cdx, wnt signalling and anterior hox genes in the regulation of the
Post on 08-Jan-2017
224 Views
Preview:
TRANSCRIPT
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA ANIMAL
Cdx, Wnt signalling and anterior Hox genes in the regulation of the posterior growth zone
in the mouse embryo.
Ana Rita Soares Monteiro
Dissertação
Mestrado em Biologia Evolutiva e do Desenvolvimento 2012
UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA ANIMAL
Cdx, Wnt signalling and anterior Hox genes in the regulation of the posterior growth zone
in the mouse embryo.
Ana Rita Soares Monteiro
Dissertação Mestrado em Biologia Evolutiva e do Desenvolvimento
Orientadores: Doutora Jacqueline Deschamps e Doutora Sólveig Thorsteinsdóttir
2012
V
Abstract
The Cdx gene family plays a fundamental role in the regulation of the posterior
growth zone during mouse development. This region contains populations of long–term
neuromesodermal progenitors that contribute to axis elongation [1]. Cdx2+/-‐Cdx4-‐/0 (Cdx2/4)
mutants have a truncation of the axis and defects in the placental labyrinth leading to
embryonic lethality. Rescuing experiments showed that Wnt signalling and Hox trunk genes
interact with Cdx genes in the regulation of axial extension [2]. In the first part of this work
we studied the lethality in mutants that lack one allele of Cdx2 and both alleles of Wnt3a.
We show that Wnt3a and Cdx2 interact in the regulation of placental labyrinth precursors
and act upstream of Cdx4.
Previous findings revealed that trunk Hox genes and Hox13 differentially regulate
posterior axial growth [2]. Here we tested the role of an anterior Hox gene (Hoxb1) in the
regulation of axial elongation. We showed that overexpression of Hoxb1 under the Cdx2
promoter in a genetic background of Cdx2/4 mutants aggravates the phenotype instead of
rescuing it. Cdx2/4 Cdx2PHoxb1 transgenic embryos present embryonic lethality and a more
severe truncation of the axis compared to their Cdx2/4 littermates. Therefore, we propose
that anterior Hox genes are epistatic over the trunk Hox genes. To assure the right
regulation of axis extension Cdx genes would interact in a positive way with trunk Hox genes.
However, the presence of anterior Hox genes would disrupt the balance between anterior
and trunk Hox genes.
Keywords: Axial extension, mouse, Cdx , Hox, Wnt
VI
Resumo
Durante o processo de gastrulação as camadas germinativas do embrião são
formadas e o plano corporal do organismo é estabelecido. Após a gastrulação o crescimento
do eixo em ratinho ocorre por um processo designado de extensão axial. A parte posterior
do eixo do ratinho cresce através da adição de tecidos provenientes de populações de
progenitores residentes na linha primitiva e tecidos adjacentes, mais tarde no “botão da
cauda” [1]. Esta região é por esse motivo denominada de “zona de crescimento posterior”.
Nesta região estão presentes progenitores da mesoderme extraembrionária, células
germinais primordiais, mesoderme somítica, neuroectoderm, progenitores neuro-‐
mesodérmicos de longo termo e precursores de endoderme. A ordem referida é a ordem da
sua localização dos mais posteriores para os a mais anteriores na linha primitiva. A regulação
e manutenção destes progenitores é essencial para extensão do eixo, manutenção das
células germinais primordiais e desenvolvimento da mesoderme extraembrionária que dará
origem ao alantoide. Esta regulação é assegurada pela acção de factores de transcrição,
como Cdx (Caudal related homeobox) que actua como regulador dos genes Hox e via de
sinalização Wnt/Beta-‐catenina [2]. A família de genes Cdx é constituída por três genes (Cdx1,
Cdx2 e Cdx4). Mutantes de Cdx apresentam o eixo antero-‐posterior truncado, cuja
severidade depende dos genes ou do número de alelos mutados. Alguns destes mutantes
apresentam defeitos nos tecidos extraembrionários, ausência de alantoide no caso mais
extremo e malformações no labirinto vascular da placenta. Os defeitos nos tecidos
extraembrionários provocam letalidade embrionária uma vez que os embriões são incapazes
de estabelecer correctamente contacto com o sangue materno e assim prosseguir com a
troca de nutrientes. Mutantes de Cdx também apresentam defeitos na padronização do eixo
axial com algumas transformações ao nível da identidade vertebral. Um dos mutantes de
Cdx mais estudado é o de Cdx2+/-‐Cdx4-‐/0 (Cdx2/4) [2-‐4]. O fenótipo destes mutantes
apresentam diferentes penetrâncias , o nível de truncamento varia ( no caso mais severo o
eixo termina ao nível do sacro) assim como os defeitos que causam letalidade embrionária.
Em alguns embriões o alantóide não se funde com o córion, noutros casos os defeitos são ao
nível do labirinto placentário. Apenas uma pequena percentagem de embriões nasce [4].
A primeira parte deste trabalho tem como objectivo estudar a interacção de genes
Cdx e a via de sinalização Wnt através do estudo de mutantes Wnt3a-‐/-‐Cdx2+/-‐. Trabalhos
anteriores demonstraram que Wnt actua tanto a jusante como a montante de Cdx no
processo de extensão axial, Lef1 (mediador da via Wnt canónica) foi capaz de resgatar o
fenótipo de Cdx2/4 [2]. O objectivo deste projecto foi desvendar mais acerca da relação
VII
entre Cdx e a via de sinalização Wnt. Os mutantes gerados, Wnt3a-‐/-‐Cdx2+/-‐ sofrem letalidade
embrionária. Este fenótipo não era espectável uma vez que mutantes Cdx2+/-‐ e mutantes
Wnt3a-‐/-‐ não apresentam qualquer letalidade embrionária. Colocámos a hipótese de que a
causa da letalidade destes mutantes seria a mesma que a observada em mutantes Cdx2/4, e
portanto que a mesma via de regulatória estaria a ser afectada. Para testar esta hipótese,
analisaram-‐se alantóides de embriões de dia embrionário 8.5 (E8.5) e placentas de embriões
de E10.5. Alantóides dos mutantes desenvolvem-‐se correctamente e a maioria funde com o
córion. Cortes de placentas mostraram defeitos na ramificação dos vasos sanguíneos
embrionários, mas menos severos que os descritos em mutantes Cdx2/4. Devido à
semelhança com Cdx2/4 foi testada a hipótese da expressão de Cdx4 estar afectada em
mutantes Cdx2+/-‐Wnt3a-‐/-‐ . Os baixos níveis de expressão de Cdx4 observados em mutantes
confirmou esta hipótese. Estes resultados levaram nos a concluir que genes Cdx e a via de
sinalização Wnt actuam em conjunto na regulação da população de progenitores dos tecidos
que darão origem ao labirinto placentário.
No segundo projecto foi explorada a função de genes Hox anteriores (Hox1-‐3) na
regulação da extensão axial. Os genes Hox têm um papel fundamental no estabelecimento
da identidade dos segmentos ao longo do eixo anterio-‐posterior. No entanto, os genes Hox
do tronco (Hox5-‐9) também estão envolvidos na extensão do eixo. Este papel é
desempenhado em paralelo com os genes Cdx. Os genes Hox e genes Cdx têm um gene
ancestral em comum e durante o desenvolvimento partilham domínios de expressão na
região posterior do embrião [6]. Sobrexpressão de Hoxb8 e Hoxa5 sob o promotor de Cdx2
levou ao resgate do fenótipo de mutantes Cdx2/4, demonstrando assim uma função na
regulação da extensão do eixo. Estes embriões transgénicos (Cdx2/4 Cdx2PHoxb8 e Cdx2/4
Cdx2PHoxa5) apresentaram menor letalidade e o eixo axial apresenta truncamento menos
severo, relativamente aos embriões Cdx2/4 [2]. Neste projecto propusemos testar se a
sobreexpressão de Hoxb1 (gene Hox anterior) sob o mesmo promotor, resgataria o fenótipo
de Cdx2/4. Foram criadas diferentes linhas transgénicas com a construção Cdx2PHoxb1
expressa no fundo genético de mutantes Cdx2/4. A sobrevivência e esqueleto axial destes
indivíduos foram analisados. A presença do transgene Hoxb1 não resgatou a letalidade
embrionária de mutantes Cdx2/4 e em algumas linhas transgénicas aumentou a letalidade.
De todas as linhas obteve-‐se apenas um recém-‐nascido com o genótipo Cdx2/4 Cdx2PHoxb1
o que indica que a presença de Hoxb1 está a agravar o fenótipo de Cdx2/4. A análise do
esqueleto axial dos mutantes com e sem o transgene mostrou que em todos os mutantes de
Cdx (Cdx4+/-‐,Cdx4-‐/0,Cdx2+/-‐Cdx4+/-‐ e Cdx2/4) a presença do transgene agrava o fenótipo. Com
VIII
base nestes resultados propomos que Hoxb1 interage com genes Cdx/Hox centrais de forma
antagonísitca no processo de extensão axial. Os genes Hox mais afastados de genes centrais
do cluster actuam de forma epistática sobre estes, o que explicaria o agravamento do
fenótipo de Cdx2/4 Cdx2PHoxb1. Em suma, ao longo do processo de extensão axial é
necessário um balanço entre genes Hox anteriores e posteriores, estabelecido através de
interacções epistásticas.
Palavras chave: Genes Cdx, extensão axial, sinalização Wnt, genes Hox
IX
Abbreviation List AP Anterior-‐posterior C Celsius ADH Alcohol dehydrogenase AP Alkaline phosphatase Cdx2/4 Cdx2+/-‐ Cdx4 null CHAPS 3[(3-‐Cholamidopropyl)dimethylammonio]-‐propanesulfonic acid Cyp26a1 Cytochrome P450, family 26, subfamily A, polypeptide 1 DEPC Diethylpyrocarbonate DIG Digoxigenin DNA Deoxyribonuclease acid DNAse Deoxyribonuclease dNTP Deoxyribonucleotide triphosphate DTT Dithiothreitol E Embryonic day EDTA Ethylene diamine tetraacetic acid et al. et alii (and others) EtOH Ethanol FGF Fibroblast growth factor FGFR Fibroblast growth factor receptor H Hour ICM Inner cell mass LB Lysogeny broth Lef1 Lymphoid enhancer-‐binding factor 1 LiCl Lithium Chloride M Molar MetOH Methanol MgCl2 Magnesium dochloride min Minutes ml Milliliter
mM Millimolar
MAB Maleic acid buffer NaAC Sodium Acetate ng Nanogram NTMT Alkaline phosphatase buffer PBS0 Phosphate buffered saline (without calcium and magnesium) PCR Polymerase Chain Reaction PFA Paraformaldehyde PGC Primordial germ cell PSM Presomitic mesoderm RA Retinoic acid RALDH Retinaldehyde dehydrogenase Raldh2 Retinaldehyde dehydrogenase type 2 RAR Retinoic acid receptor
X
RDH Retinol dehydrogenase RNA Ribonucleic acid RNAse Ribonuclease rpm Revolutions per minute RT Room temperature RXR Retinoic X receptor sec Seconds SDS Sodium dodecyl sulphate SRY Sex-‐determining region Y SSC Saline Sodium Citrate Taq polymerase Thermicus aquaticus polymerase TBS Tris buffered Saline TCF T cell factor TE Tris EDTA tRNA Transfer ribonucleic acid VE Visceral endoderm VEGF Vascular endothelial growth factor μg Microgram μl Microliter μm Micrometer
XI
Table of contents
ABSTRACT V
RESUMO VI
ABBREVIATION LIST IX
TABLE OF CONTENTS XI
GENERAL INTRODUCTION 1 Early mouse development 1 Axis elongation and axial progenitor cells 1 Wnt signalling 2 Retinoic acid signalling 2 FGF signalling 3 Cdx genes 3 Cdx null mutants and the genetic control of axial extension 5
AIM OF THIS THESIS 7
CHAPTER I -‐ INVOLVEMENT OF THE CANONICAL WNT PATHWAY DOWNSTREAM OF CDX GENES IN THE FORMATION OF THE PLACENTAL LABYRINTH 9
Introduction 9 Placental labyrinth development 9 Cdx genes and Wnt signalling pathway in placenta formation 9
Methods 11 Mice 11 Isolation embryos and processing 11 Genotyping 11 Histological analysis 11 In situ hybridization 12
Results 14 Wnt3a-‐/-‐ Cdx2+/-‐ embryos have defects in placental labyrinth similar to Cdx2/4 mutants 14 Cdx4 is downregulated in Wnt3a-‐/-‐Cdx2+/-‐ mutants 14
Discussion 16
CHAPTER II – ANTERIOR HOX GENES AND AXIAL ELONGATION 17
Introduction 17 The vertebrate axis 17 Hox genes and vertebrate axis 17 Hox genes expression and regulation 18
Methods 21
Table of contents
XII
Generation of transgenic constructs and mice 21 Isolation of embryos 21 Bone and cartilage staining 21 Genotyping 21 RNA isolation 22 DNAse treatment 22 cDNA synthesis 23 Quantitative RT-‐PCR analysis 23
Results 24 Hoxb1 is overexpressed in the Cdx2PHoxb1 transgenic mice 24 Hoxb1 transgene does not recue defects from the placental labyrinth of Cdx2/4 mutants. 25 Hoxb1 does not rescue the axial defects of Cdx mutants 26 Analysis of the phenotype of Hoxb1 transgenic embryos 31
Discussion 33
CONCLUDING REMARKS 35
REFERENCES 37
ANNEXES 43
Annex I 43
Annex II 44
1
General Introduction
Early mouse development
The early patterning of the embryo and the onset of subsequent morphogenesis
occurs during what could be considered the most important process in development,
gastrulation. Gastrulation is characterized by morphogenetic movements accompanied by
cell proliferation and differentiation which will eventually convert the embryo into three
germ layers, the ectoderm, mesoderm and endoderm [7]. The mouse gastrulates by the
ingression of cells from the epiblast through the primitive streak, a structure that emerges in
the posterior region of the embryo at embryonic day (E) 6.2 [8]. During gastrulation, nodal-‐
dependent signals from the VE have a role in the regionalization in the primitive streak, with
the node in the most anterior region [9]. Fate maps provided by clonal analysis of single
epiblast cells show that the epiblast is regionalized; however individual cells can contribute
to multiple germ layers [10]. The node organizes the ingression of epiblast cells through the
primitive streak. Once ingressed, mesodermal tissues differentiate in lateral mesoderm
(circulatory system, limb bud mesenchyme and wall of the digestive organs), intermediate
mesoderm (urogenital system) or paraxial mesoderm (presomitic mesoderm and somites)
[8].
