comparison of
KCNQ sequences (NCBI database) from drosophila, human,
mouse, and zebrafish based on Clustal W sequence align-
ment. Highlighted: zebrafish KCNQ2, KCNQ3, KCNQ5 are
most closely related to their respective M-channel associated
mammalian counterparts. [Color figure can be viewed in the
online issue, which is available at wileyonlinelibrary.com.]
KCNQ Channels in Larval Zebrafish 189
Developmental Neurobiology
RESULTS
Channel Expression
First, we performed a phylogenetic analysis of KCNQcDNA sequences from zebrafish, human, mouse and
Drosophila using Clustal W sequence alignment soft-
ware (Lasergene). This program determines sequence
similarity and assigns phylogenetic relationships based
on the similarity or differences between published gene
sequences. Zebrafish zKCNQ2 (Kv7.2), zKCNQ3(Kv7.3), and zKCNQ5 (Kv7.5), clustered with human
and mouse KCNQ2, 3 and 5 respectively, and indicated
a divergence from Drosophila KCNQ (see Fig. 1). Real-
time quantitative PCR was performed to investigate the
temporal expression of KCNQ genes in developing (2–7
dpf) zebrafish larvae. zKCNQ2-2B mRNA was first
present at 2 dpf, maintained at a fairly stable level
through 7 dpf [Fig. 2(A)]. zKCNQ3 mRNA was highly
expressed at 2 and 3 dpf, decreased at 4 dpf and gradu-
ally increased between 5 and 7 dpf [Fig. 2(B)].
zKCNQ5-5B mRNA increased in a linear age-dependent
fashion between 2 and 4 dpf and then plateaued between
4 and 7 dpf [Fig. 2(C)]. Specificity of the primers was
confirmed using conventional RT-PCR and melting
curves were analyzed for all primer sets during the real-
time analysis (data not shown). Next, a series of whole-
mount in situ hybridizations was performed to investi-
gate the spatial expression of zKCNQ genes in the devel-
oping zebrafish. Diffuse expression of all three zKCNQgenes in regions corresponding to the central nervous
system of the zebrafish (e.g., telencephalon, preoptic
area, optic tectum and cerebellum) was first observed at
2 dpf and remained prominent through 7 dpf. zKCNQ2and zKCNQ3 expression appeared to co-localize in the
CNS, as expected (Cooper et al., 2000). Representative
Figure 2 Gene expression detection of zKCNQ genes using quantitative real-time PCR (qPCR).
Levels of mRNA (shown as mean 6 SEM), measured by qPCR were normalized to b-act and are
shown for 2 through 7 dpf. Abbreviations: kcnq2, potassium voltage-gated channel, KQT-like sub-
family, member 2; kcnq3, potassium voltage-gated channel, KQT-like subfamily, member 3;
kcnq5, potassium voltage-gated channel, KQT-like subfamily, member 5.
190 Chege et al.
Developmental Neurobiology
whole-mount images for each gene are shown in Figure
3; sense probe control trials are shown below.
Behavioral Analysis
Behavioral manifestations of electrographic seizures
include episodes of excessive locomotor activity and
myoclonus of all four limbs, and are well character-
ized in rodent models of epilepsy (Pitkanen et al.,2006). Similar stereotyped behaviors occur in imma-ture zebrafish exposed to convulsant drugs (Barabanet al., 2005; Baraban et al., 2007). To determinewhether blocking M-channels results in seizure-likebehaviors, we exposed zebrafish (5–7 dpf) tolinopirdine (LPD) at concentrations between 25 and200 lM. Vehicle-exposed controls (n ¼ 50) exhibitlittle or no locomotor activity during these recording
Figure 3 KCNQ2, KCNQ3, and KCNQ5 mRNA expression in developing zebrafish larvae. WISH
panels showing expression in the head and eye are shown for all three genes. Whole mount images
are shown in lateral views. Sense probe control images are shown at bottom. Scale bar: 0.2 mm.
[Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
KCNQ Channels in Larval Zebrafish 191
Developmental Neurobiology
epochs (Supporting Information Video 1). However,notable increases in locomotor activity with fastwhole-body twitch-like convulsions were observed inzebrafish exposed to LPD (Fig. 4; Supporting Infor-mation Video 2). Less activity was observed at a bathconcentration of 200 lM (n ¼ 12) which, with pro-longed exposure, appeared to be toxic. Similar behav-iors were observed with exposure to 100 lM XE991(Supporting Information Video 3). Qualitatively
based on a scoring system established previously(Baraban et al., 2005), control zebrafish exhibitedbehaviors categorized as Stage 0 (little or no swim ac-tivity). Zebrafish exposed to 25 lM LPD (n ¼ 9)mainly exhibited behaviors consistent with Stage I(increased swim activity) whereas those exposed tobath concentrations between 50 (n ¼ 7) and 100 lM(n ¼ 22) LPD exhibited activity closer to Stage 3(increased activity plus brief clonus-like convulsions)
Figure 4 Electrophysiological response to KCNQ channel modulating drugs. A: Representative
tectal field recording from zebrafish larvae bathed in embryo media (baseline) and *30 min after
exposure to media containing 100 lM LPD. Note the presence of abnormal burst-like discharge ac-
tivity. B: Only very small and brief spontaneous activity was noted at baseline (triangle in A). In
contrast, large long-duration multi-spike burst activity was noted following exposure to LPD (tri-
angle in A) or XE991. C: Bar plot of burst frequency for fish exposed to embryo media (control),
retigabine (RTG), linopirdine + retigabine (LPD + RTG), XE991 or LPD. Burst frequency was sig-
nificantly increased in the LPD exposed fish compared with control (*p < 0.05). Plots represent
mean 6 S.E.M. D: Similar plot for burst duration. [Color figure can be viewed in the online issue,
which is available at wileyonlinelibrary.com.]
192 Chege et al.
Developmental Neurobiology
[Fig. 4(B)]. Representative locomotion plots for indi-vidual zebrafish are shown in Figure 3(A). Similarconvulsive behaviors were observed with 100 lMLPD (n ¼ 10) or 100 lM XE99 (n ¼ 9); these werereduced to control Stage 0 levels with coapplication of100 lM retigabine, a Kv7 channel opener [Fig. 4(C)].
Electrophysiological Analysis
Previous work (Baraban et al., 2005, 2007) demon-
strated that it is possible to induce electrographic
seizure-like activity in immature zebrafish with expo-
sure to convulsant drugs. Taking a similar approach,
we exposed agar-immobilized zebrafish (3–7 dpf) to
different concentrations of LPD (5–200 lM) for peri-
ods up to 1 h. CNS activity was monitored using an
extracellular field electrode placed, under visual guid-
ance, in the optic tectum. Abnormal epileptiform
electrical bursts [Fig. 5(A,B)] were visible beginning
at a bath concentration of 50 lM LPD and remained
stable up to 200 lM LPD (note: this concentration
also led to a reduction in heart rate and death with
prolonged exposure). Under control recording condi-
tions in embryo media, only rare and very brief bursts
Figure 5 Seizure-like behaviors in zebrafish larvae. A: Representative locomotion tracking plots
of individual zebrafish larvae during the different treatment conditions shown in B. B: Quantifica-
tion of changes in locomotion during treatment with increasing concentrations of LPD, compared
with control (vehicle), 25, 50, and 100 lM LPD cause significant increases in locomotor activity.
C: Quantification of changes in locomotion during exposure to 100 lM LPD or 100 lM XE991 and
coapplication of 100 lM RTG. Plots represent mean 6 SEM. Significance taken as **p < 0.001 or
*p < 0.05 ANOVA (in B) or Student’s t test (in C).
KCNQ Channels in Larval Zebrafish 193
Developmental Neurobiology
of spontaneous activity were observed [n ¼ 20;
Fig. 5(A,B)]. 100 lM XE991 elicited similar electro-
graphic activity [Fig. 4(B)], though at a lower burst
frequency [Fig. 5(C,D)]. Epileptiform activity
induced with both M-channel blockers could be abol-
ished with coapplication of 100 lM retigabine [Fig.
