ammonia transportation via rhesus ... laura_2016_thesis...and spiny dogfish (squalus acanthias)....

AMMONIA TRANSPORTATION VIA RHESUS GLYCOPROTEINS IN LONHORNED SCULPIN (Myoxocephalus octodecemspinosus)

AND SPINY DOGFISH (Squalus acanthias).

A Thesis

By LAURA VICTORIA ELLIS

Submitted to the Graduate School Appalachian State University

In partial fulfillment of the requirements for the degree of MASTERS OF SCIENCE

August 2016 Department of Biology


AND SPINY DOGFISH (Squalus acanthias).

A Thesis

By LAURA VICTORIA ELLIS

August 2016 APPROVEDBY: Susan L Edwards, Ph.D. Chairperson, Thesis Committee Ted Zerucha, Ph.D. Member, Thesis Committee Sarah E. Marshburn, Ph.D. Member, Thesis Committee Zach Murrell, Ph.D. Chairperson, Department of Biology Max C. Poole, Ph.D. Dean, Cratis D. Williams School of Graduate Studies

iv

Abstract


AND SPINY DOGFISH (Squalus acanthias). (August 2016)

Laura Victoria Ellis

B.S., University of North Carolina at Asheville M.S., Appalachian State University

Chairperson: Susan L. Edwards, Ph.D.

The maintenance of homeostatic equilibrium is one of the main challenges facing

marine fishes. Ammonia is a toxic byproduct of protein digestion and therefore must be

regulated and excreted. Since the discovery of Rhesus glycoproteins roles in ammonia

excretion in 2007, many species of fish have been studied (Nakada et al. 2007b). Rhesus

glycoprotein orthologs, Rhag, Rhbg, Rhcg1, and Rhcg2, have been localized to the gills

of Takifugu rubripes, the puffer fish, while Rhp2 has been localized to the kidney of the

marine elasmobranch Triakis scyllium, the banded houndshark. This study looked at the

marine elasmobranch Squalus acanthias, spiny dogfish, and the marine teleost

Myoxocephalus octodecemspinous, longhorned sculpin. We hypothesize that both the

spiny dogfish and the longhorned sculpin utilize Rhesus glycoprotein orthologs in the

excretion and movement of ammonia and its byproducts. To date we have cloned a

partial fragment of Rhp2 (1040bp) from the spiny dogfish and partial fragments of Rhag

(677bp), Rhbg (661bp), and Rhcg1 (610bp), from the longhorned sculpin. The open

reading frame from Rhcg2 (1097bp) was also isolated and showed high similarity to

other teleost Rhcg2. In this study, immunohistochemistry was used to localize Rhesus

glycoprotein orthologs and various ion transporters to the kidney and gills of the spiny

v

dogfish, and the gills of the longhorned sculpin. Western blot and tissue distribution

confirmed expression of Rhesus glycoproteins to the epithelial tissues of the longhorned

sculpin.

vi

Acknowledgements

During my time here at Appalachian State University, there have been so many

people who have made this thesis possible. I could never have accomplished any of this

work without the love, support, and encouragement from Dr. Susan Edwards. Without

your belief in my abilities, teachings, and nerdy side moments I never would have been

able to pull off one project, let alone a whole different second one. You truly have shown

me not only how to be a fabulous mentor, but also a well-rounded scientist. To my

committee Dr. Ted Zerucha and Dr. Sarah Marshburn, thank you for always being there

to talk about my project and always being willing to give me comments on how to

become a better writer and scientist. A special thanks to Sarah for always pushing me to

also be a better teacher and giving me such an amazing example of how to be a fair and

still kick butt teacher. The entire Department of Biology also became my family over the

past two years. Special thanks to Dr. Ece Karatan, Dr. Mike Gangloff, Dr. Zach Murrell,

and Dr. Guichuan Hou for always keeping me in the loop of how grad school works,

letting me invade your lab, helping me with my duties as BGSA president, and teaching

me the skills necessary to become proficient in microscopy. This project would never

have been a reality without the funding from the National Science Foundation, the Cratis

D. Williams Graduate School, and the Office of Student Research. I also cannot forget

the endless love and support from my family, boyfriend, and friends who helped keep me

sane...well kind of sane, were always willing to be held hostage for practice

presentations, and made me laugh for hours. Thank you everyone who has ever believed

in me and my dreams in science, this is for you as well.

vii

Dedication

To my family and friends, whose unconditional love and support made all of this possible.

viii

Table of Contents

Abstract…………………………………………………………………………………...iv

Acknowledgements………………………………………………………………………vi

Dedication………………………………………………………………………...……...vii

List of Tables……………………………………………………………………………..ix

List of Figures……………………………………………………………………………..x

Introduction………………………………………………………………………………..1

Methods…………………………………………………………………………………..15

Results……………………………………………………………………………...…….21

Discussion………………………………………………………………………………..26

Tables…………………………………………………………………………………….32

Figures……………………………………………………………………………………34

References………………………………………………………………………….…….62

Vita………………………………………………………………………………...……..75

ix

List of Tables

Table 1. List of Primers used to clone Rh glycoprotein orthologs ………..…………….32

x

List of Figures

Figure 1. Model of homeostasis in marine elasmobranchs and marine teleost………….34

Figure 2. Diagram of the Ornithine-Urea Cycle………………………………………...35

Figure 3. Diagram of a fish gill……………………………………………………….…36

Figure 4. Diagram of gill cell types………………………………………………….….37

Figure 5. Diagram of a vertebrate kidney……………………………………………….38

Figure 6. Diagram of ion movement in teleost intestines……………………….………39

Figure 7. Diagram of ion transporters in the gill………………………………………..40

Figure 8. Diagram of saltwater teleost NaCl movement……………..…………………41

Figure 9. Model describing the localization of Rh glycoproteins in a fish gill……...…..42

Figure 10. Tissue distribution of Rh glycoproteins in longhorned sculpin………..…….43

Figure 11. Longhorned sculpin Rhag nucleotide sequence………………………….…44

Figure 12. Longhorned sculpin Rhbg nucleotide sequence……………………………..45

Figure 13. Longhorned sculpin Rhcg1 nucleotide sequence……………………………46

Figure 14. Longhorned sculpin Rhcg2 nucleotide and amino acid sequence……..…….47

Figure 15. Spiny dogfish Rhp2 neucleotide sequence……………….………………….48

Figure 16. Western blot analysis of Rh glycoproteins in the longhorned sculpin............49

Figure 17. Phylogenetic Tree of Rh glycoproteins…………….………….…...………..50

Figure 18. Immunohistochemistry of NKA, Rhag, and Rhbg in the longhorned sculpin

gill………………...………...….…………………………………………….51

Figure 19. Immunohistochemistry of NKA, Rhcg1, and Rhcg2 in the longhorned sculpin

gill...................................................................................................................52

xi

Figure 20. Immunohistochemistry of NKCC and Rh glycoproteins in the longhorned

sculpin gill.....................................................................................................53

Figure 21. Immunohistochemistry of HAT B and Rhcg1 in the longhorned sculpin gill.54