Axis elongation and axial progenitor cells
By the end of gastrulation, only the most rostral tissues are formed and the
elongation of the anterior-‐posterior (AP) axis continues by the addition of tissues from the
primitive streak and adjacent epiblast, and later from the tail bud [1,11]. The source of these
axial tissues is a pool of progenitors, some of which have stem cell properties [1]. These axial
structures are added in an rostral-‐to-‐caudal sequence as the embryo grows [11]. For this
reason both the primitive streak plus the adjacent epiblast, together with tail bud can be
called “posterior growth zone”. This region comprises the border region between the node
and anterior primitive streak and the epiblast adjacent to the streak [1,12,13]. Cell lineage
tracing studies revealed the relative positions of the different progenitor populations, and
they indicate a temporal order of cell emergence that corresponds to the building of the AP
axis [7]. More recently clonal analysis showed that the stem cell-‐like precursors are
neuromesodermal progenitors which persist after the segregation of endodermal and
General Introduction
2
surface ectoderm layers [14], suggesting that neurectoderm and mesoderm are more closely
related than mesoderm and endoderm.
As mentioned above some of these progenitors of the posterior growth zone have
stem cell characteristics. Therefore an equilibrium between the generation of differentiated
axial tissues and the maintenance of a posterior progenitors is required [1]. The genetic
control of the process of axial elongation and maintenance of the posterior growth zone
involves a series of highly conserved genes and signalling pathways. Among the known
signalling pathways involved are Wnt, Retinoic acid (RA) and Fgf [1,2,15,16] and among the
transcription factor-‐encoding genes are Cdx [3,17] and T brachyury [2,3,17,18].
Wnt signalling
Wnt signalling is essential during vertebrate development and is associated with the
regulation of many processes. Wnt is the ligand that activates the canonical pathway and the
other main components are the transmembrane receptor Frizzled (Fz), and the downstream
effectors of the pathway, Dishevelled (Dsh), β-‐catenin and T cell factor/Lymphoid enhancer-‐
binding factor 1 (Tcf/Lef1) [19]. During early development the Wnt pathway controls cell
proliferation, stem cell maintenance, cell fate decisions, organized cell movements and
establishment of tissue polarity [20]. Wnt3 and Wnt3a have been shown to be essential for
axis formation and elongation of vertebrate embryos, respectively. Wnt3a is expressed in
the presumptive mesoderm in the posterior region of the developing embryo [5]. Null
mutants for Wnt3a have a severe axial truncation, a disrupted notochord and a deficient
tailbud [21]. Galceran et al. showed that Wnt3a acts trough Lef1/Tcf1 since Lef1-‐/-‐Tcf1-‐/-‐ mice
have a phenotype similar to that of Wnt3a-‐/-‐ mice [22]. Wnt3a is also involved in the
regulation of somitogenesis acting on the presomitic mesoderm (PSM) [23]. Wnt3-‐/-‐ mice do
not develop a primitive streak and therefore lack mesoderm and node [24], and thus Wnt3 is
required in a much earlier developmental stage compared to Wnt3a.
Retinoic acid signalling
Retinoic acid (RA) signalling is involved in a range of developmental processes, for
example the control of progenitor cell populations, including the axial precursors [25]. RA is
a vitamin A-‐derived compound and its biological action is restricted by the localization of its
synthesis regulated by retinol and alcohol dehydrogenase (RDHs and ADHs) and
General Introduction
3
retinaldehyde dehydrogenases (RALDHs) and the presence of enzymes that degrade it,
cytochrome P450s (CYP26s) [25].
Raldh2-‐/-‐ embryos die during development from defective heart morphogenesis and
have severe developmental defects like body axis truncation [26]. Cyp26a-‐/-‐ mutant embryos
show several defects among which a truncation of the posterior body region, posterior
transformations of cervical vertebrae and abnormal hindbrain patterning [27,28].
FGF signalling
Fibroblast growth factors (FGFs) are a family of ligands that bind tyrosine kinase
receptors, the FGF receptors (FGFRs). FGF ligands bind the extracellular domain of the FGFRs
to form a complex leading to the transphosphorylation of specific intracellular tyrosine
residues [29].
Fgf signalling is required for ingression of epiblast cells through the primitive streak
[30,31]. During axial elongation Fgf8 is expressed in the primitive streak and posterior
mesoderm [1,4,32-‐34]. A caudal-‐to-‐rostral gradient of Fgf8 is formed from the node region
where low Fgf8 levels allow mesoderm to differentiate and high concentrations maintain the
stemness of the progenitors in the posterior growth zone [1,16]. Fgf signalling is confined to
the posterior region of the embryo as a result of the antagonistic interaction with RA.
Cdx genes
The vertebrate Cdx genes (Cdx1, Cdx2 and Cdx4) are the homologs of the Drosophila
caudal (cad) gene [35] , which is known for playing a role in patterning the AP axis of the
early fly embryo and acts as a posterior homeotic gene [36]. Both Cdx and Hox gene families
arose from a common ancestor, the ProtoHox cluster thought to confer anteroposterior
identity to axial tissues in all bilatarians [6]. Given their common origin, high similarities
between these two families exist. The three Cdx genes are initially expressed in the primitive
streak at the late primitive streak stage. Slightly later, Cdx1 has the most anterior expression
boundary whilst the expression of Cdx2 and Cdx4 is more posteriorly restricted. This
situation is transient and at E9.0 all three Cdx genes are expressed in the posterior growth
zone.
Expression of Cdx1 is initiated at E7.2 in the ectodermal and mesodermal cells of the
primitive streak [37]. Cdx1-‐/-‐ mutant mice have anterior homeotic transformations of the
General Introduction
4
cervical region accompanied by a caudal shift in the expression domain of Hox genes [38].
This shows the role of Cdx genes in regulating Hox genes expression.
In addition to its expression in the primitive streak, Cdx2 is already expressed at E3.5
in the trophectoderm. At the blastocyst stage Cdx2 has an essential function in assuring
segregation of the inner cell mass (ICM) and trophectoderm and is necessary for the
implantation into the uterus wall at E4.5 [39-‐42]. At E7.2 expression of Cdx2 is detected in
the embryo in the posterior primitive streak, in the allantois and the chorion. The gene
remains expressed at later stages in the posterior neural tube and presomitic mesoderm.
The lethality of Cdx2-‐/-‐ mutants at E3.5 can be bypassed by tetraploid rescue, and the
resulting embryos eventually die at E10.5 because of defects in the allantois [40]. In addition,
the absence of the allantois leads to agenesis of the placental labyrinth. Around E10.5 the
mouse embryo becomes dependent on the correct formation of the placental labyrinth,
which will allow exchanges of nutrients and gases between the mother and the embryo.
Cdx2 mutants obtained by tetraploid rescue are severely truncated in all three germ layers
posteriorly to the forelimb bud, and they form a maximum of 17 somites [40]. Heterozygous
mutants for Cdx2 get born but they have a subtle shorter axis and occasionally exhibit a
short and kinky tail and skeletal analysis showed anterior homeotic transformations of some
of the cervical and thoracic vertebrae [41]. Although Cdx2 is not expressed in the somitic
mesoderm at cervical levels, Cdx2 mutations do alter egene expression and the identity of
vertebrae at this cervical levels which implies that the interactions of Cdx as Hox regulators
occur early in the presomitic mesoderm [43]. The phenotypes of Cdx1 and Cdx2 loss of
function mutants may result from the fact that Cdx proteins are positive regulators of the
Hox genes in embryonic tissues [44]. Although the possibility that Cdx genes play a role on
their own in the processes of axial extension and patterning should also be consider.
Cdx4 located on the Y chromosome, is first expressed at E7.2 in the allantoic bud and
in the posterior primitive streak. Cdx4 remains expressed in the neuroectoderm, presomitic
and lateral plate mesoderm in the posterior embryo, and in the hindgut endoderm until
around E10.5 [45,46]. Hemizygous mutants for Cdx4 have a very mild axial defect, an
anterior transformation of vertebra 15, with very low penetrance [4].
The Cdx mutant phenotypes discussed so far show that Cdx genes have a crucial role
in patterning the anteroposterior axis (together with Hox genes) and in supporting the
process of axial elongation of the mouse. Besides the failure of Cdx2 null mutants in
generating a functional allantois, the role of Cdx genes in extraembryonic tissues was shown
in the compound mutant Cdx2+/-‐/Cdx4-‐/-‐ (Cdx2/4). These embryos also have an axial
General Introduction
5
truncation at the sacral level and only 15% survive until birth. The embryonic lethality is due
to defects in placental development, in some cases a failure of chorio-‐allantoic fusion , and
most often deficiencies in extension and branching of the allantoic vascular network into the
chorionic ectoderm [4].
Cdx null mutants and the genetic control of axial extension
Cdx triple null mutants were generated with mice carrying null alleles for Cdx1, Cdx4
and conditional alleles for Cdx2 [47]. These mutants present the most severe axial truncation
of all the Cdx mutants described: only 5 somites are generated. The posterior growth zone of
Cdx null embryos severely lost its activity of generating nascent mesoderm and
neuroectoderm. The complete absence of Cdx alleles in these mutants permits a more clear
study of the genetic pathways associated with Cdx and axial elongation. The expression of
Wnt3a is downregulated in these mutants, reinforcing that the Wnt pathway acts
downstream of Cdx genes. Hox gene expression was also affected, Hox anterior genes are
well induced but posterior Hox genes show no expression in these mutants. Cdx genes
regulate the gene encoding the enzyme that degrades RA, Cyp26a1 directly and positively
[2,48]. Cyp26a1 is absent from the posterior region of Cdx null mutants resulting in the
deficiency of RA clearance. The persistence of RA in the posterior region is further accounted
for the high level of Raldh2 expression in this region of the Cdx null mutants. Due to the
higher levels of RA in the posterior region of Cdx null embryos, Fgf8 expression is completely
absent in these mutants. Interestingly, re-‐induction of Fgf signalling was able to partially
Figure 1 -‐ Genetic interactions involved in the maintenance of the posterior growth zone in Wild-‐type and Cdx null embryos. Left: Schematic dorsal view of E8.5 wild-‐type and Cdx null embryos. Right: Schematic representation of the signalling cascades downstream of Cdx in the growth zone of wild-‐type and Cdx null embryos. Not the absence of Fgf8 in the Cdx null mutants that lead to failure of RA clearance from the posterior region of the embryo. Orange represents the expression domain of Fgf8 and in blue the presence of RA. From: Van Rooijen et al., 2012
General Introduction
6
rescue the Cdx2 mutant truncation [47]. The rescued embryos regain the expression of
Cyp26a1 also absent in Cdx2 null mutants. The generation of embryos totally deprived of
Cdx activity allowed a better understanding of the mechanisms and genetic interaction
involved in axial extension. The model in figure 1 was proposed.
7
Aim of this thesis
This work will focus on the role of Cdx genes and the interaction with other factors
in the regulation of the posterior growth zone in the mouse embryo. This thesis has two
aims; the first is to study the interaction of Cdx2 and canonical Wnt signalling (Wnt3a) and
the second is to test the role of Hoxb1 in the regulation of axis extension and the interaction
with Cdx genes. The results of these two projects will be described in two separate chapters
in this thesis.