5(C,D)]; retigabine alone did not evoke spontaneous
burst activity different from that observed with embryo
media [Fig. 5(C,D)]. Retigabine also abolished burst
activity in fish pretreated with LPD (LPD: 0.96 6 0.2
bursts/min; LPD + RTG: 0.07 6 0.04 bursts/min; n ¼17; p < 0.001). LPD-induced bursts occurred in an
\all-or-none" fashion starting at 5 lM and did not
increase in duration with higher drug concentrations
[Fig. 6(A)]. Low concentrations of LPD (5 or 25 lM)
elicited long-duration bursts at a frequency similar to
the short-duration bursts seen with embryo media; at
higher LPD concentrations (50 or 100 lM) burst
frequency was significantly greater [Fig. 6(B)].
Morpholino Studies
To determine whether morpholino oligonucleotides
(MO) targeting zKCNQ3 result in seizure-like pheno-
types similar to those observed with pharmacological
manipulations, we obtained tectal extracellular field
recordings from agar-immobilized zebrafish (3–5
dpf). Abnormal epileptiform electrical bursting [Fig.
7(A)] was observed in 71.4% of ATG MO (n ¼ 35)
and 70.8% of Ex4 MO (n ¼ 65) larvae. Similar to
pharmacological studies, large multispike bursts
>250 msec in duration were consistently observed
[Fig. 7(B,C)]. Only short duration discharges were
observed in 20% of control MO (n ¼ 10), 33% of ve-
hicle injected (n ¼ 9) and 23% of uninjected (n ¼ 13)
WT larvae [Fig. 7(C)]. Tectal recordings also
revealed significantly increased burst frequency in
both ATG MO (0.31 6 0.06 bursts/min; p < 0.001
ANOVA), and Ex4 morphant larvae (0.28 6 0.04
bursts/min; p < 0.001 ANOVA) compared with three
control conditions [Fig. 6(D)].
DISCUSSION
KCNQ2 and KCNQ3 are widely expressed in the hip-
pocampus, neocortex and cerebellar cortex of the
rodent and human brain (Cooper et al., 1998; Cooper
et al., 2000; Saganich et al., 2001; Geiger et al., 2006;
Weber et al., 2006). KCNQ5 is also expressed in the
adult rodent brain where it colocalizes with KCNQ2
and KCNQ3 (Schroeder et al., 2000; Jensen et al.,
2005). Here, we have shown using quantitative PCR
that zKCNQ2 and zKCNQ3 are expressed at fairly sta-ble levels in larval zebrafish. zKCNQ5 mRNA
increases in a linear fashion between 2 and 7 dpf.
Using whole-mount in situ hybridization all three
subunits were found to be widely and diffusely
expressed in CNS structures. In the mouse cortex, an
increasing intensity of KCNQ3 expression was
observed between approximately postnatal Days 3
and 30 (Timel et al., 1998; Geiger et al., 2006); the
expression of KCNQ3 was shown to increase in late
fetal life through infancy in humans (Kanaumi et al.,
2008). Our qPCR data for zKCNQ3 between 4 and 7
dpf is consistent with these findings and would
suggest that this developmental epoch in the zebrafish
Figure 6 Linopirdine (LPD) induced electrographic burst-
ing in the zebrafish tectum. (A) Dose-response plot of burst
duration (in sec) at different concentrations of bath applied
LPD. At least 10 bursts were analyzed for each trace (n ¼ 9
separate fish for each bar). Plots represent mean 6 S.E.M.
*Significance taken as p < 0.001 ANOVA. (B) Bar plot of
burst frequency (in bursts per min) at different concentrations
of bath applied LPD. At least 10 bursts were analyzed for
each trace (n ¼ 9 separate fish for each bar). Plots represent
mean6 S.E.M. *Significance taken as p < 0.001 ANOVA.