Figure 22. Immunohistochemistry of NHE 3 and NKA in ammonia treated longhorned

sculpin gill........................................................................................................55

Figure 23. Immunohistochemistry of HAT, NHE 2, and Rhcg in spiny dogfish kidneys

............................................................................................................................................56

Figure 24. Immunohistochemistry of HAT and Rhcg1 in spiny dogfish gill...................57

Figure 25. Immunohistochemistry of Rhcg in spiny dogfish gill.....................................58

Figure 26. Immunohistochemistry of NKA, Rhag, and Rhbg in the spiny dogfish gill...59

Figure 27. Hypothesized model of ammonia excretion in the longhorned sculpin..........60

Figure 28. Negative controls of spiny dogfish gills and longhorned sculpin gills...........61

1

Introduction

Homeostasis is key to the survival of all vertebrates and refers to the overall

balance between the animal’s intracellular space and its external environment. (Withers,

1998). Since the evolution of jawed fishes approximately 443 million years ago, fishes

have faced unique challenges associated maintaining internal osmotic and ionic

homeostatis (Giles et al. 2015). The fundamental challenge to all fishes with the

exclusion of hagfish, is maintaining ionic balance and osmotic homeostasis in

environments that pose differences in salinity. Most fishes are restricted to a single

environmental niche (stenohaline), but can inhabit aqueous environments that range from

the dilute environment of freshwater (0 mOsmol kg-1l) to the full salinity of marine

environments (1000 mOsmol kg -1) (Edwards and Marshall 2013). Fishes have

developed three strategies to maintain homeostasis: osmoconformity, where the fish

maintain a similar extracellular fluid (ECF) concentration to that of the environment in

which they inhabit. Hagfish are the only marine osmoconformers and there is no evidence

of an osmoconforming freshwater fish (Currie and Edwards 2010; Whittamore 2012;

Edwards et al. 2015). Hypo-osmoregulation where fishes maintain their ECF slightly

lower than that of their marine environment. Finally hyper-osmoregulation, where fishes

maintain their ECF slightly higher than that of their dilute freshwater environment

(Currie and Edwards 2010).

Elasmobranchs

Marine elasmobranchs are osmconformers and ionoregulators, which is atypical

in the marine environment (Whittamore, 2012). These organisms are also ureotelic

meaning they retain excess nitrogen and convert the nitrogenous waste product ammonia

2

into the less toxic form urea (Wood et al 1995; Wilkie 2002). The physiological

parameters of marine elasmobranchs mean that they maintain an internal osmolality

slightly higher, yet similar to, the osmolality to their external environment (Yancey and

Somero 1979; Wood et al. 1995; Anderson et al. 2012; Nawata et al. 2015a) (Fig 1 B).

This is achieved by the retention of the regulatory osmolyte urea and the metabolite

Trimethylamine Oxide (TMAO) (Beyenbach 2004; Edwards and Marshall, 2013; Nawata

et al. 2015a).

Elasmobranchs retain ammonia through various mechanisms, including the gills,

that are specialized to preferentially conserve ammonia instead of excrete it, the nephrons

in the kidneys are adapted to remove ammonia from the blood stream, and the

repurposing of dietary ammonia into urea (CH4ON2) (Fig 1 B) (Wood et al. 1995; Wood

et al. 2002; Nawata et al. 2015b). The retention of urea aids in the osmotic homeostasis

between the intercellular space and the surrounding waters (Wood et al.1995; Anderson

et al. 2012; Nawata et al. 2015b). The abundance of urea in the marine elasmobranchs

results in the animal being hyperosmotic to their saltwater environment, thus allowing

them to conserve water loss and avoid excess salt intake (Li et al. 2013; Hyodo et al.

2014; Nawata et al. 2015a). However, in order to ameliorate the deleterious effect of urea

on proteins, urea must be balanced in a 1:2 ratio with the nonelectrolyte TMAO (Seibel

and Walsh, 2002; Treberg et al. 2006). TMAO is utilized as an osmolyte in

osmoregulation as well as to balance the ability of urea to degrade macromolecules,

including proteins (Wood et al. 1995; Kajimura et al. 2006; Walsh et al. 2006).

3

Elasmobrachs and the Ornithine-Urea cycle

Marine elasmobranchs utilize the Ornithine-Urea Cycle (OUC) to create the

osmolyte urea. The OUC is an energetically costly multi-step process that occurs mainly

in the kidneys and the mitochondria of liver cells (Kajimura et al. 2006). Urea is

produced from ammonia (NH3) created during protein digestion (Schmidt-Nielson,

1964). Ammonia is sequestered from filtrate in the kidneys and transported through the

blood stream into the liver (Wood et al. 1995; Anderson et al. 2012; Nawata et al. 2015a).

The unique nephrons of the shark kidney facilitate almost 90% ammonia retention from

filtrate in the kidneys (Hyodo et al. 2014). Once in the liver, it is phosphorylated into the

carbomoyal phosphate by a rate limiting enzyme carbomoyal phosphate synthetase

(Kajimura et al. 2006) (Fig 2). The OUC produces multiple intermediates before the end

product urea is created, including citrulline, L-argenine and argininosuccinate (Fig 2).

The production of urea is both adenosine triphosphate (ATP)-dependent and

metabolically costly, utilizing 5mol of ATP per 1mol of urea produced (Anderson 2001).

This mechanism is not unique to elasmobranchs; some teleost fishes have retained

the ability to convert ammonia into less toxic forms such as urea or uric acid (Yancey and

Somero 1979; Wood et al. 1995; Wilkie 2002; Nawata et al 2015a). In the special case of

the Gulf toadfish (Opsanus beta), this species uses urea as a mechanism to cloak itself

against predation (Barimo and Walsh 2006). Due to the energetic cost of producing urea

most teleost fishes utilize a more simplistic mechanism to deal with nitrogenous waste.

4

Teleost Fishes

In contrast to marine elasmobranchs that osmoregulate using urea and TMAO,

marine teleost fishes maintain internal homeostasis through ionoregulation and

osmoregulation (Evans et al. 2005). The ionic gradient between teleost fishes and their

marine ecosystems results in a constant loss of water, coupled with a constant influx of

ions (Evans et al. 2005). Due to these physiological conditions, teleost fishes must

actively excrete various ions including nitrogenous wastes as well as consume seawater

to combat osmotic water loss (Hwang et al. 2011) (Fig 1 A).

Most marine teleost fishes are ammoniotelic, in that their nitrogenous waste is in

the form of ammonia, which can be excreted directly across the gill epithelium into the

surrounding water (Evans et al. 2005; Nawata et al. 2010; Zhang et al. 2015). The direct

excretion of ammonia is restricted to aquatic organisms, as it requires copious amounts of

water in which it can disseminate (Evans 2008). The few exceptions to this generalization

are the fish species that can enter terrestrial environments for short periods of time;

including the mangrove killifish, which can volatilize their waste, as well as the

mudskipper, and climbing perch, which utilize active ammonium transport in times of

high environmental ammonia (Hung et al. 2007; Clifford et al. 2015).

