24.soto.dna techniques

Extra Information:

* Z DNA * Telomere

Chen Yonggang 2007

Biochemistry

DNA

Double helix can assume different conformations

zig-zag (Z)

left-handed

*

B form Z form

*

                                                                                                 From OncoLog, April 2006, Vol. 51, No. 4                           Breaks in “Backward” DNA Associated with LeukemiaWhen otherwise normal DNA adopts an unusual shape called Z-DNA, it can lead to the kind of genetic instability associated with cancers such as leukemia and lymphoma, according to a study by researchers at The University of Texas M. D. Anderson Cancer Center. The study, presented in the February 21 edition of the Proceedings of the National Academy of Sciences, demonstrates for the first time that the odd shape can cause DNA breaks in mammalian cells.

Interestingly, sequences prone to forming Z-DNA are often found in genetic “hot spots,” areas of DNA prone to the genetic rearrangements associated with cancer. About 90% of patients with Burkitt’s lymphoma, for example, have DNA breaks that map to regions with the potential to form these odd DNA structures.

Imagine untwisting the DNA ladder and then winding it up the other way. The resulting “Z-DNA” would be a twisted mess with segments jutting out left and right and with the all-important base pairs that hold the DNA code zigzagging like a jagged zipper. It just doesn’t look right, and it doesn’t act right, either, according to Karen Vasquez, Ph.D., lead author of the study

This awkward shape can cause the DNA molecule to break completely apart.

“Our study shows that DNA itself can act as a mutagen, resulting in genetic instability,” said Dr. Vasquez. “The discovery opens up a new field of inquiry into the role of DNA shape in genomic instability and cancer.”

Telomere - Telomerase

What about the ends (or telomeres) of linear chromosomes?

DNA polymerase/ligase cannot fill gap at end of chromosome after RNA primer is removed. Big problem---If this gap is not filled, chromosomes would become shorter each round of replication!

Solution:

Eukaryotes have tandemly repeated sequences at the ends of their chromosomes.

1. Telomerase (composed of protein and RNA complementary to the telomere repeat) binds to the terminal telomere repeat and catalyzes the addition of of new repeats.

2. Compensates by lengthening the chromosome.3. Absence or mutation of telomerase activity results in

chromosome shortening and limited cell division.

*

(a) Telomeres on human chromosomes consist of the hexanucleotide sequence TTAGGG repeated between 1000 and 1700 times. These TTAGGG tandem repeats are attached to the 3'-ends of the DNA strands and are paired with the complementary sequence 3'-AATCCC-5' on the other DNA strand. Thus, a G-rich region is created at the 3'-end of each DNA strand and a C-rich region is created at the 5'-end of each DNA strand. Typically, at each end of the chromosome, the G-rich strand protrudes 12 to 16 nucleotides beyond its complementary C-rich strand. (b) Like other telomerases, human telomerase is a ribonucleoprotein. The ribonucleic acid of human telomerase is an RNA molecule 962 nucleotides long. This RNA serves as the template for the DNA polymerase activity of telomerase. Nucleotides 46 to 56 of this RNA are CUAACCCUAAC and provide the template function for the telomerase-catalyzed addition of TTAGGG units to the 3'-end of a DNA strand.

Repeated G rich sequence on one strand in humans: (TTAGGG)n

Repeats can be several thousand basepairs long. In humans, telomeric repeats average 5-15 kilobases

Telomere specific proteins, eg. TRF1 & TRF2 bind to the repeat sequence and protect the ends

Without these proteins, telomeres are acted upon by DNArepair pathways leading to chromosomal fusions

Telomeres *

*

Different types of Nucleotide Polymerases

1) DNA polymerase Uses a DNA template to synthesize a DNA strand

2) RNA polymeraseUses a DNA template to synthesize an RNA strand

(= transcription)

3) Reverse transcriptaseUses an RNA template to synthesize a DNA strand

Found in many viruses

Telomerase is a specialized reverse transcriptase

*

Eukaryotic DNA polymerases

Eukaryotes have at least 15 DNA Polymerases (5 most important):

Pol α: acts as a primase (synthesizing a RNA primer), and then as a DNA Pol elongating that primer with DNA nucleotides. After a few hundred nucleotides elongation is taken over by Pol δ and ε. Pol β: is implicated in repairing DNA. Pol γ: replicates mitochondrial DNA. Pol δ: is the main polymerase in eukaryotes, it is highly processive and has 3'->5' exonuclease activity. Pol ε: may substitute for Pol δ in lagging strand synthesis, however the exact role is uncertain. η, ι, κ, and Rev1 are Y-family DNA polymerases and Pol ζ is a B-family DNA polymerase. These polymerases are involved in the bypass of DNA damage. There are also other eukaryotic polymerases known, which are not as well characterized: θ, λ, φ, σ, and μ. There are also others, but the nomenclature has become quite jumbled.