194 Chege et al.
Developmental Neurobiology
may correspond to the first month of postnatal
development in the mouse; a stage of brain matura-
tion thought to be comparable with the neonatal pe-
riod in humans (Clancy et al., 2001). KCNQ2 expres-
sion increases rapidly with the first week of life in rat
CNS (Tinel et al., 1998); KCNQ2 immunoreactivity
in humans was noted as early as 22 gestational weeks
(GW) and increased gradually from 29 GW to three
months of age (Kanaumi et al., 2008). Although we
did not examine zebrafish developmental epochs ear-
lier than 48 h postfertilization because these ages are
too early to assess physiological activity, zKCNQ2mRNA was observed between 2 and 7 dpf but lacked
any clear age-dependent changes during this period.
Developmental changes in KCNQ5 have not been
reported for human or rodent tissue, however, our
Figure 7 Electrophysiological activity in KCNQ morphant larvae. A: Representative tectal field
recording from MO zebrafish larvae bathed in embryo media. Sample gap-free recordings are
shown for ATG and Ex4 KCNQ3 MOs. B: Burst discharges are shown at high resolution below
(triangle denotes site in gap-free recording). Note the presence of abnormal burst-like discharge ac-
tivity similar to that observed with pharmacological manipulation [compare with Fig. 4(A)]. C: Bar
plot of burst frequency. D: Bar plot of burst duration. Plots represent mean 6 SEM. **Significance
taken as p < 0.001, ANOVA.
KCNQ Channels in Larval Zebrafish 195
Developmental Neurobiology
qPCR data reveal an interesting increase in zKCNQ5mRNA between 3 and 7 dpf zebrafish. Recent immu-
nohistochemical studies indicate that KCNQ2 and
KCNQ3 are concentrated at the axon initial segment
and nodes of Ranvier of central principal neurons
(Pan et al., 2006) and a subset of parvalbumin-
expressing interneurons (Lawrence et al., 2006). In
mammalian brain, they are also expressed at lower
densities at cell somata and possibly dendrites (Gei-
ger et al., 2006). Although suitable antibodies recog-
nizing KCNQ subunits in zebrafish are not yet avail-
able, our in situ hybridization studies suggest colocal-
ization of these subunits in relevant structures of the
developing zebrafish nervous system. From these
mRNA expression studies we surmise that KCNQ
channels may have functional roles.
Mutations in Kv7 subunits cause epilepsy in
humans (Charlier et al., 1998; Singh et al., 1998) and
mice (Peters et al., 2005; Singh et al., 2008; Otto et
al., 2009). CNS structures expressing these subunits,
such as the hippocampus and cortex, are strongly
implicated in the generation of seizure activity. At
the single-cell level, Kv7 channels shape the intrinsic
firing activity of hippocampal neurons (Shah et al.,
2008; Tzingounis and Nicoll, 2008) and a slow after-
hyperpolarization that regulates the level of neuronal
excitability (Tzingounis et al., 2010). Linopridine, an
inhibitor of Kv7 channels, was shown to induce ictal-
like bursting in immature cortical-hippocampal slices
following sustained acute exposure (Pena and
Alvarez, 2006) and facilitated the transition from
interictal to ictal bursting in immature hippocampal
slices (Qiu et al., 2007). Here we used an intact invivo preparation to show that exposure to LPD indu-
ces multi-spike burst discharge activity, *200 to 300
ms in duration, in larval zebrafish in a concentration-
dependent manner. In the present study, we also per-
formed gene knockdown of zKCNQ3 using morpho-
lino-based oligonucleotide and found multispike burst
discharge activity comparable with that observed
with pharmacological manipulations. In both cases,
these bursts are similar to those classified as \ictal"upon exposure of larval zebrafish to pentylenetetra-
zole, a common convulsant agent (Baraban et al.,
2005) or those observed spontaneously in a zebrafish
ubiquitin E3 ligase mutant homologous to the human