Embryonic teleost fishes, have demonstrated both ureotelic and ammoniotelic

stages throughout their development (LeMoine and Walsh 2013). Immediately after

fertilization embryos excrete ~85% of the nitrogenous waste as urea, but 2-3 days post

fertilization the embryos shed their chorion and ~75% of their waste is excreted as

ammonia (Braun et al. 2009a). Zerbrafish embryos have functioning ornithine-urea

cycles, but after hatching it is down regulated and the organism switches to ammoniotelia

5

and excretes ammonia directly into the environment (Braun et al. 2009a). During

embryonic development fish lack functioning gills for excretion of ammonia, so they

must detoxify the ammonia by converting it to the less toxic urea (LeMoine and Walsh

2013). This pattern of functioning ornithine-urea cycles during embryonic stages may

also be prevalent in other species as it prevents the toxic accumulation of ammonia

during development (LeMoine and Walsh 2013).

Ammonia

Total ammonia, both the gaseous form NH3 and the ionic form NH4+, are formed

through the degradation of amino acids during protein metabolism (Wood et al. 1995;

Houlihan et al. 1995; Braun et al 2009). Ammonia is formed after amino acids are

released during protein digestion in the intestine through the removal of carbon during

protein catabolism (Evans et al. 2005; Ip and Chew 2010; Wright and Wood 2012). The

deamination of the α-amino group on the amino acid results in a carbon byproduct that is

used as a source of dietary carbon and glucose production (Ip and Chew 2010). Ammonia

is formed mainly in the kidneys, with accessory formation in the muscles, and intestines

of vertebrata (Evans 2008; Weiner and Verlander, 2014).

In both marine teleost fishes and elasmobranchs, nitrogenous wastes are a concern

for not only osmotic homeostasis, but also the overall health of the fishes. Ammonia

presents an issue for all vertebrate organisms as it is a toxic nitrogenous byproduct and

therefore fishes must develop mechanisms to excrete it (Treberg et al 2006; Ip and Chew

2010; Nawata et al 2015a). High ammonia levels can have extremly deleterious effects on

the body including decreased growth rates (Weiner and Verlander 2014; Sinha et al.

6

2015), hemolytic anemia (Hung et al. 2008), hepatic encephalopathy in mammals

(Lemberg and Fernández 2009), and eventually can lead to death (Wilkie 2002). Acute

ammonia toxicity affects fishes through disruptions to the central nervous system

(Randall and Tsui, 2002; Albrecht 2007). The increased levels of ammonia lead to the

depolarization of the neurons in the brain, which leads to a cascade of chain reactions

resulting in cell death and convulsions (Randall and Tsui 2002). This ammonia toxicity

can be triggered during exposure to high environmental ammonia, stress events, or

swimming, although if exposed to high environmental ammonia, fishes will stop feeding

before they produce toxic internal ammonia levels (Randall and Tsui 2002). Marine

fishes must have a method to excrete ammonia so that they can avoid the adverse effects

associated with high internal ammonia concentrations.

Ion Transporting Tissues

Marine fishes utilize specialized organs in the regulation of ion and osmotic

homeostasis. These organs include the gill, kidney, and intestines. As the majority of

waste and ion movement occurs at the gills, with some secondary movement occurring at

the intestines and kidneys, the following sections will review each of these organs

specifically (Schmidt-Nielsen 1964).

Gill

The gills of fishes have long been studied as an excretory organ; not only do they

possess an exceptionally large surface area, but also a very high blood flow (Evans and

Cameron 1986) (Fig 3). These anatomical considerations, combined with small diffusion

7

distances from the blood to the surrounding waters, make them an ideal organ for both

gas and ion exchange (Evans et al. 2005). These same gill characteristics are ideal for the

excretion of ions, specifically ammonia, into the environment with little energy

requirements.

The gill is composed of a few major organizational sections. The main structural

support for the teleost gill is the bony gill arch, while in elasmobranchs the support comes

from the interbranchial septum (Edwards 2000). The next organization level includes

both the filaments, which are the main branches that extend from the gill arch, and the

lamellae, which extend off from the filament (Edwards 2000; Evans et al. 2005). Each of

these sections plays a major role in the gill’s ability to be an excretory organ (Fig 3).

The gill arches are the main structural support for the gill; they have blood vessels

that run through them to the gill filaments, facilitating blood flow and transportation of

ions and waste (Evans et al. 2005). The filaments and lamellae are open to the waters and

are used in waste removal and ion exchange (Wilson and Laurent 2002). Water is taken

in through the mouth and moves across the gills, both bringing oxygen and ions to the

fish, as well as washing away any free ions or gases (Fig 3).

The filament is the main site of ion exchange across the epithelium, due to the

vascularization of the filament (Edwards 2000). The filament and lamellae are composed

of specific types of cells. On the filament there are two major cell types, mitochondrion

rich cells involved in ion transport, and pavement cells, which are theorized to play a role

in gas exchange (Wilson and Laurent, 2002; Evans et al. 2005). The mitochondrion rich

cells, MRC, have also been called ionocytes, or chloride cells due to the ion transporters

localized in their cells (Hill et al. 2008). Ionocytes have an abundance of mitochondria

8

that produce the ATP necessary to activate ion secretion pathways. The MRC’s also have

a specialized apical crypt where specific ion transporters and proteins are localized

(Claiborne et al. 2002; Guffey et al. 2015). Approximately 90% of the epithelial surface

areas of the gills are comprised of pavement cells (Evans et al. 2005)

In the lamellae, as you move distally from the filament, there are very few

ionocytes (Evans et al. 2005). The lamellae is composed of a single cell layer, mainly

pavement cells and pillar cells, which facilitate gas exchange due to their thin walled

squamous cell structure (Wilson and Laurent, 2002; Nakada et al. 2007b). The lamellae

are the main site of gas exchange in the fish gill; they are highly vascularized and are the

main way for gases to be transferred from the blood stream to the surrounding waters,

and vice versa (Evans et al 2005).

The branchial epithelium is also comprised of three more cell types, accessory

cells, mucous cells, and neuroepithelial cells (Edwards 2000) (Fig 4). Accessory cells

closely associate with MRC’s and are normally observed in marine teleost fishes (Laurent

and Dunel, 1980). Accessory cells form leaky junctions with MRC’s that allow ions to

leak across the short junction formed between the two cell types (Laurent and Dunel,

1980; Evans et al. 2005). Mucous cells are localized to the edge of the filament and

excrete mucous onto the apical edge of the gill (Laurent and Dunel, 1980; Edwards

2000). Neuroepethelial cells are localized throughout the filament and lamellae on the

efferent aspect (i.e., facing the flow of water) of the gill (Zachar and Jonz 2012).

Neuroepethelial cells are theorized to be involved in O2 sensing as well as function in

neural stimulus transmission (Zachar and Jonz 2012).