*

Animation !!!!!

In most somatic tissues, telomerase is expressed at verylow levels or not at all -- as cells divide, telomeres shorten

Telomerase and Senescence

Telomerase and Cancer

The presence of telomerase in cancer cells allows them tomaintain telomere length while they proliferate

Biochemistry 2007

Chen yonggang. Zhejiang UniversitySchool of Medicine

Techniques in Molecular Biology

DNA Purification

• Bacteria (plasmid)

• Cell in culture

•Tissue (buccal, blood, organs)

DNA Chromosome

plasmid

DNA Purification (1)

Simple method

*

DNA Purification (2a) (plasmid)

Commercial kit

*

DNA Purification (2b) (plasmid)

Commercial kit

Genomic DNA(large band)

Genomic DNA Digested with restriction enzyme

(smear band)

Plasmid

Genomic DNA

RNA degraded

supercoil

circularlinearizedplasmid

DNA Analysis (large amount-μg)

Agarose gel (1%)stained with

Ethidium bromide

*

Restriction Enzymes: Molecular Scissors

DNA Analysis:

Endonucleases

*

The ability to determine the structure of DNA is relatively recent

• In the 1960s a group of protective enzymes were found in bacteria. These Restriction Endonucleases could recognize and cleave specific 6-8 base sequences either at or distant from symmetrical “palindromic” sites

ISXSI and IZXZI• The bacteria protected their own specific

sequences by methylation

Three classes of Restriction Endonucleases were found

• Class I and Class III enzymes cleave the DNA at sites distant from the recognition site

• Class II enzymes cleave the DNA within the recognition sequence which gives the greatest applicability to determining the structure of DNA. Some Class II enzymes yield blunt ends, some overhanging ends

*

Enzymes were named according to the organism, strain and designation

• One of the first such enzymes used was EcoR1, a product of a strain of E coli– Its recognition sequence is a palindrome:

– 5’G AATTC– 3’CTTAA G

• Cleavage occurs symmetrically between the G and A

Cleavage of DNA with EcoR1 yields complementary ends

• The DNA strands end with an overhang in such cases thus the two cleaved strands have “sticky” or coherent ends

******G

******CTTAA

AATTC*****

G*****

*

Depending on the number of such sites, a piece of DNA may be fragmented

• Each fragment will have the same complementary sequences at each end

• The larger the DNA, the greater the probability of multiple cleavage sites, Thus large DNAs may be cleaved to analyzable size

• Other restriction endonucleases may be used to cleave at other recognition sites, it is thus possible to generate many cleavage patterns for a DNA

Restriction fragments can be separated on the basis of size

• The rate of transport of polynucleotides on gel electrophoresis is inversely proportional to size. Small move quickly, large slowly

• Polyacrylamide gels can separate polynucleotides up to about 1000 base pairs

• Agarose gels can separate fragments up to about 20kb

*

Restriction Fragments can be visualized in a number of ways

• Radioactively labeled(32P) polynucleotides can be detected by autoradiography or variants thereof

• DNA fragments can be stained with Ethidium bromide and be visualized with UV light

• DNA fragments can be labeled with fluorescent markers and seen under UV light

• Specific sequences can be visualized by hybridization with a radiolabeled probe

*

Stained with SYBR-Green

Stained with Ethidium Bromide

Agarose gel of DNA digested with restriction enzymes

Stained with Ethidium Bromide

(black and white print)

Visualized in a transilluminator with UV light

DNA Analysis: Southern blot

Edwin Southern

*

   Transfer of electrophoretically separated fragments of DNA, after denaturation, from the gel to an absorbent sheet of material, such as nitrocellulose, to which the DNA binds. The sheet is immersed in a solution containing a labeled probe that will hybridize to fragment(s) of interest.

The method was first devised by E. M. Southern to transfer DNA fragments from an agarose gel to a nitrocellulose paper for hybridization, but similar transfer methods are now also used for transfering RNA or protein to papers of a variety of types followed by hybridization (RNA) or labeled antibody treatment (protein) to identify specific molecules. The Southern blot is named after its inventor, the British biologist M.E. Southern. There is also a Northern blot (RNA) and a Western blot (Protein).

Southern blot (DNA) *

RNA Analysis: Northern blot

1,3,5: Total RNA2,4: mRNA

Agarose gel

A: Stain with Ethidium BromideB: Autoradiography (32P)

A B

*

DNA Analysis:

PCR Polymerase Chain Reaction Kary Mullis

Nobel Prize in Chemistry

1993

*

RT-PCR: Reverse Transcription-PCR

From mRNA is produced DNA (copy, cDNA) by using reverse transcriptase (RT). This cDNA is amplified by PCR. The size of the amplified DNA differs of the genomic DNA if introns are present in the gene.