condition Angelman syndrome (Hortopan et al.,
2010). Nearly identical patterns of activity were seen
when zKCNQ3 expression was knocked down using
morpholino antisense oligonucleotides suggesting a
direct link between KCNQ channel function and epi-
leptic activities. The mechanism for generation of
burst activity in zebrafish is consistent with inhibition
of Kv7 channels as it was also observed with XE991
and abolished by coapplication of a Kv7 channel
opener (retigabine). Behaviors consistent with seizure
activity were also observed following bath applica-
tion of LPD or XE991 and in both cases these behav-
iors were blocked by coapplication of RTG. Based on
single-cell recording studies from CA1 hippocampal
neurons it is thought that inhibition of Kv7 channel ac-
tivity by linopirdine or XE991 directly depolarizes
neurons leading to an increase in spontaneous action
potential firing (Shah et al., 2008). In CA3 hippocam-
pal pyramidal neurons in slices prepared from neonatal
rats (P14-P16), linopirdine block of Kv7 channels
leads to a pronounced increase in the frequency and
duration of intrinsic bursts. Although both of these
mechanisms are consistent with an increase in excita-
tion and could underlie generation of synchronized
spontaneous ictal bursts, the presence of Kv7 channels
on a subset of hippocampal interneurons and the
increased firing of these inhibitory cells seen with bath
application of linopirdine (Lawrence et al., 2006) sug-
gests that further in vivo studies will be required to pre-cisely evaluate the contribution of these channels to
epileptic activities. Because all three Kv7 subunits
(i.e., KCNQ2, 3, and 5) are expressed in the CNS of
larval zebrafish during the stages of development at
which manipulations were performed and each of
these, including KCNQ5 splice variants (Yeung et al.,
2008), are sensitive to blockade by LPD/XE991 or
activation by retigabine it is suggested that zebrafish
could be an ideal system in which to further investigate
the function and expression of these channels.
REFERENCES
Baraban SC, Dinday MT, Castro PA, Chege S, Guyenet S,
Taylor MR. 2007. A large-scale mutagenesis screen to iden-
tify seizure-resistant zebrafish. Epilepsia 48:1151–1157.
Baraban SC, Taylor MR, Castro PA, Baier H. 2005. Pentyle-
netetrazole induced changes in zebrafish behavior, neural
activity and c-fos expression. Neuroscience 131:759–768.
Bill BR, Petzold AM, Clark KJ, Schimmenti LA, Ekker SC.
2009. A primer for morpholino use in zebrafish. Zebra-
fish 6:69–77.
Brown DA, Adams PR. 1980. Muscarinic suppression of a
novel voltage-sensitive K+ current in a vertebrate neu-
rone. Nature 283:673–676.
Brown DA, Passmore GM. 2009. Neural KCNQ (Kv7)
channels. Br J Pharmacol 156:1185–1195.
Charlier C, Singh NA, Ryan SG, Lewis TB, Reus BE,
Leach RJ, Leppert M. 1998. A pore mutation in a novel
KQT-like potassium channel gene in an idiopathic epi-
lepsy family. Nat Genet 18:53–55.
Clancy B, Darlington RB, Finlay BL. 2001. Translating
developmental time across mammalian species. Neuro-
science 105:7–17.
196 Chege et al.
Developmental Neurobiology
Cooper EC. 2001. Potassium channels: How genetic studies
of epileptic syndromes open paths to new therapeutic tar-
gets and drugs. Epilepsia 42 Suppl 5:49–54.
Cooper EC, Aldape KD, Abosch A, Barbaro NM, Berger
MS, Peacock WS, Jan YN, et al. 2000. Colocalization
and coassembly of two human brain M-type potassium
channel subunits that are mutated in epilepsy. Proc Natl
Acad Sci USA 97:4914–4919.
Cooper EC, Jan LY. 2003. M-channels: Neurological dis-
eases, neuromodulation, and drug development. Arch
Neurol 60:496–500.
Cooper EC, Milroy A, Jany YN, Jan LY, Lowenstein DH.
1998. Presynaptic localization of Kv1.4-containing A-
type potassium channels near excitatory synapses in the
hippocampus. J Neurosci 18:965–974.
Dorsky RI. 2008. Neural patterning and CNS functions of
Wnt in zebrafish. Methods Mol Biol 469:301–315.