9

Kidney

The kidneys of marine teleosts and elasmobranchs are secondary sites of ion

exchange and ammonia movement (Edwards and Marshall 2013). Vertebrate kidneys are

comprised of thousands, up to millions, of nephrons (Schmidt-Nielsen 1964) (Fig 5). The

nephron can be broken down in two major groups by location in the kidney, the sections

present in the cortex, and the sections present in the medulla (Schmidt-Nielsen, 1997)

(Fig 5). The outer layer, the cortex, contains the Malpighian body, the Bowman’s

capsule, the proximal convoluted tubule, and the distal convoluted tubule (Hill et al.

2008). The inner layer of the medulla contains both Henle’s loop, and the collecting duct

(Schmidt-Nielsen, 1997). Teleost and elasmobranch kidney morphology differs based on

the presence, or reduced presence, of glomeruli (Edwards and Marshall, 2013). Teleost

fishes may have fully functioning glomeruli, but this is only common to euryhaline

species; sternomarine species normally lack the glomuerli, or it has lost its function in

filtration (Beyenbach, 2004; Evans and Claiborne, 2006; Edwards and Marshall, 2013).

Independent of the type of kidney fishes have, all kidneys are responsible for filtration of

the divalent ions, Mg2+, Ca2+, and SO42- as well as the electrolytes and osmolytes Na and

Cl. (Beyenbach, 2004).

Intestine

In addition to the gill and the kidney, the intestine is also a site of osmotic and

ionic regulation. In marine teleost fishes, the intestine is responsible for the uptake of

Na+, Cl-, and H2O (Evans 2008; Whittamore 2011). Marine teleost fishes drink the

surrounding water to combat osmotic water loss. The gastrointestinal tract and intestines

10

absorb H2O from the saltwater and also act to remove Na+ and Cl- (Evans et al. 2005;

Evans 2008; Edwards and Marshall, 2013). The posterior end of the intestine secretes

HCO3- causing the precipitation of the divalent ions Mg2+ and Ca2+ (Grosell 2006;

Edwards and Marshall, 2013).

Mechanisms of Ammonia Excretion

Historical Theories

Ammonia excretion has been studied in fishes for the last 80 years, although there

was little consensus regarding the specific mechanisms involved (Evans 1982; Mallery

1983). The original hypothetical models (Fig 7), linked the excretion of ammonia to the

uptake of sodium through Na+/NH4+ exchanger on the apical membrane of the branchial

epithelium (Claiborne and Evans 1988; Evans et al. 2005). Since that time numerous

studies have been conducted, some of which support the existence of a Na+/NH4+

exchange system (Evans 2008; Evans 2010). Studies conducted in freshwater fishes

support a model of simple diffusion across the lipid bilayer of NH3 down its partial

pressure gradient, maintained by a boundary layer acidification at the gill (Wilkie 2002;

Braun et al 2009). There are also a number of groups that suggest that the diffusion of

NH3 is linked to Na+/H+ exchange or an H+ pump/Na+ channel mechanism or alternately

that there is a mechanism of excretion by which ammonia partially moves by diffusion

and partially by electroneutral exchange (Catches et al. 2006; Havrid et al. 2013; Rubino

et al. 2014) (Fig 6).

The ion transporters Na+/H+ exchanger and H+-ATPase play a pivotal role in the

historical model of ammonia excretion (Evans et al. 2005). The Na+/H+ exchangers,

11

NHE2 and NHE3, are located in the apical side of the MRC’s in the gills and move Na+

into the MRC and exchange H+ ions to the outside water (Evans et al 2005; Tsui et al.

2008; Li et al 2013; Brix et al. 2015). H+-ATPase, is a proton pump localized in the MRC

and pavement cell of the gills (Edwards et al. 2005; Roa et al. 2014). H+-ATPase utilizes

ATP to move H+ out of the cells and into the surrounding waters, which causes a slight

acidification boundary layer immediate surrounding the gills (Tresguerres et al. 2006;

Wright and Wood, 2012). This acidification layer is hypothesized to aid in the movement

of ammonia out of the membrane in a freshwater fish model (Wright and Wood, 2012).

More recently a potentially new model to facilitate ammonia excretion has been

described and is associated with Rhesus glycoproteins (Rh) (Bakouh et al 2006; Nakada

et al 2007a; Nakada et al. 2007b).

Rhesus Proteins

Rhesus proteins belong to a super family of ammonia transport proteins including

the ammonia transport protein (Amt) in bacteria, Achaea and plants, methylammonia

permease (Mep) in yeast, and Rhesus proteins in animals (Andrade and Einsle 2007). All

of the ammonia transport proteins are hydrophobic membrane proteins, have 11-12

transmembrane domains, and function in either uptake or excretion of ammonia (Anstee

and Tanner 1993; Andrade and Einsle 2007).

The discovery of Rh proteins came from investigations into the human Rh D,

which is responsible for the charge in human blood types. The Rh factor associated with

Rh proteins was discovered in the early 1940’s due to investigations in fetal maternal

blood mismatch, which caused stillbirths or miscarriages (Landsteiner and Weiner, 1941;

12

Huang and Ye 2010). The Rh proteins in human erythrocytes fall into two categories: 1)

the Rh polypeptides, which are non-glycosylated and associate with Rh D; and 2) the

glycosylated RhAG, Rh-associated glycoprotein (Huang and Liu 2001; Huang and Peng

2005). The Rh proteins are grouped by molecular weight; non-glycosylated proteins are

30kDa and all named Rh30 proteins, while the glycosylated proteins are 50kDa and are

called Rh50 proteins (Nawata et al. 2007; Suzuki et al. 2014). The human Rh proteins are

Rh30, RhAG, RhBG, and RhCG, while all non-human protein orthologs are titled Rhag,

Rhbg, and Rhcg (Liu et al. 2001; Caner et al. 2015).

In 2007, the first study in fish to identify orthologs of Rh glycoproteins was

conducted in Takifugu rubripes and localized four orthologs, Rhag, Rhbg, Rhcg1, and

Rhcg2 to the gill epithelium (Nakada et al. 2007b). Rh glycoproteins were localized to

the pillar, pavement, and mitochondria rich cells of the gill (Fig 9).To date, Rh

glycoproteins have been identified in several species of teleost fish (Nakada et al. 2007a;

Nakada et al. 2007b; Nawata et al. 2007; Nawata et al. 2010; Wood et al. 2013; Wright et

al. 2014; Lawrence et al. 2015) and shark species (Nakada et al. 2010; Nawata et al.

2015a) as well as in the hagfishes (Edwards et al. 2015, Clifford et al. 2015). Rhag is

localized to the apical edge of the red blood cells on the lamellae of the gill and is

theorized to facilitate the movement of ammonia from the blood stream to the pillar cells

(Wright and Wood 2009). Rhbg is located basolaterally on the brachial epithelium

pavement cells (Ip and Chew 2010). Rhcg1 is localized to two areas, the apical edge of

the pavement cells lining the lamellae, as well as in the apical crypt of the mitochondrial

rich cells on the filament of the gill (Nakada et al. 2007b). Rhcg2 is predominately

localized on the apical edge of the pavement cells along the lamellae (Weihrauch et al.

