dna sequencing. cs273a lecture 3, autumn 08, batzoglou dna sequencing how we obtain the sequence of...
Post on 21-Dec-2015
222 Views
Preview:
TRANSCRIPT
DNA Sequencing
CS273a Lecture 3, Autumn 08, Batzoglou
DNA sequencing
How we obtain the sequence of nucleotides of a species
…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…
CS273a Lecture 3, Autumn 08, Batzoglou
Which representative of the species?
Which human?
Answer one:
Answer two: it doesn’t matter
Polymorphism rate: number of letter changes between two different members of a species
Humans: ~1/1,000
Other organisms have much higher polymorphism rates Population size!
CS273a Lecture 3, Autumn 08, Batzoglou
Why humans are so similar
A small population that interbred reduced the genetic variation
Out of Africa ~ 40,000 years ago
Out of Africa
Heterozygosity: H
H = 4Nu/(1 + 4Nu)
u ~ 10-8, N ~ 104
H ~ 410-4
N
CS273a Lecture 3, Autumn 08, Batzoglou
Human population migrations
• Out of Africa, Replacement “Grandma” of all humans (Eve) ~150,000yr
• Ancestor of all mtDNA
“Grandpa” of all humans (Adam) ~100,000yr• Ancestor of all Y-chromosomes
• Multiregional Evolution Fossil records show a continuous change of
morphological features Proponents of the theory doubt mtDNA and
other genetic evidence
• New fossil records bury “multirigionalists” Nice article in Economist on thathttp://www.economist.com/science/displaystory.cfm?story_id=9507453
CS273a Lecture 3, Autumn 08, Batzoglou
DNA Sequencing – Overview
• Gel electrophoresis Predominant, old technology by F. Sanger
• Whole genome strategies Physical mapping Walking Shotgun sequencing
• Computational fragment assembly
• The future—new sequencing technologies Pyrosequencing, single molecule methods, … Assembly techniques
• Future variants of sequencing Resequencing of humans Microbial and environmental sequencing Cancer genome sequencing
1975
2015
CS273a Lecture 3, Autumn 08, Batzoglou
DNA Sequencing
Goal:
Find the complete sequence of A, C, G, T’s in DNA
Challenge:
There is no machine that takes long DNA as an input, and gives the complete sequence as output
Can only sequence ~900 letters at a time
CS273a Lecture 3, Autumn 08, Batzoglou
DNA Sequencing – vectors
+ =
DNA
Shake
DNA fragments
VectorCircular genome(bacterium, plasmid)
Knownlocation
(restrictionsite)
CS273a Lecture 3, Autumn 08, Batzoglou
Different types of vectors
VECTOR Size of insert
Plasmid2,000-10,000
Can control the size
Cosmid 40,000
BAC (Bacterial Artificial Chromosome)
70,000-300,000
YAC (Yeast Artificial Chromosome)
> 300,000
Not used much recently
CS273a Lecture 3, Autumn 08, Batzoglou
DNA Sequencing – gel electrophoresis
1. Start at primer(restriction site)
2. Grow DNA chain
3. Include dideoxynucleoside (modified a, c, g, t)
4. Stops reaction at all possible points
5. Separate products with length, using gel electrophoresis
CS273a Lecture 3, Autumn 08, Batzoglou
Method to sequence longer regions
cut many times at random (Shotgun)
genomic segment
Get one or two reads from each segment
~900 bp ~900 bp
CS273a Lecture 3, Autumn 08, Batzoglou
Reconstructing the Sequence (Fragment Assembly)
Cover region with high redundancy
Overlap & extend reads to reconstruct the original genomic region
reads
CS273a Lecture 3, Autumn 08, Batzoglou
Definition of Coverage
Length of genomic segment: GNumber of reads: NLength of each read: L
Definition: Coverage C = N L / G
How much coverage is enough?
Lander-Waterman model: Prob[ not covered bp ] = e-C
Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides
C
CS273a Lecture 3, Autumn 08, Batzoglou
Repeats
Bacterial genomes: 5%Mammals: 50%
Repeat types:
• Low-Complexity DNA (e.g. ATATATATACATA…)
• Microsatellite repeats (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)
• Transposons SINE (Short Interspersed Nuclear Elements)
e.g., ALU: ~300-long, 106 copies LINE (Long Interspersed Nuclear Elements)
~4000-long, 200,000 copies LTR retroposons (Long Terminal Repeats (~700 bp) at each end)
cousins of HIV
• Gene Families genes duplicate & then diverge (paralogs)
• Recent duplications ~100,000-long, very similar copies
CS273a Lecture 3, Autumn 08, Batzoglou
Sequencing and Fragment Assembly
AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT
3x109 nucleotides
50% of human DNA is composed of repeats
Error!Glued together two distant regions
CS273a Lecture 3, Autumn 08, Batzoglou
What can we do about repeats?
Two main approaches:• Cluster the reads
• Link the reads
CS273a Lecture 3, Autumn 08, Batzoglou
What can we do about repeats?
Two main approaches:• Cluster the reads
• Link the reads
CS273a Lecture 3, Autumn 08, Batzoglou
What can we do about repeats?
Two main approaches:• Cluster the reads
• Link the reads
CS273a Lecture 3, Autumn 08, Batzoglou
Sequencing and Fragment Assembly
AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT
3x109 nucleotides
C R D
ARB, CRD
or
ARD, CRB ?
A R B
CS273a Lecture 3, Autumn 08, Batzoglou
Sequencing and Fragment Assembly
AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT
3x109 nucleotides
CS273a Lecture 3, Autumn 08, Batzoglou
Strategies for whole-genome sequencing
1. Hierarchical – Clone-by-clonei. Break genome into many long piecesii. Map each long piece onto the genomeiii. Sequence each piece with shotgun
Example: Yeast, Worm, Human, Rat
2. Online version of (1) – Walkingi. Break genome into many long piecesii. Start sequencing each piece with shotguniii. Construct map as you go
Example: Rice genome
3. Whole genome shotgun
One large shotgun pass on the whole genome
Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Dog
top related