Eisen JS. 1991. Developmental neurobiology of the zebra-
fish. J Neurosci 11:311–317.
Fritch PC, McNaughton-Smith G, Amato GS, Burns JF,
Eargle CW, Roeloffs R, Harrison W, et al. 2010. Novel
KCNQ2/Q3 agonists as potential therapeutics for epi-
lepsy and neuropathic pain. J Med Chem 53:887–896.
Geiger J, Weber YG, Landwehrmeyer B, Sommer C, Lerche
H. 2006. Immunohistochemical analysis of KCNQ3 potas-
sium channels in mouse brain. Neurosci Lett 400:101–104.
Hortopan GA, Dinday MT, Baraban SC. 2010. Spontaneous
seizures and altered gene expression in GABA signaling
pathways in a mind bomb mutant zebrafish. J Neurosci
30:13718–13728.
Hortopan GA, Dinday MT, Baraban SC. 2010. Zebrafish as
a model for studying genetic aspects of epilepsy. Dis
Model Mech 3:144–148.
Jensen HS, Callø K, Jespersen T, Jensen BS, Olesen SP.
2005. The KCNQ5 potassium channel from mouse: A
broadly expressed M-current like potassium channel
modulated by zinc, pH, and volume changes. Brain Res
Mol Brain Res 139:52–62.
Jentsch TJ. 2000. Neuronal KCNQ potassium channels: Phys-
iology and role in disease. Nat Rev Neurosci 1:21–30.
Kanaumi T, Takashima S, Iwasaki H, Itoh M, Mitsudome
A, Hirose S. 2008. Developmental changes in KCNQ2
and KCNQ3 expression in human brain: possible contri-
bution to the age-dependent etiology of benign familial
neonatal convulsions. Brain Dev 30:362–369.
Key B, Devine CA. 2003. Zebrafish as an experimental
model: strategies for developmental and molecular neu-
robiology studies. Methods Cell Sci 25:1–6.
Lawrence JJ, Saraga F, Churchill JF, Statland JM, Travis
KE, Skinner FK, McBain CJ. 2006. Somatodendritic
Kv7/KCNQ/M channels control interspike interval in
hippocampal interneurons. J Neurosci 26:12325–12338.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the
2(-Delta Delta C(T)) Method. Methods 25:402–408.
Main MJ, Cryan JE, Dupere JR, Cox B, Clare JJ, Burbidge
SA. 2000. Modulation of KCNQ2/3 potassium channels
by the novel anticonvulsant retigabine. Mol Pharmacol
58:253–262.
Otto JF, Singh NA, Dahle EJ, Leppert MF, Pappas CM,
Pruess TH, Wilcox KS, et al. 2009. Electroconvulsive
seizure thresholds and kindling acquisition rates are
altered in mouse models of human KCNQ2 and KCNQ3
mutations for benign familial neonatal convulsions. Epi-
lepsia 50:1752–1759.
Pan Z, Kao T, Horvath Z, Lemos J, Sul JY, Cranstoun SD,
Bennett V, et al. 2006. A common ankyrin-G-based mech-
anism retains KCNQ and NaV channels at electrically
active domains of the axon. J Neurosci 26:2599–2613.
Pena F, Alavez-Perez N. 2006. Epileptiform activity
induced by pharmacologic reduction of M-current in the
developing hippocampus in vitro. Epilepsia 47:47–54.
Peters HC, Hu H, Pongs O, Storm JF, Isbrandt D. 2005.
Conditional transgenic suppression of M channels in
mouse brain reveals functions in neuronal excitability,
resonance and behavior. Nat Neurosci 8:51–60.
Pfaffl MW. 2001. A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids Res
29:e45.
Pitkanen A, Schwartzkroin PA, Moshe SL. 2006. Models of
Seizures and Epilepsy. Amsterdam, Boston: Elsevier
Academic.
Qiu C, Johnson BN, Tallent MK. 2007. K+ M-current regu-
lates the transition to seizures in immature and adult hip-
pocampus. Epilepsia 48:2047–2058.