The project described in Chapter I results from previous observations that Wnt3a-‐/-‐
Cdx2+/-‐ mutant embryos were not recovered at E15.5. The aim of this project was to
investigate the origin of early lethality of the Wnt3a-‐/-‐Cdx2+/-‐ mutant embryos. Neither Cdx2
heterozygote mutants nor Wnt3a null mutants are arrested in their development. Cdx2
heterozygotes only present some alterations in vertebrate patterning and a mild defect in
the posterior embryonic axis, missing a few caudal vertebrae [41]. Wnt3a homozygous
mutants have a severe truncation of the embryonic axis [5], very similar to the posterior
body truncations of Cdx2 mutants [49]. Both Wnt signaling and Cdx/Hox genes have
important roles during axis elongation and Wnt exerts a positive feedback loop on Cdx that
maintains Wnt signalling to sustain progenitor self-‐renewing and tissue elongation [2]. We
wanted to test whether the loss of Wnt3a in Cdx2 heterozygotes was causing early lethality
of the compound mutant embryos by compromising placental development.
Cdx genes are key regulators of the process of axial extension as they regulate the
niche of the axial progenitors in the posterior growth zone. Previous work showed that trunk
Hox genes collaborate with Cdx genes to stimulate posterior axial growth while posterior
Hox genes promote growth termination by interfering with Cdx/trunk Hox genes [2]. The
second question of this work concerns the role of anterior Hox genes in the process of axial
elongation and how they interact with Cdx in this regulation; this work is described in
Chapter II. In this project we propose to test whether Hoxb1, like Hoxb8 and Hoxa5 [2], is
able to rescue the Cdx2/4 mutant phenotype.
9
Chapter I -‐ Involvement of the canonical Wnt pathway downstream of Cdx genes in the formation of the placental labyrinth
Introduction
Placental labyrinth development
Mice have a chorioallantoic placenta, which means that it is formed from two
extraembryonic components, the chorion and the allantois. The allantois is first visible at
E7.0/E7.25 [50,51] as a bud of extraembryonic mesoderm arising from the posterior part of
the primitive streak [10,52]. The outer cells of the bud will differentiate into a layer of
mesothelium that surrounds an inner core of extraembryonic mesoderm [53] . The next step
in the development of the allantois is its growth into the exocoelomic cavity in the direction
of the chorion [53]. The allantois vascularizes intrinsically, rather than by angiogenesis. It
arises independently from the vessel network of the yolk sac or the fetus and is not
accompanied by erythropoiesis [54]. The allantoic vasculature is formed by vasculogenesis, a
process characterized by the differentiation of mesodermal cells into endothelial cell
precursors or angioblasts. The vascularization starts in the most distal cells of the inner core
of the allantois which start to flatten and then coalesce to form the blood vessels [54].
Expression of Flk1, a tyrosine kinase receptor for vascular endothelial growth factor (VEGF)
and a marker for endothelial cells, follows the morphological appearance of vascularization,
first in the distal part of the allantois and later at the proximal part [54]. The first signs of
vascularization occur before the fusion of the allantois with the chorion.
Cdx genes and Wnt signalling pathway in placenta formation
The role of Cdx in the development of extraembryonic tissues was mentioned above.
Cdx2 null mutations impair the generation of embryonic and extra-‐embryonic mesoderm
and Cdx2 null allantois does not fuse with the chorion [40]. This reveals the early Cdx
dependence of placental ontogeny, reflected by the fact that one active Cdx2 allele is
required for outgrowth of the early allantoic bud. In Cdx2+/-‐ and Cdx2+/-‐Cdx4+/-‐ mutants the
allantois reaches a normal size. Cdx mutants exhibit subsequent defects that compromise
the ontogenesis of a proficient chorio-‐allantoic placenta, with a penetrance that increases
with the decrease in Cdx dosage [4]. In the case of Cdx2/4 mutants, the majority of mutant
Chapter I – Introduction
10
allantoises undergoes chorio-‐allantoic fusion but exhibit a later defect, being impaired in the
establishment of a functional endothelial network in the labyrinth. The allantoic vessel
branching fails to occur in the placental labyrinth, preventing the necessary proximity of the
embryonic and maternal blood [4]. The role of Cdx genes in placentogenesis is an early one
acting on the progenitors of endothelial cells in the early allantois since Cdx genes are
downregulated in the allantois at E8.5.
Wnt signaling is also involved in the development and differentiation of the
placental tissues in the mouse embryo [55]. Several studies showed that Wnt signaling is
crucial for extraembryonic development, particularly in chorion-‐allantois fusion, placental
vascularization and labyrinth function. Embryos null for both Tcf-‐1 and Lef-‐1 display severe
defects in placenta formation due to absence of chorionic-‐allantois fusion [56]. Fzd5 knock-‐
out embryos do not survive beyond E10.0 since their placentae were less vascularized[57].
Labyrinths of Wnt2 null embryos exhibit different defects such as edema and decreased
numbers of capillaries [58]. Deletion of Wnt7b results in embryonic death around
midgestation due to placental abnormalities [59].
Objective
Previous experiments in the lab showed that Wnt3a-‐/-‐ Cdx2+/-‐ mutant embryos suffer
early lethality during development. The objective of this project is to investigate the cause of
this lethality, by analysing mutant embryos at earlier stages. Our hypothesis is that, similarly
to Cdx mutants, the early lethality resulted from impairment of the allantoic and/or
placental labyrinth development.
11
Methods
Mice
All mice were in the C57Bl6j/CBA background. Cdx2+/-‐ mice were obtained from F.
Beck (Beck et al., 1995) and Wnt3a mice from S.Takada (Takada et al., 1994). To generate
the mutants Wnt3a-‐/-‐ Cdx2+/-‐, Wnt3a+/-‐ females were crossed with Wnt3a+/-‐Cdx2+/-‐ males.
Matings were timed to get embryos from the desired stage. The day of the vaginal plug was
designated as E0.5 at noon.
Isolation embryos and processing
Embryos were isolated in PBS0, for E8.5 the allantois was kept intact and for E10.5
the placenta was also isolated. Embryos and placentas (E8.5, E10.5) were fixed in
paraformaldehyde (PFA) (4%) at 4°C overnight. Tissue was washed twice (10 minutes (min))
in PBS0 with Tween (1%) (PBT), dehydrated in methanol (10 min) steps of 25%, 50%, 75%
and twice 100%) and stored at -‐20°C.
Genotyping
For genotyping of embryos genomic DNA was isolated from the yolk sac and
amnion. Tissue was lysed overnight by a lysis solution (100 mM Tris HCl pH 8.5, 5 mM EDTA,
0.2% SDS, 200 mM NaCl, 100 μg/mL proteinase K) at 55°C, precipitated with isopropanol and
finally dissolved in TE buffer.
Primer sequences for genotyping Cdx2 are ATATTGCTGAAGAGCTTGGCGGC
(forward) and TAAAAGTCAACTGTGTTCGGATCC (reverse). Primer sequences for Wnt3a are
ACTACAACCCTCCTCACCTG (forward) and TGGCTACCCGTGATATTGCT (reverse). The PCR
reaction conditions are 94°C for 5 min, 94°C for 30 seconds (sec), 61°C for 1 min, 72°C for 1
min for 35 cycles, 72°C for 5min and 12°C until the end of reaction. In 10 μl mixture with 0.5
μM of each primer, 0.2 mM of each dNTP,1.5 mM MgCl2 and 1x PCR buffer (Promega 5x
Flexi Green GoTaq Buffer)
Histological analysis
Dehydrated placentas (in 100% methanol at -‐20°C) were put in paraffin (30 min at
60°C) and paraffin was refreshed twice (2 times 30 min at 60°C). Placentas were embedded
Chapter I – Methods
12
in paraffin and sections were cut (6 μm) using a microtome. Sections were afterwards
stained with hematoxylin and eosin.
In situ hybridization
i. Probe generation
DNA transformation into competent cells
1 μl of plasmid with Cdx4 cDNA insert was added into 25 μl of DH5α competent cells
and incubated for 10 min on ice. Cells were heat shocked for 45 sec at 42°C and after that
placed on ice for 2 min. 1ml of prewarmed Lysogeny Broth (LB) medium was added and
incubated at 37°C for one hour. 100μl of the transformation mixture was spread on a LB
agar plate (with ampicillin). The plates were left overnight incubating at 37°C. Two separate
colonies were picked and grown over night in 100 ml LB medium with 200 μl ampicillin.
DNA isolation form DH5α
Overnight bacterial cultures were pelleted by centrifuging 10 min at 3200 rpm.
Plasmids were isolated with the Invitrogen PureLinkTM Quick Plasmid Midiprep Kit,
following the manufacturer’s protocol. After the isolation the concentration of DNA was
determined with NanoDrop.
Linearization and purification
10 μg of DNA was linearised using restriction enzymes for 1 hour. Linearised DNA
plasmid was purified by a phenol/chloroform extraction followed by precipitation with
NaAC.
Synthesis of digoxygenin-‐labeled (DIG-‐labeled) RNA probe
In a total volume of 20 μl, the following reagents were mixed: 5x Transcription
Buffer, 0.1 M DTT, DIG RNA-‐labelling mixture, placental RNAse inhibitor and RNA
polymerase (T7) together with 1.5 μg of linearised plasmid DNA. The mixture was incubated
for 2 hours at 37°C. The next step was to dilute with 5x transcription buffer followed by the
digestion with 2 μl DNAse (RNAse free) for 45 min at 37°C. Next, destilled H20, brewer’s
yeast tRNA, LiCl and 100% ethanol (-‐20°C) was added to the mixture and incubated
overnight at -‐20°C. The mixture was spinned down (15 min) at 4°C, washed with 70%
ethanol and centrifuged again. Finally, the probes were dried under vacuum, redissolved in
TE/formamide (1:1) and stored at -‐80°C.
�
ii. Whole mount in situ hybridization
Chapter I – Methods
13
For whole mount in situ hybridization the embryos were rehydrated (75%, 50%, 25%
methanol, 2 times PBT; all steps for 10min) and permealized with 10 μg/ml proteinase K for
15 min. Proteinase K was blocked by glycine (2 mg/ml in PBT) for 5 min and was followed by
two times wash (5 min) with PBT. Embryos are refixed in 0.2% glutaraldehyde in 4% PFA,
followed by two washes (5 min) with PBT. The embryos were washed with 300 μl
prehybridization mix (5 min) and subsequently incubated for at least 1 hour at 70°C in 400 μl
prehybridization mix. Hybridization takes place over night at 70°C with prehybridization mix
with the probes. After hybridization embryos are washed with 800 μl prehybridization mix
(10 min at 70°C) and 400 μl 2x SSC (70°C) was added three times (10 min). After 2 times 30
min wash with CHAPS (0.1%)/SSC (2x), the tissue was incubated at 37 °C for at least one hour
with 100 μg/ml RNAse-‐A in CHAPS (0.1%)/SSC (2x). Afterwards the samples were washed
twice with Maleic acid buffe (MAB) for 10 min at room temperature and twice for 30 min at
70°C. Subsequently a 10 min wash with PBT and two washes (10 min) with TBST with 2mM
levamisole. Embryos were preblocked by 10% heat inactivated sheep serum (endogenous
alkaline phosphatase activity is inactivated beforehand by 70°C incubation for 30 min) for 2
hours. Beforehand a anti-‐DIG alkaline phosphatase mixture was prepared with 15 mg
embryo powder in 2,5 ml TBST, 250 μl 10% inactivated sheep serum and 5 μl of anti-‐DIG
conjugated with AP; incubated at 4°C for 4 hours while shaking. Blocking serum was
removed and anti-‐DIG mixture was added, tissues were incubated at 4°C overnight with
gently shaking. Post antibody washes were done with TBST with 2mM levamisole (3 times 5
min followed by 5 times 60 min wash). Before immunological detection with 1 ml BM Purple
(with 1mM levamisole) starts, the samples must be washed 3 times with NTMT (with 2 mM
levamisole). To stop the reaction the embryos were washed twice (10 min) with NTMT (with
2 mM levamisole) and 10 min with PBT including 10 mM EDTA. Embryos were postfixed with
0.2% glutaraldehyde in 4% PFA and finally samples were washed (30 min) and stored in
PBT/EDTA. Embryos were placed in filtered PBT/EDTA for image acquisition. This protocol is
adapted from Wilkinson, 1992. [60]
14
Results In order to study the relationship between Cdx genes and Wnt signalling in more
detail, Wnt3a-‐/-‐ Cdx2+/-‐, embryos were generated previously to this work by crossing Wnta3+/-‐
females with Wnt3a+/-‐ Cdx2+/-‐ males. At E15.5 these genotypes were not recovered which
indicated early lethality during development. To investigate whether placentation was
defective in these mice, embryos were isolated at earlier stages of development and the
phenotype was analysed.