RNA Analysis : RNA

DNA

RT

Reverse transcriptase

PCR

*

Specific DNA sequences can be amplified using PCR

• The polymerase chain reaction (PCR) can amplify DNA sequences if the sequence of the DNA either side of the sequence in question is known( cut with RE which generates known flanking sequences-often cloned into a known sequence vector)

• PCR depends on the ability to generate primers which are complementary to the known flanking sequences

• PCR is dependent upon a thermostable Taq DNA polymerase and heat cycling

Multiple cycles of PCR amplify DNA sequences million-fold

• Reaction is heated to 95o to denature DNA in presence of flanking oligomers for 15”

• Temperature is redruced precipitously to 54o to allow annealing of primers

• Primers are extended by raising the temperature to 72o for 30”to replicate DNA sequence

• Cycle is repeated, more cycles, more amplification• Desired sequence is harvested by RE cleavage

*

PCR has allowed rapid detection of DNA sequences

• A small amount of DNA from a human hair follicle can be amplified by PCR and sequenced for forensic analysis

• An HIV chromosome can be amplified for diagnosis of HIV infection using hybridization with a labeled probe

• Mutations in a gene can be identified after PCR amplification and sequencing

J Clin Microbiol. 2002 September; 40(9): 3334–3340.

Detection and Quantification of Oral Treponemes in Subgingival Plaque by Real-Time PCR

Yasuyuki Asai, Takayoshi Jinno, Hajime Igarashi, Yoshinori Ohyama, and Tomohiko Ogawa*Department of Oral Microbiology, Asahi University School of Dentistry, 1851-1 Hozumi, Hozumi-cho, Motosu-gun, Gifu 501-0296, Japan

Oral treponemes have been associated with periodontal diseases. We developed a highly sensitive and specific method to detect and quantify cultivable oral treponemes (Treponema denticola, Treponema vincentii, and Treponema medium) in 50 subgingival plaque samples from 13 healthy subjects as well as 37 patients with periodontal diseases using real-time PCR assays with specific primers and a TaqMan probe for each 16S rRNA sequence. The specificity for each assay was examined by using DNA specimens from various treponemal and other bacterial species. The TaqMan real-time PCR was able to detect from 103 to 108 cells of the oral treponemes….

Quantitative or Real Time PCR

Fluorescent probes

TABLE 1. PCR primers for detection of oral treponemes

Adapted from Asai et al., J Clin Microbiol 2002

TABLE 1. PCR primers for detection of oral treponemes (cont.)

Adapted from Asai et al., J Clin Microbiol 2002

Fig.1 Electrophoresis evaluation of PCR products amplified with primers for T. denticola (A), T. vincentii (B), T. medium (C), and total

treponemes (D) and with a ubiquitous primer (E). Lanes: M, molecular size marker (a 100-bp DNA ladder); 1, T. denticola; 2, T. vincentii; 3, T. medium; 4, T. socranskii; 5, T. phagedenis; 6, T. pectinovorum; 7, P. gingivalis; 8, P. nigrescens; 9, A. actinomycetemcomitans; 10, E. coli; 11, F. nucleatum; 12, S. mutans; 13, S. oralis; and 14, S. salivarius.

The expected sizes are noted by arrows.Adapted from Asai et al., J Clin Microbiol 2002

Cleaving Chromosomal DNA with restriction endonucleases gives a characteristic pattern

• Even though the sequence of the DNA is not known, the pattern is typical

• When the DNA of individuals having a disease is treated in the same way there may be a loss of some fragments and the appearance of others

• These Restriction Fragment Length Polymorphisms[RFLP] are often the first steps in understanding a genetic disease

*

RFLP: Restriction Fragment Length Polymorphism *

DNA Fingerprinting

Determination of an individual’s unique collection of DNA restriction fragments

*

Collect Tissue Sample

How to do DNA FingerprintingThe Big Picture

>1000 cells

RFLP / Southern blot PCR AnalysisRFLP / Southern blot

>20 cells

*

Need to Analyze only a Small Fraction of Genome

• Human genome is too big to analyze:

• 3 x 109 base pairs 65,536 bp between cuts

= ~46,000 bands

• Most regions of genome are not suitable:

• 99.9% of DNA sequence is same from one person to the next

• Solutions:

• Limit analysis to a few genomic regions

• Focus on regions which are highly variable

How to Focus on Specific Regions of Genome

Need a probe:A short single stranded DNA which is complementary to the region of interest

CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA

A probe will base pair to the region of interest

GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT:::::::::::::::::::::::::::::::::::::::::