13

2009). All four orthologs of Rh glycoproteins are theorized to facilitate the movement of

ammonia (Nakada et al. 2007b).

In addition to the Rh glycoproteins Rhag, and Rhbg, a novel Rh protein ortholog

Rhp2, has been identified in the Triakis scyllium, which is hypothesized to be the

primitive form of Rhcg (Nakada et al. 2010; Nawata et al. 2015a; Nawata et al. 2015b).

Rhp2 localizes to the renal tubules of the kidney sinus zone and is theorized to facilitate

the sequestration of ammonia from the urine to the blood stream (Nakada et al. 2010).

This ammonia reuptake is associated with the OUC in sharks and leads to the production

of the regulatory osmolyte urea (Nawata et al. 2015b). The discovery of Rh glycoproteins

has helped to create a new hypothesis of ammonia transportation and excretion in both

teleosts and chondrictheys (Wright et al. 2014).

While Rh glycoproteins are in the current model of ammonia excretion, it is also

important to note the use of the NHE3 ion exchanger in the facilitation of ammonia. NHE

exchangers can also preferentially bind NH4+ and move it across the membrane into the

surrounding waters to maintain acid base regulation (Edwards et al. 2005; Hyndman and

Evans 2008; Evans 2010). The Na+/H+ exchange proceeds through an electroneutral

interchange of one Na+ for one H+ (Edwards et al. 2001). The abundance of

environmental Na+ in the marine ecosystem allows for the movement of NH4+ from inside

the cell to the outside with little no energy input.

14

Purpose of Study

Many questions about the colocalization of ion transporters and the orthologs of

the Rh glycoproteins, as well as the identification of the Rh glycoproteins in the marine

teleosts, are still unanswered; this work attempts to fill the voids currently present in this

area. To my knowledge, this is the first study to investigate the role of Rh glycoproteins

in a stenohaline marine teleost. My project objectives were twofold, 1) use molecular

techniques to identify orthologs of the Rhesus glycoproteins in the longhorned sculpin; 2)

use protein expression and immunohistochemistry to examine the tissue localization of

ammonia transporters, including Rh glycoproteins, in longhorned sculpin and spiny

dogfish.

15

Methods

Animals

The teleost the longhorned sculpin (Myoxocephalus octodecemspinosus) and the

elasmobranch the spiny dogfish (Squalus acanthias) were used to identify and localize

orthologs of the Rh proteins. Longhorned sculpin (M. octodecemspinous) tissues were

obtained from Animal Technician Michele Bailey, Mount Dessert Island Biological

Laboratory, Sailsbury Cove, Maine.

Spiny dogfish (S. acanthias) gill total RNA was donated to our lab as a generous

gift from Greg Goss, University of Alberta, Canada.

Molecular Biology

RNA Isolation

Total RNA isolation was performed using TRI reagent (Sigma-Aldrich,St. Louis,

MO) according to previously published methods (Hyndman and Evans 2008). RNA

pellets were resuspended in RNase-free Hyclone water (Fisher Scientific, Wilmington,

DE) and the concentration of the total RNA measured with a Nanodrop ND-1000

spectrophotometer (Fisher Scientific, Wilmington, DE).

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)

cDNA was generated using reverse transcription (SuperScript II; Invitrogen,

Carlsbad, CA). Initial Rh sequence amplification was performed using degenerate

primers designed against other vertebrate cDNA Rh gene sequences (NCBI database).

(Table 1) and polymerase chain reaction (PCR) (3mmol l-1 MgCl, 200µmol l-1 dNTP mix,

16

10mmol l-1 primer & 1.25units plat taq) in 50µl volume incubated using an MJ Mini

thermocycler (Bio-Rad, Hercules, CA). The thermal cycler program was 2 minutes at

92°C, 30 seconds at 92°C, a gradient from 50-68°C depending upon the primers used, 45

seconds at 72°C, repeat 40 cycles from 30 seconds at 92°C, and an extension time of 10

minutes at 72° C (Table 1).

Molecular Cloning and Sequencing

PCR products were cloned into either PROMEGA pGEM® T-easy vector,

PROMEGA pGEM® T vector (Promega, Madison, WI), or TOPO PCR 4 vector (Fisher

Scientific, Wilmington, DE). Clones containing the correct inserts were identified by

restriction digest (Promega, Madison, WI), or PCR screening and then sequenced.

Sequencing was conducted at the Mount Dessert Island Biological Laboratory.

Following the amplification of initial sequence, homologous oligo primers were

designed and Rapid Amplification of cDNA Ends (RACE) for the 3’ and subsequent 5’

ends was performed using a SMARTer RACE cDNA amplification kit (Clonetech,

Mountain View, CA). The resulting sequenced sections were then assembled using Mac

Vector (Mac Vector, Cary, NC).

Tissue Distribution

Tissue specific expression of the four Rhesus genes was conducted using ortholog

specific primer pairs and RT-PCR in the gill, kidney, intestine, and the skin of M.

octodecemspinos. RT-PCR was done according to published protocols (Nawata et al.

17

2007b). The resulting PCR product was isolated on a 1.5% agarose gel stained with

ethidium bromide (Fig 10).

Phylogenetic Tree

The phylogenetic tree was constructed using a ClustalW alignment of Rh

glycoprotein sequences; the resulting alignment was analyzed using neighbor joining

method and calculation of absolute difference and boot strap confidences estimation

(1000 replications) in MacVector (Mac Vector, Cary, NC). Green algae, Chlamydomonas

reinhardtii, Rhp1 was used as an outgroup (accession number XM_001695412).

Antibodies

Rhesus glycoproteins

Polyclonal antibodies were generated in rabbits against the C-terminus of

Takifugu rubripes Rhag, Rhbg, Rhcg1, and Rhcg2. These antibodies were used to

determine Rh protein expression and colocalization in spiny dogfish gills and kidneys as

well as longhorned sculpin gills. The antibody was a gift from Dr Shigehisa Hirose,

Department of Biological Sciences, Tokyo Institute of Technology, Yokohama, Japan.

These antibodies have been used in previous studies to localize Rh proteins in teleost gills

(Nakada et al. 2007b).

H+-ATPase

A polyclonal antibody raised in a rabbit against spiny dogfish HAT was generated

based on the Spiny dogfish HAT sequence (AREEVPGRRGFPGY) (Claiborne et al.

18

2008). A polyclonal antibody raised against the B subunit of Sculpin H+-ATPase (AP

7181/7182) was used to determine protein localization and expression in the longhorned

sculpin (Catches et al. 2006).

NHE 3

The polyclonal antibody in a rabbit made against the synthetic peptide NHE3 A99

was produced by Biosource international (A99; TDSSHDSGNGDTDHES derived from

genbank: EU909191). The antibody was utilized to determine NHE3 localization and

expression in the longhorned sculpin.