Wnt3a-‐/-‐ Cdx2+/-‐ embryos have defects in placental labyrinth similar to
Cdx2/4 mutants
Embryos were isolated at two different embryonic stages. E8.5 embryos were
generated to observe whether the allantois was attached or not to the chorion. At E10.5 the
umbilical cord and placenta have normally already developed and it is possible to analyse
their morphology.
At E8.5 Wnt3a-‐/-‐ and Wnt3a-‐/-‐Cdx2+/-‐ show a narrower posterior region in the
embryo compared to wild type. Only a few Wnt3a-‐/-‐Cdx2+/-‐ embryos had not undergone
chorio-‐allantoic fusion.
At E10.5 no defects in the morphology of the umbilical cord or aberrant blood was
observed. Placentas were isolated and sectioned to analyse the phenotype of the labyrinth.
Figure 1.1 shows sections of these placentas, from both wild-‐type and Wnt3a-‐/-‐Cdx2+/-‐
embryos. Fig1.1A and 1.1C show that the labyrinthine area, containing the embryonic and
maternal blood, has the same width in the wild-‐type and in the Wnt3a-‐/-‐Cdx2+/-‐ mutants.
However the embryonic vessels are wider in the mutants, and do not penetrate the
chorionic plate efficiently (Fig.1.1D). The embryonic blood seems to be held in the base of
the placenta and the branching of the vessels is underdeveloped when compared to the
wild-‐type (Fig.1.1B and D). As a result, the embryonic vessels and the maternal blood are not
in direct contact, impairing the interchange of nutrients, which is a likely cause of the
embryonic lethality. The defects in the placental labyrinth resemble that in the Cdx2/4
mutants, although it is less severe.
Cdx4 is downregulated in Wnt3a-‐/-‐Cdx2+/-‐ mutants
To investigate whether this phenotype is reproducing the Cdx2/4 phenotype we
analysed whether Cdx4 was downregulated in these embryos. In mutants isolated at E8.5 in
situ hybridizations with a Cdx4 probe were performed (Fig.1.2). Due to the differences of the
Chapter I – Results
15
morphology of the posterior region of the mutants, Wnt3a-‐/-‐ embryos, which also have a
narrow posterior region, were used as a control to assess differences in expression. Figure
1.2 shows that Cdx4 is less expressed in the progenitors region of Wnt3a-‐/-‐Cdx2+/-‐ mutants.
Together these results indicate that in these mutants the genetic pathway affected is the
same as in the Cdx2/4 mutants. Wnt3a and Cdx2 interact during the regulation of
progenitors of the placental labyrinth and have Cdx4 as a downstream target.
Figure 1.1 – Defective placental labyrinth of Wnt3a-‐/-‐Cdx2+/-‐ E10.5 embryos. (A-‐D) Hematoxylin and eosin-‐stained sections of placentas from wild-‐type (A,B; B is an enlargement of A) and Wnt3a-‐/-‐Cdx2+/-‐ (C,D; D is an enlargement of C) embryos. Wild-‐type placentas show branched vessels that penetrate the chorionic ectoderm, embryonic vessels in close contact with maternal blood. In mutant placentas the allantoic vessels start to penetrate the chorionic ectoderm but the branching morphology is deficient. In B and D the arrow heads point to maternal red blood cells and arrows to fetal red blood cell. Scale bars represent 500 μm in A and C and 200 μm in B and D.
Figure 1.2 – Cdx4 is downregulated in Wnt3a-‐/-‐Cdx2+/-‐ E8.5 embryos. Whole mount in situ hybridization using a Cdx4 probe in wild-‐type (A,B), Wnt3a-‐/-‐ (C,D) Wnt3a-‐/-‐Cdx2+/-‐(E,F) in E8.5 embryos. A,C and E represent dorsal views and B,D and F lateral views. Comparison between compound mutant and Wnt3a-‐/-‐ indicates that Cdx4 expression is downregulated in the first. Posterior region of the embryo to the left. Scale bars represent 500 μm.
16
Discussion The results of this work do not unveil how Cdx and Wnt signalling establish their
genetic relation, but they illustrate once more that these two factors interact to in the
posterior progenitor region. The fact that a new phenotype, that is absent in either of the
mutants alone (Cdx2+/-‐ and Wnt3a-‐/-‐), arises in the compound mutants indicates that these
two genes act together. These factors are invested in the allantois development and in
proper placental labyrinth formation. The downregulation of Cdx4 in these mutants suggests
that the labyrinth defects are similar to Cdx2/4 mutant placentas.
In this work Wnt3a-‐/-‐ embryos do not show a downregulation of Cdx4 at E8.5, only
the compound mutant showed less expression of Cdx4 in the posterior region. It has been
shown that in Wnt3a hypomorphs, Cdx4 is downregulated, although experiments were done
ex vivo and at later stages [ ]. Microarray data from Cdx2 null embryos showed that Cdx4 is
downregulated [3]. However, Cdx2 heterozygotes alone have a normal survival rate and no
defects in the placental labyrinth. This would mean that the combination of missing one
allele of Cdx2 and both alleles of Wnt3a has a more deleterious effect on placental
development that each genetic condition individually.
Wnt canonical signalling has been shown to act both upstream and downstream of
Cdx genes. This signalling pathway rescued several aspects of the phenotype of Cdx mutants,
i.e the axial truncation [2] and the number primordial germ cells (PGCs) that is affected in
Cdx2 null mutants [17]. These findings suggested that the Wnt pathway plays an essential
role in the balance of morphogenesis of the derivatives of the posterior growth zone during
emergence of tissues from the different germ layers. The defects of placental labyrinth in
the compound mutants investigated in this work are most likely result of a deregulation of
allantoic progenitors, since Wnt3a and Cdx2 are not expressed in the allantois itself at the
time point vascular differentiation takes place. Given the many roles of Wnt in the allantoic
and placental development; Fzd5 [57], Wnt2 [58] , Wnt7b [59], Tcf1/Lef1 [56] ; we do not
exclude that this genotype Wnt3a-‐/-‐Cdx2+/-‐ causes a further decrease of Wnt signalling by
other ligands than Wnt3a. We propose that downregulation of Wnt3a and Cdx2 in the
progenitors impairs the expression of other factors, like Wnt2, in the endothelial cells of the
allantois. This hypothesis is supported by results that show that Tcf1-‐/-‐ Lef-‐1-‐/-‐ mutants
allantois does not fuse with the chorion [56].
17
Chapter II – Anterior Hox genes and axial elongation
Introduction
The vertebrate axis
The vertebral column arises from blocks of mesodermal tissue that are formed in a
sequential manner along the AP axis during development. These structures are called
somites and are formed sequentially in pairs on each side of the neural tube, by a process
called somitogenesis. The number of somites formed during development will determine the
number of vertebrae. By a process called resegmentation the posterior half of one somite
will fuse with the anterior half of the succeeding somite to form a complete vertebra. While
the somites show no morphological difference along the AP axis, vertebrae have a different
morphology depending on their position along the axis. The most anterior vertebrae are the
cervical vertebrae, and in the trunk region are the thoracic vertebrae, which are
characterized by the presence of ribs. Posterior to these are the lumbar vertebrae, the sacral
vertebrae, which are fused to form the sacrum, and finally the caudal vertebrae that form
the tail. The number of vertebrae of each morphological group (axial formula) varies
amongst vertebrates and is specific for each species. The mouse has 7 cervical vertebrae, 13
thoracic vertebrae with 7 seven ribs attached to the sternum. The number of lumbar
vertebrae varies from 5 to 6, and 4 sacral vertebrae fuse to form the sacrum. The number of
caudal vertebrae varies from 28 to 30. The identity of the vertebrae along the AP axis is
acquired by the combination of Hox genes expression in their mesoderm precursors.
Hox genes and vertebrate axis
Edward B. Lewis described 30 years ago a gene complex that controls segment
identity in Drosophila [62], since he observed that mutations in the complex resulted in
homeotic transformations in the Drosophila body segments. These genes were later called
Hox genes and were identified in Drosophila as essential in determining the body plan and
the formation of body segment [63]. The term “homeotic” genes is related to homeosis, a
term introduced by William Bateson in 1894 when describing the phenomenon of the
replacement of an expected body part by another [64]. Mutations of Hox genes cause
homeotic transformations, and so they are called homeotic genes. One of the best known
Chapter II – Introduction
18
examples is the mutation Antennapedia (Antp), a homeotic mutation that causes legs to
grow in the place where antennae are normally found on the Drosophila head [65].
Homologs of the fly Hox genes have been identified in most bilaterian animals
studied. In metazoan, Hox genes are evolutionary conserved in structure and function. They
are organized in clusters on the chromosomes. In vertebrates the chromosomal position of
3’ to 5’ Hox genes in the cluster follows the temporal order in which they are expressed. The
initial Hox genes to be expressed are the most 3’ genes (Hox1) followed by the next 5’ genes,
until the most 5’ gene (Hox13) is expressed [66]. This characteristic is called temporal
collinearity. Hox genes also exhibit spatial collinearity of expression [66]. This means that the
more 3’ have a more anterior expression boundary than the more 5’ and later Hox genes
[67].
As result of two rounds of whole genome duplication, mammals obtained 4 copies
of the Hox cluster (A, B, C and D). Every Hox gene has at least 1 close relative or paralog on
another cluster. Mutations of a whole paralog group lead to severe homeotic changes in
axial skeleton of mice. Loss of function of the Hox10 paralog group caused anterior
transformations of all lumbar vertebrae. These mutants have rib-‐bearing vertebrae at the
position of lumbar vertebrae [68]. Hox10 genes therefore repress rib formation in vertebrae
posterior to the ribcage. In the absence of Hox10 the repression is no longer present,
resulting ribs formation on all lumbar vertebrae [68]. When Hox10 was overexpressed at
thoracic levels, the ribcage remains rib-‐less [69]. These results highlight another
characteristic of Hox genes, called posterior prevalence, where the most posteriorly
expressed Hox gene usually imposes its function over that of more anterior genes. This
suppressive mechanism does not involve transcription repression but it is likely to proceed
through protein interaction and competition for co-‐factors [70-‐72]. This repression was
proposed to ensure that more posterior identities arise at posterior axial levels [66].
Hox genes expression and regulation
In the mouse embryo, the expression of the earliest Hox genes is initiated in the
posterior primitive streak, at the boundary between extraembryonic and embryonic tissues
[6,73]. First, the expression is in the epiblast and overlying mesoderm [74,75]. The initial
expression domain spreads anteriorwards in a way that does not correlate with cell lineage,
and does not rely on cell migration until it reaches the anterior-‐most expression boundary.
This was called phase I of expression of Hox genes [74]. The regulation of this initial Hox
transcription is thought to result from events that are connected to the emergence and
Chapter II – Introduction
19
extension of the primitive streak [75]. Wnt and Fgf signalling pathways are involved in early
developmental processes and are also involved in the regulation of Hox genes. Wnt
signalling, which is essential for the initiation of gastrulation, could also modulate Hox gene
expression during anterior spreading of expression domains [75]. A second phase of Hox
gene expression take place at later stages (early somite stages) after their expression
domains reach the region anterior to the streak [74]. From that moment on, Hox gene
expression domain expands parallel to, but not fully clonally, the emerging tissues.
The early expression and dynamics of Cdx genes is very similar to the expression of
Hox genes, likely to be a result of their close evolutionary relationship. As referred above,
Cdx and Hox family genes are close relatives and they derived from a common ProtoHox
ancestral cluster [76]. In addition Cdx is a direct regulator of Hox genes in a dose-‐dependent
way [38,77-‐79] and this regulation is achieved via Cdx binding sites present in the regulatory
region of the respective Hox genes. The regulation of Hox genes by Cdx is not the same for
all the Hox paralog groups [80,81] and it is suggested that Cdx genes could be intermediaries
between Fgf and Wnt signals and the Hox genes [33]. A more recently discovered function of
Cdx genes is that they are essential for the process of embryonic axial elongation in addition
to their involvement in transducing AP positional information together with Hox genes
[2,43]. Since Cdx and Hox genes share an evolutionary history as well as biological functions,
Young et al., 2009 questioned whether Hox genes were also involved in posterior axial
extension, despite the fact that no Hox mutation has ever caused axial truncations. They
showed that gain of function of central or trunk Hox genes (Hoxb8 and Hoxa5) rescued the
truncation of the posterior axis of the Cdx2/4 compound mutants. This demonstrated that
central Hox genes stimulate trunk tissue expansion during posterior axial growth [2]. In
addition, it was shown that the most posterior Hox genes, Hox13 controls axial elongation in
the opposite way. Precocious expression of Hoxb13 (driven by the Cdx2 promoter) resulted
in an axial truncation similar to Cdx mutants.