Raol YH, Lapides DA, Keating JG, Brooks-Kayal AR,
Cooper EC. 2009. A KCNQ channel opener for experi-
mental neonatal seizures and status epilepticus. Ann
Neurol 65:326–336.
Saganich MJ, Machado E, Rudy B. 2001. Differential expres-
sion of genes encoding subthreshold-operating voltage-
gated K+ channels in brain. J Neurosci 21:4609–4624.
Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS,
Atkinson DL, Keating MT. 1996. Coassembly of
K(V)LQT1 and minK (IsK) proteins to form cardiac
I(Ks) potassium channel. Nature 384:80–83.
Schenzer A, Friedrich T, Pusch M, Saftig P, Jentsch TJ,
Grotzinger J, Schwake M. 2005. Molecular determinants
of KCNQ (Kv7) K+ channel sensitivity to the anticonvul-
sant retigabine. J Neurosci 25:5051–5060.
Schroeder BC, Hechenberger M, Weinreich F, Kubisch C,
Jentsche TJ. 2000. KCNQ5, a novel potassium channel
broadly expressed in brain, mediates M-type currents. J
Biol Chem 275:24089–24095.
Shah MM, Migliore M, Valencia I, Cooper EC, Brown DA.
2008. Functional significance of axonal Kv7 channels in
hippocampal pyramidal neurons. Proc Natl Acad Sci
USA 105:7869–7874.
Singh NA, Charlier C, Stauffer D, DuPont BR, Leach RJ,
Melis R, Ronen GM, et al. 1998. A novel potassium
channel gene. KCNQ2, is mutated in an inherited epi-
lepsy of newborns. Nat Genet 18:25–29.
Singh NA, Otto JF, Dahle EJ, Pappas C, Leslie JD, Vilay-
thong A, Noebels JL, et al. 2008. Mouse models of
human KCNQ2 and KCNQ3 mutations for benign fami-
lial neonatal convulsions show seizures and neuronal
plasticity without synaptic reorganization. J Physiol
586:3405–3423.
KCNQ Channels in Larval Zebrafish 197
Developmental Neurobiology
Tinel N, Lauritzen I, Chouabe C, Lazdunski M, Borsotto
M. 1998. The KCNQ2 potassium channel: Splice var-
iants, functional and developmental expression. Brain
localization and comparison with KCNQ3. FEBS Lett
438:171–176.
Tzingounis AV, Heidenreich M, Kharkovets T, Spitzmaul
G, Jensen HS, Nicoll RA, Jentsch TJ. 2010. The KCNQ5
potassium channel mediates a component of the afterhy-
perpolarization current in mouse hippocampus. Proc Natl
Acad Sci USA 107:10232–10237.
Tzingounis AV, Nicoll RA. 2008. Contribution of KCNQ2
and KCNQ3 to the medium and slow afterhyperpolariza-
tion currents. Proc Natl Acad Sci USA 105:19974–
19979.
Weber YG, Geiger J, Kampchen K, Landwehrmeyer B,
Sommer C, Lerche H. 2006. Immunohistochemical anal-
ysis of KCNQ2 potassium channels in adult and develop-
ing mouse brain. Brain Res 1077:1–6.
Westerfield M. 1995. The Zebrafish Book. Eugene, OR:
University of Oregon Press.
Winter MJ, Alderton WK, Kimber GM, Liu Z, Strang I,
Redfern WS, Valentin JP, et al. 2008. Validation of a
larval zebrafish locomotor assay for assessing the seizure
liability of early-stage development drugs. J Pharmacol
Toxicol Methods 57:176–187.
Wuttke TV, Seebohm G, Bail S, Maljevic S, Lerche H. 2005.
The new anticonvulsant retigabine favors voltage-depend-
ent opening of the Kv7.2 (KCNQ2) channel by binding to
its activation gate. Mol Pharmacol 67:1009–1017.
Yeung SY, Lange W, Schwake M, Greenwood IA. 2008.
Expression profile and characterisation of a truncated KCNQ5
splice variant. BiochemBiophys Res Commun 371:741–746.
198 Chege et al.
Developmental Neurobiology
top related