Na+/K+-ATPase

A mouse monoclonal (α5) antibody was raised against the alpha subunit of

Na+/K+-ATPase by Dr Douglas Fambrough and was obtained from the Developmental

Studies Hybridoma Bank (DSHB, John Hopkins Univ., Balitmore, MD USA). This

antibody is widely used to determine localization of teleost Na+/K+-ATPase in brachial

epithelium (Chloe et al. 2002; Edwards et al. 2002; Catches et al. 2006).

Na+/K+/2Cl- Cotransporter

The monoclonal antibody against the human NKCC (T4) was used to localize

NKCC in the longhorned sculpin gill. The T4 antibody was acquired from the

Developmental Studies Hybridoma Bank (DSHB, John Hopkins Univ., Balitmore, MD

USA). The NKCC T4 antibody has been used to recognize both isoforms of NKCC in

multiple tissues, including gills (Wilson and Laurent 2002; Horng and Lin 2008).

19

Western Blotting

Total protein was isolated from longhorned sculpin gill, kidney, and intestines.

Tissues were placed into chilled homogenization buffer (250mM Sucrose, 1mM EDTA,

30mM Tris, 100µg/ml PMSF, and 5mg/ml protease inhibitor cocktail) and homogenized.

The homogenate was centrifuged at 14,000g for 10 minutes at 4°C to separate the protein

from the debris. The protein supernatant was decanted and a BCA (bicinchroninic acid)

protein assay was conducted to determine protein concentrations (Thermo Scientific,

Rockford, IL). 50µg of total protein was loaded into Ready Mini Gel-TGX-10%

acrylamide gels (Bio-Rad, Hercules, CA) and separated by SDS-PAGE (sodium dodecyl

sulfate, polyacrylamide gel electrophoresis). Separated proteins were then transferred

onto nitrocellulose membranes using a Trans-Blot® Turbo™ (Bio-Rad, Hercules, CA).

The membranes were blocked for 24 hr rocking at 4°C in 5% blotto (5% non-fat dry milk

powder in 0.1M Tris-buffered Saline with 0.2% Tween-20 (TBST)). Membranes were

then incubated in primary antibody 1:500 Rhag, Rhbg, Rhcg1, or Rhcg2 in 5% blotto

rocking overnight at room temperature. Membranes were washed three times in 0.1M

Tris-buffered Saline (TBS) for 15 minutes, then incubated in the secondary conjugate

antibody (1:10000) horseradish peroxidase (HRP)-conjugate goat anti-rabbit and

Precision Protein StrepTactin HRP-conjugate (Bio-Rad) in TBS for 1 hour. Following

three TBS washes, the membranes were then developed using a chemioluminescence

Clarity western system (Bio-Rad, Hercules, CA). Blots were visualized using Bio-Rad

Chemi-doc system.

20

Immunohistochemistry

Immunohistochemistry (IHC) enabled the localization of the transport proteins of

interest in tissue sections of gill and kidney (Sanatacana et al. 2014). IHC was done

following the published protocols (Edwards et al. 2005).

Fixed tissue samples were processed for paraffin embedding. Gill and kidney tissues

were sectioned to 7 µm using a Leica 3 microtome and mounted on Fisherbrand ®

Superfrost®/Plus Microscope Slides (Thermo Fischer Scientific Rockford, IL) and

incubated overnight. Slides were incubated in a variety of antibodies, including hagfish

specific hRhcg antibody (1:500), teleost Rhc1 antibody (1:500), teleost Rha antibody

(1:250), teleost Rhb antibody (1:250), teleost Rhc2 antibody (1:250) and detected using

goat anti-rabbit or anti-mouse Alexa Fluor® 568, and goat anti-rabbit or anti-mouse

Alexa Fluor® 488 (Molecular probes). In addition to localization of all known Rh

proteins, NKA, NHE 3, NKCC, and HAT were also localized in M. octodecemspinos

tissues. Colocalization studies were used to determine locality of Rhesus proteins and the

specific ion transporters. Sections were visualized using a Zeiss LSM 510 confocal

microscope (Zeiss).

21

Results Gene Sequencing and Annotation

Rhag

A partial sequence of Rhag was isolated utilizing Oncorhynchus mykiss Rhag primers.

BLASTX showed the 677 base pair Rhag fragment has 85% identity to the Clupea

harengus, Atlantic herring, predicted ammonium transporter Rh type A

(XP_012693009.1; gi|831320363|) (Fig 11).

Rhbg

The partial sequence of Rhbg was isolated using PCR and Oncorhynchus mykiss Rhbg

primers. The 661 base pair fragment has 89 % identity to the Larimichthys crocea, large

yellow croaker, predicted ammonium transporter Rh type B isoform X1 and X2

(XP_010746197.1; gi|734635239|), as well as 92% identity to Takifugu rubripes,

Japanese pufferfish, ammonium transporter Rh type B (XP_011617147.1; gi|768957319|)

(Fig 12).

Rhcg1

The partial Rhcg1 sequence 610 base pair fragment was isolated using PCR and

Oncorhynchus mykiss Rhcg primers. The 610 bp fragment has 91% identity to the

Cynoglossus semilaevis, tongue sole, ammonium transporter Rh type C 1

(XP_008310757.1 ; gi|657750682|) (Fig 13).

Rhcg2

The complete Rhcg2 ortholog was identified and sequenced. The 1097 bp open reading

frame has an 89% identity with the Cynoglossus semilaevis, tongue sole, predicted

ammonium transporter Rh type C2 (XP_008308471.1; gi|657746415|) (Fig 14).

22

Rhp2

The partial Rhp2 from the spiny dogfish was isolated using banded hound shark primers

(Nakada et al. 2009). The 1040 bp fragment had 91% identity with the Triakis scyllium,

banded hound shark, Rhesus glycoprotein P2 (BAI49727.1; gi|269913342|) and a 96%

identity to the Squalus acanthias, spiny dogfish Rhp2 (AJF44129.1|; gi|751250147|) (Fig

15).

Tissue Distribution

A 500 bp fragment from each orthologs was amplified to assess expression in the

epithelial tissues of M. octodecemspinosus (Fig 10). All four orthologs, Rhag, Rhbg,

Rhcg1, and Rhcg2, were identified using PCR in the gill, skin, kidney, and intestine of M.

octodecemspinosus utilizing Oncorhynchus mykiss Rh primers (Nawata et al. 2007) (Fig

10). PCR analysis showed qualitative expression of Rhag, Rhbg, Rhcg1, and Rhcg2 in

the gills. Rh glycoproteins, Rhbg, Rhcg1, and Rhcg2 were additionally found in the skin,

kidney, and intestines.

Western Blot Use of Takifufu rubripes Rhag, Rhbg, Rhcg1, and Rhcg2 antibodies demonstrated

a single immunoreactive band (approximately 47kDa) in the longhorned sculpin tissues.

These results are similar to the results reported in Takifugu rubripes tissues by Nawata et

al. 2010 (Fig 16).