Together with the observation of a longer body axis in the Hoxb13 knock-‐out [82]
these findings suggest that the function of the most 5’ Hox genes is to arrest axial extension.
Therefore Hox and Cdx genes are involved in coupling the two processes, tissue generation
and the AP patterning.
Based on the previous findings Young et al. 2009 proposed a model where Cdx genes
and trunk Hox genes stimulate the posterior axial growth in the posterior growth zone by
sustaining the signalling required for the maintenance of the axial progenitors. This effect
goes on until Hox13 starts to be expressed to compete with trunk Hox genes, leading to the
Chapter II – Introduction
20
termination of the axis elongation. The switch of expression from trunk Hox genes to
posterior Hox genes would instruct a slowing down of the axial growth. This is referred to as
the trunk-‐tail transition. Axial elongation would depend on Cdx/Hox genes acting on
downstream positive (Wnt and Fgf) and negative (RA) signalling in the posterior growth zone
(Figure 2) [2].
Objective
To test the role of Hoxb1 in the regulation of axial extension, the strategy designed
was to attempt the rescue of Cdx2/4 mutant phenotype by overexpressing Hoxb1 as
previously done for trunk Hox genes (Hoxb8 and Hoxa5). The phenotype of the Cdx2/4
mutant includes a lower survival rate due to failure in placental development and an axial
truncation of variable severity [4]. To show that Hoxb1 rescues the phenotype, Cdx2/4
embryos with the Hoxb1 transgene (Cdx2/4 Cdx2PHoxb1) should have a higher survival rate
and/or a less severe truncation of the axis.
Figure 2 -‐ Interaction of Wnt, RA, Cdx/trunk Hox genes and HoxPG13 in the regulation of axis growth. Left: Schematic representation of the expression level of Cdx/trunk Hox genes, Wnt, Cyp26a1 and HoxPG13 in the posterior region of the embryo during axial growth. Cdx/trunk Hox genes, Wnt and Cyp26a1 have similar expression dynamics while it is opposite to HoxPG13 starting at E10.0 shortly before the trunk-‐tail transition. Three different phases related to the involvement of Cdx/trunk Hox genes during axial growth can be identified; initiation, maintenance and termination. Right: Schematic view of the genetic interaction between Cdx/Hox trunk, Wnt, Ra and HoxPG13. Note the positive feedback loop between Cdx and Wnt. Expression of Cdx/Hox trunk genes in blue, Wnt in green, Cyp26a1 in yellow and HoxPG13 in red. From: Young et al., 2009
21
Methods
Generation of transgenic constructs and mice
To construct the Cdx2PHoxb1, full-‐length cDNA for Hoxb1 (a kind gift of M. Mallo,
IGC, Oeiras Portugal) was cloned behind the 9.4kb Cdx2 promoter fragment [83]. The
construct was injected in Cdx4 deficient male pronuclei to generate transgenic embryos.
Founder mice were recovered and 7 transgenic lines were established.
Isolation of embryos
For expression analysis of the transgene, Cdx4-‐/0 Cdx2PHoxb1 males were crossed
with wild-‐type females. Embryos were isolated at E9.5 in PBS0 at 4°C. Posterior region of the
embryo (posterior to the forelimb) was used for total RNA extraction and the remaining
tissues (anterior region of the embryo, yolk sac and amnion) were used for genotyping. For
analysing the embryonic phenotype of Cdx2/4 Cdx2PHoxb1; Cdx4-‐/-‐ Cdx2PHoxb1 females
were crossed with Cdx2+/-‐ males and embryos were isolated at E10.5 in the same conditions
as describes in Methods of Chapter I.
Bone and cartilage staining
Newborns skin and internal organs were removed. Forelimb was dissected for DNA
isolation and genotyping. Fixation was performed with 96% ethanol including 1% glacial
acetic acid for at least 24 hours. Afterwards cartilage was stained in 80% ethanol/20% acetic
acid and 0.5 mg/ml Alcian Blue (Sigma) overnight. Newborns were washed twice in ethanol
(96%) for 1 hour and soft tissue was dissolved in 1.5% KOH for 2 hours. Bone was stained
overnight in 0.5% KOH including 0.15 mg/ml Alizarin Red S (Sigma). Destaining was
performed in 0.5% KOH/20% glycerol for 3 days and finally newborns were stored in 20%
ethanol/20% glycerol (adapted from: van den Akker et al., 2001 [84]). Cervical, thoracic,
lumbar, sacral and caudal vertebrae were counted.
Genotyping
The procedure is described in Methods of Chapter I. The primer sequences for
genotyping Cdx2 are the same as described in Chapter I. Primer sequences for Hoxb1
Chapter II – Methods
22
transgene are GCCGCAGCCCCCATACGGAA (forward) and AGGCATCTCCAGCGGCTTCCT
(reverse). Cdx4-‐null embryos were confirmed by the presence of the Y chromosome using
primer sequences for Sry, TTATGGTGTGGTCCCGTGGTGAG (forward) and
TGTGATGGCATGTGGGTTCCTGT (reverse). The PCR conditions for Cdx2 and Sry are the same
as described in Methods of Chapter I. The touchdown PCR conditions for Hoxb1 transgene
were 94°C for 1 min, 92°C for 30 seconds (sec), 65°C with a decrease of 0.6°C per cycle, 72°C
for 45 sec for 12 cycles, 92°C for 30sec, 58°C for 30 sec, 72°C for 45 sec for 20 cycles, 72°C for
3 min and 12°C until the end of reaction. In 10μl mixture with 0.5 μM of each primer, 0.2
mM of each dNTP,1.5 mM MgCl2 and 1x PCR buffer (Promega 5x Flexi Green GoTaq Buffer).
RNA isolation
After embryos isolation and dissection the tissue were directly placed in a tube with
1 ml of TRIZOL Reagent (Ambion®, Life Technologies). Samples were stored at -‐80°C or
proceeded to RNA isolation. To isolate total RNA firstly the samples were homogenised, at
room temperature (RT), by pipetting up and down the tissue in the TRIZOL reagent. Next
step was phase separation, 0.2 ml of chloroform was added and the mixture was shaken for
15 sec. After incubating at RT for 2-‐3 minutes the samples were centrifuged at 12000 x g for
5 min at 4°C. The solution separates into a lower, an interphase and an upper aqueous
phase that contains the RNA. This aqueous phase is recovered into a new tube and the next
procedure is RNA isolation. RNA was precipitated by adding 0.5 ml of 100% isopropanol (5-‐
10 μg of glycogen is also added as a carrier) and incubated at RT for 10 min followed by
centrifugation for 10 min at 12000g at 4°C. After centrifugation the pellet was visible and
was washed with 1 ml of 75% EtOH. The pellet was air dried at RT for 5-‐10 min. The RNA was
ressuspended in 20 μl of DEPC-‐treated water (DEPC water) and left for 15 min at 55°C.
Samples were stored at -‐80°C. RNA concentration was quantified using Nanodrop analysis
(Thermoscientific,USA).
DNAse treatment
From the RNA isolated using TRIZOL reagent, 15 μl were used, 4 μl of transcription
buffer and 2 μl of DNAse (Roche-‐RNA free) were added. The mixture was incubated for 1 h
at 37°C. After DNA digestion the solution is diluted with 115 μl of DEPC water and 15μl of
Ammonium Acetate (5M) (BDH® Reagents) is added to stop DNAse activity. The next step
was phenol/chloroform extraction followed by isopropanol precipitation. The RNA is
ressuspended in 20 μl of DEPC water and stored at -‐80°C.
Chapter II – Methods
23
cDNA synthesis
cDNA was synthesized from RNA samples using the SuperScript™ II RT (Invitrogen).
The reverse transcription reaction includes 1 μg of total RNA, 1 μl of dNTP mix (10 mM) and
13 μl of DEPC water, incubation for 5 min at 65°C, addition of 5x First-‐Strand Buffer and 2 μl
of 0.1 M DTT followed by incubation at 42°C for 2 min. 1 μl of SuperScript II RT enzyme was
added, new incubation for 50 min at 42°C and afterwards the reaction was inactivated by
incubating at 70°C for 15 min.
Quantitative RT-‐PCR analysis
Q-‐RT PCRs were performed in duplicate for 3 individual samples from each
genotype, with 2 μl of amplified cDNA per reaction using Light Cycler DNA Master SYBR
Green 1 (Roche) according to manufacturer’s instructions. Real time PCR was carried out
using the My iQ PCR equipment (BioRad). The reaction conditions were in 25 μl of mixture
with 200 nM of forward and reverse primers, 1x Reaction buffer (2x iQ SYBR Green mix) and
5 μl of cDNA. The primer sequences used for Gapdh were TTCACCACCATGGAGAAGGC
(forward) and GGCATGGACTGTGGTCATGA (reverse). Hoxb1 primers were designed in the
exon-‐exon junction, the sequences are CCTCCTTCTGAGGACAAGGAA (forward) and
GACACCTTCGCTGTCTTAGGTG (reverse).
Relative gene expression was calculated by the comparative Ct method [85].
Significance of fold difference was analysed with t-‐student test using Microsoft® Excel® for
Mac 2011 (2010 ©Microsoft Corporation).
Statistical Analysis
For statistical analyses of vertebra counts IBM® SPSS® Statistics (IBM Corp. Released
2011, Version 20.0. Armonk, NY) was used. The Kolmogorov-‐Smirnov test was used to test
for normality of distribution of the counted vertebrae. Since the data sets were normally
distributed, Mann-‐Whitney (U) test was used to analyze the significance of the difference of
the sacro-‐caudal vertebrae between groups.
24
Results A construct of full length Hoxb1 cDNA under the Cdx2 promoter was injected in
Cdx4-‐/-‐ (from now on referred as Cdx4 null) zygotes. 7 founder mice were obtained and 7
transgenic lines were generated (A-‐G). Line B and C had no transgenic descendants and were
discarded for no germline transmission. For line A the founder was a male and it was crossed
with a Cdx4 null female to generate a colony and females for further crossing. Cdx4 null
Cdx2PHoxb1 (Cdx4 null Cdx2PHoxb1) females were crossed with Cdx2+/-‐ males in order to
generate Cdx2+/-‐ Cdx4-‐/-‐ Cdx2PHoxb1 newborns (hereafter called Cdx2/4 Cdx2PHoxb1)
Hoxb1 is overexpressed in the Cdx2PHoxb1 transgenic mice
In order to assure that the Cdx2PHoxb1 transgene was active, positive mice for the
transgene (Cdx4+/-‐ Cdx2PHoxb1) were tested to see whether they show a higher expression
of Hoxb1 compared to embryos without the transgene (Cdx4+/-‐), in the time window of Cdx2
expression. The Cdx2 promoter used, drives expression in the posterior region of the
embryo from E7.2 to E12.5. This
expression pattern is very similar to
that of Hoxb1 in the same region,
both in time and in space. The
expected difference of expression
of Hoxb1 between transgenic
embryos and non-‐transgenic
embryos is therefore quantitative
and not qualitative. Quantitative
real time PCR (qPCR) was used to
measure the relative Hoxb1
expression difference between
transgenic (Cdx2PHoxb1) and non-‐transgenic littermates. The embryonic stage examined
was E9.5, a time point where the Cdx2 promoter is active in the posterior region. At this
stage, Hoxb1 is also expressed in the anterior region of the embryo, in rhombomere 4 [86],
therefore only the tissue posterior to the heart was used to extract total RNA. Figure 2.1
shows the increase by 11.76-‐fold (Annex I) of Hoxb1 expression between transgenic and
non-‐transgenic embryos for the line investigated. This data indicates that there is
overexpression of Hoxb1 in the posterior part of these embryos and therefore the transgene
is active.
Figure 2.1 – Overexpression of Hoxb1 in Cdx2PHoxb1 mice. Expression of Hoxb1 was quantitatively measure by real-‐time PCR in dissected posterior tissues of E9.5 Cdx4+/-‐ and Cdx4+/-‐ Cdx2PHoxb1 embryos. Gapdh was used as endogenous control. Transgenic mice have a 11-‐fold increase of Hoxb1 expression. * significantly different; p-‐value=0,0105. Error bar represent the standard error of mean. Detailed data in Annex I
Chapter II – Results
25
Hoxb1 transgene does not recue defects from the placental labyrinth
of Cdx2/4 mutants.
To assess whether Hoxb1 is capable of rescuing the Cdx2/4 placental labyrinth
defects that lead to embryonic death, we asked the question whether the survival rate of
embryos would improve respectively to that of Cdx2/4 mutants. For each of the 5 transgenic
lines Cdx4 null Cdx2PHoxb1 females where crossed with Cdx2+/-‐ males. Newborns from that
cross were genotyped and newborn survival was analysed. Each line has a different founder,
because each line represents a different insertion site of the transgene, what could be
possibly translated into a different phenotype
Table 2.1 shows the number of observed and expected newborns per genotype for
lines E, G and F. The number of
newborns analysed is low and so
statistically they should be
interpreted as indications. A
survival rate lower than 100% for
Cdx4+/-‐Cdx2+/-‐ and Cdx2/4 mutants
is expected [4]. For lines E, G and F
the number of observed newborns
carrying the Hoxb1 transgene is
very low. Table 2.1 also shows that
the newborns survival decreases
when Hoxb1 transgene is expressed
in combination with Cdx null alleles.