ATGGCATGGACC::::::::::::

probe

Southern Blotting

Recombination of DNA fragments is possible

• Because of the end complementarity, cutting two DNA s with the same enzyme makes possible annealing the two fragments into one sequence, but without covalent linkage

• Use of a DNA ligase could combine them into a single sequence

• Thus Recombinant DNA****G****CTTAA

AATTC**** G****

****G****CTTAA

AATTC**** G****

****GAATTC********CTTAAG****

DNA 1

DNA 2

*

DNA Recombinant

(cloning)

*

Transfection of foreign genes into mammalian cells

viral promoter recognized by mammalian cells

Polylinker region(sequences recognized by several restriction enzymes)

Produce a recombinant plasmid by cloning of an specific gene into the “skeleton” of a plasmid (vector)

*

DNA into mammalian cells

DNA into mammalian cells

*

Cleaving a DNA molecule with a RE allows creation of a restriction map

• A restriction map identifies the sites for cleavage by a specific RE

• Carried out repeatedly by a variety of REs allows a detailed map, identifying multiple restriction sites

• A restriction map along with other techniques, allows recognition of DNA sequences of interest for purification

*

Restriction Map

Plasmid

DNA Sequence

Historically there are two main methods of DNA sequencing:

Maxam & Gilbert, using chemical sequencing

Sanger, using dideoxynucleotides. Modern sequencing equipment uses the principles of the Sanger technique.

*DNA Sequence

The Sanger Technique• Uses dideoxynucleotides

(dideoxyadenine, dideoxyguanine, etc)• These are molecules that resemble

normal nucleotides but lack the normal -OH group.

• Because they lack the -OH (which allows nucleotides to join a growing DNA strand), replication stops.

Normally, this wouldbe where another phosphateIs attached, but with no -OHgroup, a bond can not form and replication

stops

The Sanger method requires (1)• Multiple copies of single stranded

template DNA• A suitable primer (a small piece of DNA

that can pair with the template DNA to act as a starting point for replication)

• DNA polymerase (an enzyme that copies DNA, adding new nucleotides to the 3’ end of the template

• A ‘pool’ of normal nucleotides• A small proportion of dideoxynucleotides

labeled in some way ( radioactively or with fluorescent dyes)

• The template DNA pieces are replicated, incorporating normal nucleotides, but occasionally and at random dideoxy (DD) nucleotides are taken up.

• This stops replication on that piece of DNA

• The result is a mix of DNA lengths, each ending with a particular labeled DDnucleotide.

• Because the different lengths ‘travel’ at different rates during electrophoresis, their order can be determined.

The Sanger method requires (2)

Termination during Replication

DNASEQUENCE3’

G C A T T G G G A A C C

PRIMER5’

C G T A

NO OFBASES

1 2 3 4 5 6 7 8 9 10 11 12

G terminated C G T A A C C T T GC G T A A C C T T G G

A terminatedC G T A A

Tterminated C G T A A C C TC G T A A C C T T

C terminated C G T A A C C G T A A C C C G T A A C C C

The Sanger method

• Originally four separate sets of DNA, primer and a single different DD nucleotide were produced and run on a gel.

• Modern technology allows all the DNA, primers, etc to be mixed and the fluorescent labeled DDnucleotide ‘ends’ of different lengths can be ‘read’ by a laser.

• Additionally, the gel slab has been replaced by polymer filled capillary tubes in modern equipment

The Sanger method

The Sanger method

(I)

The Sanger method(II)

siRNA

Small interfering RNA: 20-25 nt with specific complementary sequence for a target mRNA is introduce in the cell. The

targeted mRNA is degraded. The corresponding protein it is not expressed.

Inhibition of caspase-3 synthesis by siRNA

Andrew Fire Craig Mello Nobel Prize - Medicine 2006

*

DNA ARRAY

Microarrays are simply ordered sets of DNA molecules of known sequence. Usually rectangular, they can consist of a few hundred to hundreds of thousands of sets.

Microarray analysis permits scientists to detect thousands of genes in a small sample simultaneously and to analyze the expression of those genes.

*

DNA ARRAY

Simultaneous expression analysis of hundreds or thousands genes in cell culture or tissues

*

DNA ARRAY*

DNA ARRAY

*

Gene Therapy (1)

Introduction of a healthy gene in a human tissue with deficiency in that gene

*

Gene Therapy (2)

*

Embrionic

Cells with ability to generate any kind of new tissue

List of techniques:

•DNA purification•DNA analysis (Agarose gel, Southern blot)•Restriction Enzymes, restriction map•PCR, RT-PCR•RFLP, Fingerprinting•Recombinant DNA, cloning•DNA sequence•DNA Array•siRNA•Gene therapy•Stem cells

*