23

Relationship of Rh Glycoproteins Based upon the multiple alignments of Rh glycoprotein amino acid sequences

obtained from the longhorned sculpin, four other teleost fish species, the African clawed

fog Rhcg, hagfish Rhcg, banded houndshark Rhp2, and green algae Rhp2; a relationship

analysis based was conducted based on neighbor joining (Fig 16). The phylogenetic tree

shows longhorned sculpin Rhcg2 being most closely related to other teleost Rhcg2

mRNA, with the exception of the zebrafish Rh glycoproteins.

Immunohistochemistry

Negative controls were conducted simultaneously with experimental slides for the

secondary antibodies, goat anti-rabbit or anti-mouse Alexa Fluor® 568, and goat anti-

rabbit or anti-mouse Alexa Fluor® 488 utilized in the study (Fig 28).

Co-Localization of Rhag in M. octodecemspinous

Rhag was localized to the apical and basolateral edges of the pillar cells, which

surrounded the interlamellar space along the lamella (Figs 18 & 20). NKA was localized

exclusively to the ionocytes on the filament (Fig 18). NKCC was localized strongly to the

ionocytes in the filament (Fig 20).

Co-Localization of Rhbg in M. octodecemspinous

Rhbg was localized to the basolateral edge of the pavement cells on the lamella

(Figs 18 & 20). NKA was localized exclusively to the MRC’s on the filament (Fig 18).

NKCC was localized strongly in the MRC’s of the filament (Fig 20).

24

Co-Localization of Rhcg1 in M. octodecemspinous

Rhcg1was localized to both the apical crypt of the MRC’s in the filament and the

edges of the pavement cells of the gill lamaella (Figs 19, 20, 21). The Rhcg1

immunoreactivity along the edges of the pavement cells is much less intense and more

diffuse compared to the Rhcg2 expression along the same gill lamella (Figs 19, 20, 21).

Rhcg1 was colocalized in the MRC’s expressing both NKA and the NKCC, with Rhcg1

immunoreativity seen exclusively in the apical crypt of the MRC (Figs 19 & 20)

Co-Localization of Rhcg2 in M. octodecemspinous

Rhcg2 was localized to the apical edge of the pavement cells lining the gill

lamella while NKA localized exclusively to the MRC’s (Fig 19). When Rhcg2

colocalized with NKCC, NKCC was found exclusively in the MRC’s, while Rhcg2 was

only found along the apical edge of the lamellae, with no inmmunoreactivity on the

filament (Fig 20).

HAT in S. acanthias and M. octodecemspinous

In the gills of both the spiny dogfish and the longhorned sculpin, HAT was

expressed exclusively in the MRC’s (Figs 24 & 21). H+-ATPase expression was more

distinct in the spiny dogfish gill, with more diffuse expression occurring in the

longhorned sculpin gill. In the kidney, HAT was localized to the renal tubules of the

spiny dogfish (Fig 23).

25

NHEs in S. acanthias and M. octodecemspinous

Kidney

NHE 2 expression was demonstrated along the apical edge of the kidney tubules

of the spiny dogfish (Fig 23). NHE 2 closely associated with the apical expression of

Rhcg along the edge of the kidney tubules.

Gill

NHE 3 expression in the longhorned sculpin gill was shown in ammonia treated

tissues. NHE 3 expression was localized to the ionocytes along with diffuse expression of

NKA (Fig 22). NHE 3 expression was specifically found in the apical crypt of the MRC’s

and along the brush boarders of the filament. When NHE 3 was colocalized with NKA,

NKA immunoreactivity was constant in the MRC’s along the filament, while NHE 3

localized specifically to the apical crypt of the MRC’s (Fig 22).

Co-localization of Rh glycoproteins and NKA in S. acanthias

The Rh glycoproteins, Rhag and Rhcg2, were each colocalized with the ion

transporter NKA in the gill of S. acanthias (Fig 26). Rhag expression was localized to the

edge of the pillar cells in the gill lamellae of S. acanthias. (Fig 26). Rhcg2 expression

was localized to the apical edge of the lamellae on the gills of S. acanthias (Fig 26).

When NKA was co-localized with either Rhag or Rhcg2, NKA was expressed solely

along the edges of the ionocytes on the filament (Fig 26). Rhbg expression could not be

localized in S. acanthias.

26

Discussion Previous studies, on both marine elasmobranchs and marine teleost fishes, have

demonstrated their ability to excrete nitrogenous waste (Claiborne and Evans 1988;

Wood et al. 1995; Nakada et al. 2010; Sinha et al. 2015). However, my research is the

first in a marine teleost to suggest that Rh glycoproteins may play a predominate role in

ammonia excretion. This study isolated and identified partial fragments of the Rh

glycoproteins, Rhag, Rhbg, and Rhcg1, as well as the complete open reading frame of an

Rhcg2 ortholog in epithelial tissues of M. octodecemspinous. In addition, I cloned a

partial fragment of the Rhp2 from the elasmobranch S. acanthias. This Rhp2 fragment

demonstrated a 96% identity to the complete Rhp2 sequence identified by other

researchers (Nawata et al. 2015b).

Elasmobranch Rh glycoproteins and Ion Transporters

The examination of Rh expression in the kidney and gill of S. acanthias provides

important information associated with the unique physiological adaptations of the spiny

dogfish, which has the interesting homeostasis profile of osmoconformity and

ionoregulation (Whittamore 2012). Results from the dogfish shark showed expression of

Rh glycoproteins in both the kidney and the gill. Immunohistochemistry demonstrated

Rhcg-like immunoreactivity in epithelial cells of the gill and kidney, while Rhag, Rhcg1,

and Rhcg2 were isolated solely from epithelial cells of the gill. These findings suggest Rh

glycoproteins play a potential role in the reuptake of ammonia from the kidney filtrate, as

well as a possible route for the excretion of excess ammonia across the gills. The role of

Rhp2 in the elasmobranch kidney is currently hypothesized to be solely responsible for

27

the retention of ammonia for the creation of the osmolyte urea (Nawata et al. 2015b).

This hypothesis was supported by a previous study that localized Rhp2 to the sinus zone

of the kidney, but in the same study no Rhp2 immunoreactivity was demonstrated in the

shark gill (Nakada et al. 2010).

The findings of my study support the idea that Rh glycoproteins present in the gill

may be important in maintaining osmotic and ionic homeostasis. The direct excretion of

ammonia via Rh glycoproteins has been suggested in teleost fish gills, but to date have

not been fully investigated in the elasmobranch gill (Nakada et al. 2007b). In my study,

IHC localization of Rhag, Rhcg, and Rhcg2 to the gill suggests a similar pattern of

transcellular ammonia efflux capability as seen in teleost fishes (Nawata et al. 2007;

Nakada et al. 2007a; Nakada et al. 2007b; Tsui et al. 2008). The excess ammonia could

be transported by way of the blood stream to the branchial arch, once in the lamellae

Rhag present on the pillar cells facilitate the movement of NH3 out of the blood stream,

then across the basolaterally located Rhbg into the pavement cells and finally excreted

via an apically located Rhcg present on the apical edge of the pavement cells (Figs 9 &

27) (Nakada et al. 2007b). Future work in S. acanthias should focus on the utilization of

Rh glycoproteins in both the kidney and gill under varying conditions such as elevated

salinity and increased internal ammonia loads.