Table 2.2 shows the number of newborns obtained from the same cross from
founders of line A and D. For these lines the presence of the transgene in the Cdx4 mutant
background has no significant effect on the survival of embryos. Although the number of
Cdx2/4 Cdx2PHoxb1 newborns is low, the data does not show that the presence of the
transgene is able to overcome the lethality of the Cdx2/4 mutants since there is only one
Cdx2/4 Cdx2PHoxb1 newborn.
The results indicate an effect of the insertion site of the transgene, since different
lines present differences in survival of newborns. For lines in Table 2.1, the transgene has a
lethal effect on embryonic development. This lethality could be due to the fact that the
Table 2.1. Number of expected and observed newborns for transgenic lines E, F and G. The total number of transgenic newborns compared with the total number of non-‐transgenic newborns for each line. For each line is also represented the number of observed and expected newborns for each of the genotypes. *The expected number was calculated using the Mendelian rule based on the expected rate of Cdx4+/-‐ newborns being 1/8. The number of expected newborns is 1/8 (7, 4 and 8 newborns for lines E, F and G respectively) for all genotypes.
Chapter II – Results
26
construct is inserted in an essential
region of the chromosome.
Alternatively it could mean that the
transgene expression aggravates
the Cdx phenotype and that these
integration sites make the
transgene more active than in lines
A and D, causing lethality even in
the Cdx4 null background. This
hypothesis will be further
investigated by crossing the
founders of these lines with wild-‐
type mice.
Together, these data show
that Hoxb1 overexpression in
Cdx2/4 mutants differs from overexpression of Hox trunk genes (Hoxb8, Hoxa5) in the same
genetic background [2]. Hox trunk genes were able to rescue the Cdx2/4 lethal placental
defects while Hoxb1 is not.
Hoxb1 does not rescue the axial defects of Cdx mutants
In order to investigate whether Hoxb1 is able to rescue the truncation of the Cdx2/4
mutant, skeletons of newborns were stained and analysed. The results described above
showed that the presence of the transgene does not improve the survival and to test
whether there were any effects on the skeletal axis, newborns of all genotypes were
analysed. For the analysis of the skeletal phenotype of each genotype all newborns were
considered irrespectively of the line from which they were generated since no phenotypic
differences were found between lines.
Table 2.2. Number of expected and observed newborns for transgenic lines A and B. The total number of transgenic newborns compared with the total number of non-‐transgenic newborns for each line. For each line is also represented the number of observed and expected newborns for each of the genotypes. *The expected number was calculated using the Mendelian rule based on the expected rate of Cdx4+/-‐ newborns being 1/8. The number of expected newborns is 1/8 (10 and 5 newborns for lines A and D respectively) for all genotypes.
Chapter II – Results
27
Table2
.3. Ve
rteb
ral ph
enotyp
e of Cdx4+/
-‐ Cd
x4-‐/0 ,
Cdx2
+/-‐ Cd
x4+/-‐ , Cd
x2/4 w
ith and
with
out the Cd
x2PH
oxb1
transgene
. Th
e nu
mbe
r of skeletal
prep
arations analysed for each gen
otype is referred in the
top
. The nu
mbe
rs rep
resent the
num
ber of new
borns that exhibit the respectiv
e axial
phen
otype. Tab
les was adapted
from
. van den
Akker et a
l., 200
2
Figu
re 2
.2 –
Schem
atic rep
resentation
of
part of the
mou
se verteb
ral axis. Each
rectan
gle represen
ts a vertebra. O
n the rig
ht
the
diffe
rent
verteb
rae
iden
tity
are
represen
ted by differen
t colours. The
black
vertical line
rep
resents the sternu
m, the
red
ho
rizon
tal lines are th
e rib
s and the light blue
lines rep
resent the
fusion
betw
een
sacral
verteb
rae. V
–verteb
ra; C
– cervical; T
– thoracic; S – sacral; Cd
– cau
dal. Ad
apted
from
Favier a
nd Dollé , 19
97 [8
7].
Chapter II – Results
28
Cdx4 +/-‐ and Cdx4+/-‐ Cdx2PHoxb1
Cdx4+/-‐ littermates show a wild-‐type vertebral phenotype (this work and [4]). From
the 34 newborns with this genotype 13 skeletons were analysed. There are only two
deviations from the wild-‐type phenotype: 1/13 had the most caudal thoracic vertebrae with
rib attached to sternum in the 15th vertebrae (V15) unilaterally, which means that it had 8
sternal ribs, and 1/13 had 14 thoracic vertebrae (Table 2.3). This anterior transformation at
the V15 level has been observed with a very low penetrance in Cdx4 null [4] and with a 100%
penetrance in Cdx2/4 mutants [2,4]. The number of lumbar, sacral and caudal vertebrae is
the same as in the wild-‐type phenotype (5-‐6 lumbar, 4 sacral and 28-‐30 caudal vertebrae).
From the 16 Cdx4+/-‐ Cdx2PHoxb1 newborns, 12 axial skeletons were analysed. The presence
of 14 thoracic ribs was more frequent, with 4/12 newborns with this phenotype (3 bilaterally
and 1 unilaterally, Table 3) and two of these (2/12) had 8 sternal ribs. The anterior
transformation at the V15 level seen, with very low penetrance in the Cdx4+/-‐, has a higher
penetrance in the presence of the Hoxb1 transgene. At the lumbar, sacral and caudal levels
there are no differences between the transgenic and non-‐transgenic newborns.
Cdx4 null and Cdx4 null Cdx2PHoxb1
Cdx4 null mutants have been described by Van Nes et al., 2006 to have similar
phenotype as Cdx4+/-‐ described above. From the 29 newborns with this genotype, 13
newborns had their skeleton stained and analysed. The V15 to V14 transformation has a
higher penetrance in Cdx4 null, when compared to Cdx4 heterozygous. 3/13 had the last
sternal ribs on V15 level (8 sternal ribs) and 3/13 had 14 thoracic ribs (2/10 unilaterally and 1
bilaterally). At the other skeletal levels the phenotype was wild-‐type-‐like. 11 transgenic
newborns in the Cdx4 null genetic background were analysed. The penetrance of the V15 to
V14 transformation seen in the non-‐transgenic newborns was much higher, with 8/11 with 8
sternal ribs (2 unilaterally, 6 bilaterally) and 7/11 with 14 ribs (all bilaterally). Without the
transgene the penetrance of this transformation was about 25% but with the Hoxb1
transgene 85% of the newborns have this transformation (Fig.2.3). At more posterior levels,
the number of lumbar, sacral and caudal vertebrae does not vary between transgenic and
non-‐transgenic mice. It seems that the presence of the transgene in the Cdx4 null genetic
background aggravates the effect of the Cdx4 null mutation, rendering it more similar to the
thoracic phenotype of Cdx2/4.
Chapter II – Results
29
Cdx2+/-‐ Cdx4 +/-‐ and Cdx2+/-‐ Cdx4 +/-‐ Cdx2PHoxb1
The Cdx4+/-‐Cdx2+/-‐ (double heterozygote) skeletal phenotype shows the anterior
transformation at the V15 level in two thirds of the analysed newborns. In addition, these
newborns have transformations at the sacral level, 5/12 have 5 fused sacral vertebrae (3
unilaterally and 2 bilaterally) instead of 4. There is a slight truncation of the axis in some of
the skeletons analysed: 4/12 have less than 25 caudal vertebrae. These transformations with
low penetrance in the sacral and
caudal regions are probably due to
the lack of one Cdx2 allele, becoming
more severe in the Cdx2/4 mutant.
From the 6 transgenic newborns
analysed, 5/6 have 8 sternal ribs and
4/6 have 14 thoracic ribs, which
makes the V15 transformation more
common than in the non-‐transgenic
mice. At the sacral level, 5 of the 6
have more than 4 sacral fused vertebrae, varying between 5 and 9 (Fig.2.4).
The phenotype of a fused sacrum with more than 5 vertebrae resembles the
phenotype of the Cdx2/4 mutants. In the non-‐transgenic double heterozygotes, the
maximum number of sacral vertebrae observed is 5 and this transformation has a low
penetrance. Posterior to the sacral level the vertebrae have many malformations and as a
result, in some cases, these mice present a curly tail (Fig.2.5). Besides malformations these
transgenic newborns show a truncation of the axis: the number of distinct caudal vertebrae
Figure 2.3 Anterior homeotic-‐like transformations in rib cage of Cdx4 null Cdx2PHoxb1. Rib cage of skeletal preparations from Cdx4 null (A,B) and Cdx4 null Cdx2PHoxb1 (C,D), both dorsal (B,D) and ventral views (A,C). The numbers indicate the thoracic vertebrae and ribs attached to the sternum. A and B show 13 thoracic vertebrae from which 7 are attached the sternum. In C and D 8 ribs are attached to the sternum, from a total of 14 thoracic ribs. Cdx4 null Cdx2PHoxb1 have an anterior homeotic-‐like transformation at the level of V15 and V21.
Figure 2.4. Defects in sacral vertebrae of double heterozygote expressing Cdx2PHoxb1. Sacral region of skeletal preparations from Cdx4+/-‐Cdx2+/-‐ (A) and Cdx4+/-‐Cdx2+/-‐ Cdx2PHoxb1 (B,C). Transgenic mice (B,C) present defects in the sacral area, number of fused vertebrae is higher and the morphology of vertebrae is altered.
Chapter II – Results
30
varies from 14 to 20 with many vertebrae fused. The number of sacral plus caudal vertebrae
in the double heterozygous expressing the transgene is significantly lower (Fig2.6; p-‐value
0,041; Annex II) than in the double heterozygous without the transgene. The axis truncation
in these newborns shows that Hoxb1 aggravates the Cdx phenotype instead of correcting it.
Figure 2.5. Axial truncation and vertebrae malformations in caudal vertebrae in Cdx2+/-‐Cdx4+/-‐
Cdx2PHoxb1. Caudal region of skeleton preparations from Cdx2+/-‐Cdx4+/-‐(A) and Cdx2+/-‐Cdx4+/-‐
Cdx2PHoxb1 (B-‐G). Note the variation of the level of truncation (B-‐D) and a curly tail (C-‐D). The caudal vertebrae of transgenic mice are fused and underdeveloped. A and B are lateral views and C-‐G are dorsal views. F and G are enlargements of C and D, respectively. Arrows point to defects in caudal vertebrae.
Figure 2.6. Sacral-‐caudal vertebrae counts in transgenic and Cdx mutants. The graph represents the number of sacral plus caudal vertebrae for each studied genotypes. The statistical difference between transgenic and non-‐transgenic is denoted on top of the bars. Cdx2PHoxb1 causes a significant decrease in the number of posterior vertebrae in the Cdx2+/-‐Cdx4+/-‐ background. Error bars represent the standard deviation. ns1 (not significant, p-‐value=0,314). ns2 (not significant, p-‐value=0,880). * (significant, p-‐value=0,041). Detailed data and statistical analysis in Annex II.
Chapter II – Results
31
Cdx2/4 and Cdx2/4 Cdx2PHoxb1
The skeletal axis transformations of the Cdx2/4 mutants have been discussed before
[2] In this work, from the 4 newborns, 4 were analysed and 3/4 show an anterior homeotic-‐
like transformation at V8 (8 cervical vertebrae T1-‐>C7), V15 (8 sternal ribs (T8-‐>T7) and V28
(7 lumbar vertebrae, S1-‐>L6). The number of sacral vertebrae varies from 5 to 6. These
mutants have an axial truncation; the number of caudal vertebrae varies from 8 to 12.
If Hoxb1 is capable of rescuing the Cdx2/4 axial truncation, Cdx2/4 Cdx2PHoxb1
newborns should possess a higher number of caudal vertebrae. Newborns with this
genotype were rare; from all lines only one pup was born. At more anterior levels this
animal had the same phenotype as Cdx2/4, the same anterior transformation. Starting at the
lumbar level most of vertebrae are fused which makes it very difficult to distinguish lumbar
from sacral vertebrae. The axis of this animal terminates at the sacrum level (Fig.2.7). This
truncation is more severe than the truncation of the Cdx2/4 mutants described in this work.
However the level of the truncation in Cdx2/4 varies and a truncation at the level of the
sacrum has been described before [2]. The data in the present work refers only to one
newborn, which likely does not represent all the possible phenotypic variations of this
genotype.
Analysis of the phenotype of Hoxb1 transgenic embryos
To better understand the phenotype of the Cdx2/4 Cdx2PHoxb1 newborns, the
same crosses described above were performed for embryonic analysis. This approach would
increase the probability of getting Cdx2/4 Cdx2PHoxb1 genotypes and allow analysis of their
phenotype and the cause of embryonic lethality. In Figure 2.8C,D a Cdx2/4 Cdx2PHoxb1
embryo at E10.5 is represented. The axis of the embryo is severely truncated and at this
embryonic stage the truncation seems more severe than the Cdx2/4 mutant without Hoxb1
Figure 2.7. Cdx2/4 Cdx2PHoxb1 newborn shows a truncation of the axis more severe than Cdx2/4. Posterior region of skeletal preparations of Cdx2/4 newborn (A) and Cdx2/4 Cdx2PHoxb1 (B,C). The axis of the transgenic newborn terminates at the sacral level, no caudal vertebrae are formed (B,C). The sacral region is very defective (C). C is an enlargement of B.
Chapter II – Results
32
transgene. The axis is terminated just posteriorly to the hindlimb and the tailbud is not
distinguishable as in the Cdx2/4.
Putting the data together from the recovery rate of transgenic newborns and the
corresponding phenotypes, Hoxb1 is not capable of rescuing either the placental defects
that lead to embryonic death or the posterior truncation of the Cdx2/4 mutants. The data
suggests that the presence of Hoxb1 aggravates the phenotypes of the different Cdx
genotypes. Regarding the skeletal axis, the presence of the transgene increases the
penetrance of the homeotic changes seen in the non-‐transgenic mice in the same genetic
background. Also, both the newborn and embryo show a more severe truncation of the axis
than what is observed in Cdx2/4 non-‐transgenic. Since the data of the newborns survival
differ between lines, it is possible that this negative effect of Hoxb1 on axis elongation is
stronger in the lines E, F and G. In that case Hoxb1 would lead to such a high lethality that no
Cdx mutants carrying the transgene would be recovered.
Figure 2.8. Severe truncation of the axis in Cdx2/4 Cdx2PHoxb1 embryos. Photographs of E10.5 Cdx2/4 (A,B) and Cdx2/4 Cdx2PHoxb1 (C,D) embryos. Axis of transgenic embryos is truncated at the level of the hindlimb and morphology of tailbud is altered. B and D are an enlargement of A and C, respectively. Dash lines surround the tail bud and the hindlimbs. HL – hindlimb. Scale bars in A,B and C represent 1 mm and in C represent 500 μm.
33
Discussion Cdx and trunk Hox genes are expressed in the axial progenitor region in the
posterior growth zone where they play a pivotal role in the regulation of axial extension.
This work set out to discover whether anterior Hox gene, Hoxb1 participates with Cdx genes
in this regulation. Here it is shown that this 3’ Hox gene (Hoxb1), unlike trunk Hox genes,
does not rescue the Cdx2/4 placental defects or the defects in patterning and extension of
the body axis. On the contrary, Hoxb1 aggravates the Cdx2/4 phenotype causing a higher
rate of lethality and a more severe truncation of the axis.
Experiments of overexpression of Hoxb1 under the control of Dll1 promoter
(expression in the presomitic mesoderm) in wild-‐type embryos lead to anterior
transformations at the V15 level similar to Cdx mutants [88]. We also observe this
phenotype in the Cdx2PHoxb1 transgenic newborns suggesting that this anterior phenotype
is consistent with Hoxb1 overexpression in the PSM. Since Dll1 is not expressed in the
posterior progenitors, this Hoxb1 overexpression does not lead to defects in axis extension
or survival.
Until now one Hox paralog group has been shown to cause truncation when
overexpressed, the Hox13 [2,89]. Overexpression of Hoxb13 under the same spatiotemporal
conditions of Cdx2 leads to a precocious arrest of the axial growth. It is believed that Hox13
acts on terminating axis extension by dominantly competing with trunk Hox genes. Given
the resemblance of the phenotype we wonder whether Hoxb1 interaction with Cdx/Hox
trunk genes is proceeding similarly to that of Hoxb13. Both Hox1 and Hox13, the groups at
the extremities of the Hox cluster, differ at several aspects from the central Hox genes.
Recent findings about binding specificity of Drosophila Hox proteins, suggested that Hox1
has a binding preference that differs considerably from Hox2-‐8, and from Hox13 [90].
Analysis of the number of amino acid substitutions between the Drosophila
homeodomains, showed that compared to Antp (Hox6) substitutions values increase in both
directions towards labial (lab) and toward Abd B (the most posterior domain, Hox13) [89].
These results are consistent with the hypothesis that the second thoracic segment in
Drosophila, which expresses Antp, represents the so-‐called “developmental ground state”.
This ground state was identified since loss of function mutations lead back to this state while
gain of function mutations lead away from it [89]. This means that Hox genes anterior and
posterior to Antp are epistatic over this ground state gene and therefore have a similar
dominance. From this “developmental ground state” perspective, both anterior and
posterior prevalence therefore play a role in Drosophila’s axial patterning. As central Hox
Chapter II – Discussion
34
genes together with Cdx genes promote axial extension, dominance of Hox1 over central
Hox genes in the Cdx2PHoxb1 transgenic embryos would lead to defects in axial extension,
similar to Cdx mutants. Interestingly when both Hoxb8 and Hob13 are overexpressed in the
Cdx2/4 mutants the result is the rescue of the phenotype [2]. It was proposed the right ratio
between posterior and anterior Hox genes might required for the process of axis extension
[2].
Besides interacting with trunk Hox genes Hoxb1 could have a negative effect on Cdx
genes. What has been shown is that Cdx negatively regulates Hoxb1 Experiments of
overexpression of Xcad3 (Cdx4 homolog) in Xenopus embryos showed upregulation of Hox
trunk genes but downregulation of Hox anterior genes [33]. This supported that Cdx
differentially regulates different subsets of Hox genes, and this regulation would be positive
for trunk Hox genes and antagonistic with anterior Hox genes. This emphasizes that trunk
Hox genes and Cdx form a functional entity different from both Hox1 and Hox13.
Rescue experiments of Cdx mutants by Hox genes, showed that only trunk/central
Hox genes promote axial extension, by interacting with Cdx genes. Hox genes posterior and
anterior to these, Hoxb9, Hoxc12 (personal communication) and now Hoxb1 were not able
to rescue the Cdx phenotype.
Together we propose that the overexpression of Hoxb1 in the axial progenitors
alters the endogenous balance between anterior and trunk Hox genes, therefore
aggravating the Cdx2/4 phenotype.
35
Concluding remarks
The work described in this thesis concerns the developmental role of Cdx genes and
the interaction with Wnt signalling and anterior Hox genes. In Chapter I we focused on the
interaction between Cdx genes and canonical Wnt signalling pathway by examining Wnt3a-‐/-‐
Cdx2+/-‐ mutant embryos. The lethality of these mutant embryos appears to result from
insufficient vascularization of the placenta, a phenotype similar to that of Cdx2/4
mutants. We propose that this deficiency is most likely a result of a decrease in Wnt
signaling below the needed threshold. This hypothesis might be tested by monitoring the
activity of the canonical Wnt signaling via qPCR of the Wnt "read out" Axin2 in posterior
tissues of E8.5-‐E10.5 developing embryos. Nevertheless these results give further proof that
Cdx genes and canonical Wnt signalling interact in the maintenance of the progenitor
population in the posterior growth zone of the embryo. However, these two factors are not
the only players in the regulation of these progenitors, Hox genes together with Cdx also
plays a role. The experimental results in Chapter II report the interaction of an anterior Hox
gene with Cdx in the regulation of axial extension. Unlike Hoxa5 and Hoxb8 [2], the 3'Hox
gene Hoxb1 is not capable of rescuing the posterior truncation of Cdx2/4 mutants, but
aggravates the truncation of the Cdx mutants. Since Hoxb1 and the Cdx genes are expressed
simultaneously in the posterior growth zone of the embryos we should investigate why the
normal – endogenous -‐ expression of the two genes does not lead to axial truncation. This
can be achieved by investigating whether Hoxb1 and the Cdx genes are normally expressed
in different cell populations during axial extension. Alternatively the control of axial
elongation may rely on a quantitative ratio of Hoxb1 and Cdx expressed in the same cell
populations. In the latter case, it will be necessary to understand on which molecular basis
the overexpressed Hoxb1 protein interferes with the Cdx proteins in the process of tissue
growth.
Since the dynamics of expression of Wnt3a in posterior axial tissues follows that of
Cdx and central Hox genes [2], the aggravation of the Cdx2/4 phenotype by overexpression
of Hoxb1 could also translate a downregulation of the Wnt signalling.
The results presented in this thesis show that Cdx genes are essential for the
generation of axial and extraembryonic tissues and they function by regulating and
interacting with signalling pathways, like canonical Wnt pathway, and other transcription
factors, like Hox genes.
37
References 1. Wilson V, Olivera-‐Martinez I, Storey KG (2009) Stem cells, signals and vertebrate body
axis extension. Development 136: 1591–1604.
2. Young T, Rowland JE, van de Ven C, Bialecka M, Nóvoa A, et al. (2009) Cdx and Hox Genes Differentially Regulate Posterior Axial Growth in Mammalian Embryos. Developmental Cell 17: 516–526.
3. van de Ven C, Bialecka M, Neijts R, Young T, Rowland JE, et al. (2011) Concerted involvement of Cdx/Hox genes and Wnt signaling in morphogenesis of the caudal neural tube and cloacal derivatives from the posterior growth zone. Development 138: 3451–3462.
4. van Nes J, de Graaff W, Lebrin F, Gerhard M, Beck F, et al. (2006) The Cdx4 mutation affects axial development and reveals an essential role of Cdx genes in the ontogenesis of the placental labyrinth in mice. Development 133: 419–428.
5. Takada S, Stark KL, Shea MJ, Vassileva G, McMahon JA, et al. (1994) Wnt-‐3a regulates somite and tailbud formation in the mouse embryo. Genes Dev 8: 174–189.
6. Young T, Deschamps J (2009) Hox, Cdx, and anteroposterior patterning in the mouse embryo. Curr Top Dev Biol 88: 235–255.
7. Tam PP, Behringer RR (1997) Mouse gastrulation: the formation of a mammalian body plan. Mech Dev 68: 3–25.
8. Wolpert L, Tickle C (2010) Principles of Development. 4th ed. Oxford: Oxford University Press. pp.
9. Whitman M (2001) Nodal signaling in early vertebrate embryos: themes and variations. Developmental Cell 1: 605–617.
10. Lawson KA, Meneses JJ, Pedersen RA (1991) Clonal analysis of epiblast fate during germ layer formation in the mouse embryo. Development 113: 891–911.
11. Stern CD, Charite J, Deschamps J, Duboule D, Durston AJ, et al. (2006) Head-‐tail patterning of the vertebrate embryo: one, two or many unresolved problems? Int J Dev Biol 50: 3–15.
12. Cambray N, Wilson V (2002) Axial progenitors with extensive potency are localised to the mouse chordoneural hinge. Development 129: 4855–4866.
13. Cambray N, Wilson V (2007) Two distinct sources for a population of maturing axial progenitors. Development 134: 2829–2840.
14. Tzouanacou E, Wegener A, Wymeersch FJ, Wilson V, Nicolas J-‐F (2009) Redefining the Progression of Lineage Segregations during Mammalian Embryogenesis by Clonal Analysis. Developmental Cell 17: 365–376.
15. Ribes V, Le Roux I, Rhinn M, Schuhbaur B, Dollé P (2009) Early mouse caudal
References
38
development relies on crosstalk between retinoic acid, Shh and Fgf signalling pathways. Development 136: 665–676.
16. del Corral RD, Storey KG (2004) Opposing FGF and retinoid pathways: a signalling switch that controls differentiation and patterning onset in the extending vertebrate body axis. BioEssays 26: 857–869.
17. Bialecka M, Young T, Sousa Lopes SC de, Berge ten D, Sanders A, et al. (2012) Cdx2 contributes to the expansion of the early primordial germ cell population in the mouse. Dev Biol 371: 227–234.
18. Martin BL, Kimelman D (2010) Brachyury establishes the embryonic mesodermal progenitor niche. Genes Dev 24: 2778–2783.
19. van Amerongen R, Nusse R (2009) Towards an integrated view of Wnt signaling in development. Development 136: 3205–3214.
20. Logan CY, Nusse R (2004) The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20: 781–810.
21. Greco TL, Takada S, Newhouse MM, McMahon JA, McMahon AP, et al. (1996) Analysis of the vestigial tail mutation demonstrates that Wnt-‐3a gene dosage regulates mouse axial development. Genes Dev 10: 313–324.
22. Galceran J, Fariñas I, Depew MJ, Clevers H, Grosschedl R (1999) Wnt3a-‐/-‐-‐like phenotype and limb deficiency in Lef1(-‐/-‐)Tcf1(-‐/-‐) mice. Genes Dev 13: 709–717.
23. Aulehla A, Wehrle C, Brand-‐Saberi B, Kemler R, al E (2003) Wnt3a plays a major role in the segmentation clock controlling somitogenesis. Developmental Cell.
24. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, et al. (1999) Requirement for Wnt3 in vertebrate axis formation. Nat Genet 22: 361–365.
25. Rhinn M, Dollé P (2012) Retinoic acid signalling during development. Development 139: 843–858.
26. Niederreither K, Subbarayan V, Dollé P, Chambon P (1999) Embryonic retinoic acid synthesis is essential for early mouse post-‐implantation development. Nat Genet 21: 444–448.
27. Abu-‐Abed S, Dollé P, Metzger D, Beckett B, Chambon P, et al. (2001) The retinoic acid-‐metabolizing enzyme, CYP26A1, is essential for normal hindbrain patterning, vertebral identity, and development of posterior structures. Genes Dev 15: 226–240.
28. Sakai Y, Meno C, Fujii H, Nishino J, Shiratori H, et al. (2001) The retinoic acid-‐inactivating enzyme CYP26 is essential for establishing an uneven distribution of retinoic acid along the anterio-‐posterior axis within the mouse embryo. Genes Dev 15: 213–225.
29. Dorey K, Amaya E (2010) FGF signalling: diverse roles during early vertebrate embryogenesis. Development 137: 3731–3742.
30. Yamaguchi TP, Harpal K, Henkemeyer M, Rossant J (1994) fgfr-‐1 is required for
References
39
embryonic growth and mesodermal patterning during mouse gastrulation. Genes Dev 8: 3032–3044.
31. Yang X, Dormann D, Münsterberg AE, Weijer CJ (2002) Cell movement patterns during gastrulation in the chick are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8. Developmental Cell 3: 425–437.
32. Dubrulle J, Pourquié O (2004) Coupling segmentation to axis formation. Development 131: 5783–5793.
33. Isaacs HV, Pownall ME, Slack JM (1998) Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3. EMBO J 17: 3413–3427.
34. Isaacs HV, Pownall ME, Slack JM (1995) eFGF is expressed in the dorsal midline of Xenopus laevis. Int J Dev Biol 39: 575–579.
35. Mlodzik M, Fjose A, Gehring WJ (1985) Isolation of caudal, a Drosophila homeo box-‐containing gene with maternal expression, whose transcripts form a concentration gradient at the pre-‐blastoderm stage. EMBO J 4: 2961–2969.
36. Moreno E, Morata G (1999) Caudal is the Hox gene that specifies the most posterior Drosophile segment. Nature 400: 873–877.
37. Meyer BI, Gruss P (1993) Mouse Cdx-‐1 expression during gastrulation. Development 117: 191–203.
38. Subramanian V, Meyer BI, Gruss P (1995) Disruption of the murine homeobox gene Cdx1 affects axial skeletal identities by altering the mesodermal expression domains of Hox genes. Cell 83: 641–653.
39. Beck F, Erler T, Russell A, al E (1995) Expression of Cdx-‐2 in the mouse embryo and placenta: Possible role in patterning of the extra-‐embryonic membranes. Developmental dynamics.
40. Chawengsaksophak K, de Graaff W, Rossant J, Deschamps J, Beck F (2004) Cdx2 is essential for axial elongation in mouse development. Proc Natl Acad Sci USA 101: 7641–7645.
41. Chawengsaksophak K, James R, Hammond VE, Köntgen F, Beck F (1997) Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386: 84–87.
42. Strumpf D (2005) Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 132: 2093–2102.
43. van den Akker E, Forlani S, Chawengsaksophak K, de Graaff W, Beck F, et al. (2002) Cdx1 and Cdx2 have overlapping functions in anteroposterior patterning and posterior axis elongation. Development 129: 2181–2193.
44. Deschamps J, van Nes J (2005) Developmental regulation of the Hox genes during axial morphogenesis in the mouse. Development 132: 2931–2942.
References
40
45. Gamer LW, Wright CV (1993) Murine Cdx-‐4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern. Mech Dev 43: 71–81.
46. Gaunt SJ, Drage D, Trubshaw RC (2005) cdx4/lacZ and cdx2/lacZ protein gradients formed by decay during gastrulation in the mouse. Int J Dev Biol 49: 901–908.
47. Van Rooijen C, Simmini S, Bialecka M, Neijts R, van de Ven C, et al. (2012) Evolutionarily conserved requirement of Cdx for post-‐occipital tissue emergence. Development 139: 2576–2583.
48. Savory JGA, Bouchard N, Pierre V, Rijli FM, De Repentigny Y, et al. (2009) Cdx2 regulation of posterior development through non-‐Hox targets. Development 136: 4099–4110.
49. Ikeya M, Takada S (2001) Wnt-‐3a is required for somite specification along the anteroposterior axis of the mouse embryo and for regulation of cdx-‐1 expression. Mech Dev 103: 27–33.
50. Beddington RS (1983) Histogenetic and neoplastic potential of different regions of the mouse embryonic egg cylinder. J Embryol Exp Morphol 75: 189–204.
51. Downs KM, Davies T (1993) Staging of gastrulating mouse embryos by morphological landmarks in the dissecting microscope. Development 118: 1255–1266.
52. Kinder SJ, Tsang TE, Quinlan GA, Hadjantonakis AK, Nagy A, et al. (1999) The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo. Development 126: 4691–4701.
53. Downs KM (1998) The murine allantois. Curr Top Dev Biol 39: 1–33.
54. Downs KM, Gifford S, Blahnik M, Gardner RL (1998) Vascularization in the murine allantois occurs by vasculogenesis without accompanying erythropoiesis. Development 125: 4507–4520.
55. Sonderegger S, Pollheimer J, Knöfler M (2010) Wnt Signalling in Implantation, Decidualisation and Placental Differentiation -‐ Review. Placenta 31: 839–847.
56. Galceran J, Hsu SC, Grosschedl R (2001) Rescue of a Wnt mutation by an activated form of LEF-‐1: regulation of maintenance but not initiation of Brachyury expression. Proc Natl Acad Sci USA 98: 8668–8673.
57. Ishikawa T, Tamai Y, Zorn AM, Yoshida H, Seldin MF, et al. (2001) Mouse Wnt receptor gene Fzd5 is essential for yolk sac and placental angiogenesis. Development 128: 25–33.
58. Monkley SJ, Delaney SJ, Pennisi DJ, Christiansen JH, Wainwright BJ (1996) Targeted disruption of the Wnt2 gene results in placentation defects. Development 122: 3343–3353.
59. Parr BA, Cornish VA, Cybulsky MI, McMahon AP (2001) Wnt7b Regulates Placental Development in Mice. Dev Biol 237: 324–332.
References
41
60. Wilkinson DG (1992) In situ hybridization. A practical approach.
61. Pilon N, Oh K, Sylvestre JR, Savory JGA, Lohnes D (2007) Wnt signaling is a key mediator of Cdx1 expression in vivo. Development 134: 2315–2323.
62. Lewis EB (1978) A gene complex controlling segmentation in Drosophila. Nature 276: 565–570.
63. Nüsslein-‐Volhard C, Wieschaus E (1980) Mutations affecting segment number and polarity in Drosophila. Nature 287: 795–801.
64. Bateson W (1894) Materials for the study of variaton treated with special regard to discontinuity in the origin of species. London: Macmillan and co. pp.
65. Struhl G (1981) A homoeotic mutation transforming leg to antenna in Drosophila. Nature 292: 635–638.
66. Duboule D, Morata G (1994) Colinearity and functional hierarchy among genes of the homeotic complexes. Trends Genet 10: 358–364.
67. Gaunt SJ, Sharpe P, Duboule D (1988) Spatially restricted domains of homeo-‐gene transcripts in mouse embryos: relation to a segmented body plan. Dev Suppl 104: 169–179.
68. Wellik DM, Capecchi MR (2003) Hox10 and Hox11 genes are required to globally pattern the mammalian skeleton. Science 301: 363–367.
69. Carapuço M, Nóvoa A, Bobola N, Mallo M (2005) Hox genes specify vertebral types in the presomitic mesoderm. Genes Dev 19: 2116–2121.
70. Kmita M (2003) Organizing Axes in Time and Space; 25 Years of Colinear Tinkering. Science 301: 331–333.
71. Schöck F, Reischl J, Wimmer E, Taubert H, Purnell BA, et al. (2000) Phenotypic suppression of empty spiracles is prevented by buttonhead. Nature 405: 351–354.
72. Noro B, Lelli K, Sun L, Mann RS (2011) Competition for cofactor-‐dependent DNA binding underlies Hox phenotypic suppression. Genes Dev 25: 2327–2332.
73. Deschamps J, van den Akker E, Forlani S, de Graaff W, Oosterveen T, et al. (1999) Initiation, establishment and maintenance of Hox gene expression patterns in the mouse. Int J Dev Biol 43: 635–650.
74. Deschamps J, Wijgerde M (1993) Two Phases in the Establishment of HOX Expression Domains. Dev Biol 156: 473–480.
75. Forlani S, Lawson KA, Deschamps J (2003) Acquisition of Hox codes during gastrulation and axial elongation in the mouse embryo. Development 130: 3807–3819.
76. Pollard SL, Holland PW (2000) Evidence for 14 homeobox gene clusters in human genome ancestry. Curr Biol 10: 1059–1062.
References
42
77. Charité J, de Graaff W, Consten D, Reijnen MJ, Korving J, et al. (1998) Transducing positional information to the Hox genes: critical interaction of cdx gene products with position-‐sensitive regulatory elements. Development 125: 4349–4358.
78. Pownall ME, Tucker AS, Slack JM, Isaacs HV (1996) eFGF, Xcad3 and Hox genes form a molecular pathway that establishes the anteroposterior axis in Xenopus. Development 122: 3881–3892.
79. Pownall ME, Isaacs HV, Slack JM (1998) Two phases of Hox gene regulation during early Xenopus development. Curr Biol 8: 673–676.
80. Bel-‐Vialar S, Itasaki N, Krumlauf R (2002) Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 129: 5103–5115.
81. Houle M, Prinos P, Iulianella A, Bouchard N, Lohnes D (2000) Retinoic Acid Regulation of Cdx1: an Indirect Mechanism for Retinoids and Vertebral Specification. Molecular and Cellular Biology 20: 6579–6586.
82. Economides KD, Zeltser L, Capecchi MR (2003) Hoxb13 mutations cause overgrowth of caudal spinal cord and tail vertebrae. Dev Biol 256: 317–330.
83. Benahmed F, Gross I, Gaunt SJ, Beck F, Jehan F, et al. (2008) Multiple Regulatory Regions Control the Complex Expression Pattern of the Mouse Cdx2 Homeobox Gene. Gastroenterology 135: 1238–1247.e3.
84. van den Akker E, Fromental-‐Ramain C, de Graaff W, Le Mouellic H, Brûlet P, et al. (2001) Axial skeletal patterning in mice lacking all paralogous group 8 Hox genes. Development 128: 1911–1921.
85. Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-‐Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25: 402–408.
86. Murphy P, Davidson DR, Hill RE (1989) Segment-‐specific expression of a homoeobox-‐containing gene in the mouse hindbrain. Nature 341: 156–159.
87. Favier B, Dollé P (1997) Developmental functions of mammalian Hox genes. Mol Hum Reprod 3: 115–131.
88. Carapuço M (2007) The role of Hox genes in the development of the branchial arches and axial skeleton Oeiras: Instituto de Tecnologia Química e Biológica da Universidade Nova de Lisboa.
89. Gehring WJ, Kloter U, Suga H (2009) Evolution of the Hox gene complex from an evolutionary ground state. Curr Top Dev Biol 88: 35–61.
90. Slattery M, Riley T, Liu P, Abe N, Gomez-‐Alcala P, et al. (2011) Cofactor Binding Evokes Latent Differences in DNA Binding Specificity between Hox Proteins. Cell 147: 1270–1282.
A-‐I
Annexes
Annex I
Detailed qPCR data and relative gene expression calculations by the 2-‐(ΔΔCT) method. (Fig2.1). The Ct values represent the mean of the two replicates of each sample. Fold change was determined by dividing the average of 2-‐(ΔCT) results in transgenic embryos by the average results of the non-‐transgenic embryos. Transgenic – Cdx4+/-‐ Cdx2PHoxb1; Non-‐transgenic -‐ Cdx4+/-‐
Annexes
A-‐II
Annex II
Detailed data from caudal plus sacral counts of vertebrae data (Fig.2.6) and results of statistical analysis. For each genotype it is represented the number of caudal+sacral vertebrae counted in all skeletons analyzed. All samples had a normal distribution, as shown by Kolmogorov-‐Smirnov test. Mann-‐Whitney test was use to compare the mean value of caudal+sacral vertebrae between genotypes with the transgene (Cdx2PHoxb1) and the same genetic background without the transgene.
top related