Teleost Rh Glycoproteins and Ion Transporters

Since Claiborne and Evans investigated the preferential movement of ammonia in

the M. octodecemspinous, the question has been how a marine fish excretes ammonia

waste as NH3 (Claiborne and Evans 1988). Marine teleosts lack the partial pressure

28

gradient present in freshwater ecosystems to utilize simple diffusion as a mechanism for

NH3 excretion. Moreover, unlike elasmobranchs, these organisms cannot convert

ammonia waste to less toxic urea (Claiborne and Evans 1988; Wilkie 2002; Catches et al.

2006; Braun et al. 2009b; Rubino et al. 2014). Since the discovery of Rh glycoproteins as

a method of ammonia excretion in 2007, in teleost fishes Rhag, Rhbg, Rhcg1, and Rhcg2

are hypothesized to be integral in NH3 excretion across the gills of all teleost fishes (Ip

and Chew 2010). In my study, all four orthologs were confirmed in M. octodecemspinous

using both tissue distribution and western blot analysis (Figs 10 &16). Tissue distribution

showed Rh Rhag cDNA expressed in gill tissue, while Rhbg, Rhcg1, and Rhcg2 were

found in the gill, kidney, skin, and intestines (Fig 10). However, protein expression

analysis determined that Rhag, Rhbg, and Rhcg2 were only present in the gill and kidney,

while Rhcg1 was present in the gill, kidney, and intestine. The presence of all four Rh

glycoprotein orthologs in the gill suggests a conservation and importance of Rh proteins

in the function of the gill. These patterns of Rh glycoprotein distribution are also

identified using IHCs.

M. octodecemspinous demonstrated strong expression of Rhag along the apical

edge of the pavement cells, Rhbg along the basolateral edge of the pillar cells, Rhcg1 and

Rhcg2 along the apical edge of the lamellae. Rhcg1, however, localized in both the apical

crypt of the ionocytes in addition to the edge of the lamellae. Rh glycoprotein orthologs

were double labeled with various ion transporters to both confirm the presence of the ion

transporters, as well as serve as markers for ionocytes along the filament. Previous

studies have sequenced and investigated the roles of NHE, NKA, and HAT in the M.

octodecemspinous, though this was before the discovery of the Rh glycoprotein and its

29

function in homeostasis (Catches et al. 2006). In my study, NHE3, HAT, NKA, and

NKCC were all expressed solely in the ionocytes of the gill. Interestingly, NHE 3

expression increased in ammonia treated M. octodecemspinous gills compared to the

control gill tissues. NHE 3 can be utilized as an NH4+ exchanger in times of high

ammonia exposure due to the abundance of intercellular ammonia. Due to previous

knowledge of the function of the ion transporters as well as current images of their

locality in the gill, my results support that these transporters may play a role in ionic

homeostasis, but are not the main method of ammonia excretion.

Molecular Identification of Rh glycoproteins

Though the aim of the study was to investigate potential methods of ammonia

excretion in S. acanthias and M. octodecemspinous, Rh glycoprotein cDNA sequence

data provided additional support for the presence of Rh gylycoproteins in both organisms.

The resulting partial Rhag, Rhbg, and Rhcg1 from M. octodecemspinous demonstrated a

high similarity to other teleost Rh glycoproteins (Figs 11-13). Additionally, the fully

sequenced Rhcg2 from the M. octodecemspinous had a high similarity (89%) to

Cynoglossus semilaevis, tongue sole (XP_008308471.1; gi|657746415|). When the Rhcg2

from M. octodecemspinous was compared to other known Rh glycoproteins, the Rhcg2

shows a distinct relationship out with other Rhcg2 orthologs in teleost species (Fig 17).

This suggests a high level of conservation of these genes across species. In the

elasmobranch S. acanthias, the isolated fragment of Rhp2 showed a high identity to the

known Triakis scyllium Rhp2 (91%) as well as the recently published S. acanthias Rhp2

30

(96%) (Nawata et al. 2015b). All of the isolated Rh glycoprotein orthologs had most

similarity in common with in their phylogenetic group, which suggests a high rate of

conservation across species for all Rh glycoproteins.

These patterns of inheritance and conservation, seen in both the M.

octodecemspinous Rh glycoproteins and the S. acanthias Rhp2, coincide with previous

work on Rh glycoprotein evolution (Nakada et al. 2010). Rhp1 and Rhp2 are currently

hypothesized to be the primitive forms of Rhcg, though many researchers are currently

investigating the phylogenetic relationship of these ancestral Rh proteins (Liu et al. 2000;

Huang and Peng 2005; Nakada et al. 2010; Huang and Peng 2010). The recent finding

that Rhcg is present in the Atlantic hagfish, Myxine glutinosa and that its expression is

increased following ammonia load has created a debate over the evolution of Rhcg

(Edwards et al. 2015). This is compounded by findings in elasmobranchs S. acanthias

and T. scyllium (Nakada et al. 2010; Nawata et al. 2015a; Nawata et al. 2015b),that

possess an Rhp2 isoform but appear to lack Rhcg cDNA. M. glutinosa, being the more

ancient of the extant vertebrates,, may also possess an Rhp2, but to date this has not been

investigated (Edwards et al. 2015).

Conclusion

The aim of this study was to examine potential routes of ammonia excretion in

both S. acanthias and M. octodecemspinous. Through the use of molecular techniques

and immunohistochemistry, I have demonstrated Rh glycoprotein and ion transporter

expression in various tissues and propose a new hypothetical model of ammonia

excretion in M. octodecemspinous. Previous work conducted by Claiborne and Evans in

1988, showed NH3 excretion as the main method of ammonia excretion in M.

31

octodecemspinous, though at the time of their study, no method of NH3 excretion had

been discovered in marine teleosts (Claiborne and Evans, 1988). This is the first study

focusing on M. octodecemspinous to isolate a potential method of ammonia excretion

since the discovery of Rh glycoproteins role in homeostasis. Through this study I was

able to generate a new hypothesized model for ammonia excretion and ion movement in

the saltwater teleost M. octodecemspinous (Fig 27).

Future Work

Future studies in the M. octodecemspinous should focus on both isolating the

complete Rh glycoproteins as well as measuring the fluctuations in Rh glycoprotein

expression under varying conditions to test the proposed model of ammonia excretion.

Currently Rh glycoproteins are theorized to move both ammonia gas and CO2, since they

are of similar molecular weight, though studies have found conflicting evidence of CO2

movement (Endeward et al. 2008; Nawata and Wood 2008; Wright and Wood, 2012).

The CO2 studies have previously utilized freshwater fishes, such as rainbow trout and

zebrafish, or the ureotelic Magadi tilapia, though to my knowledge no studies have been

conducted on a marine fish (Nawata and Wood, 2008; Nakada et al. 2010; Wright and

Wood, 2012). The key to understanding the role of Rh glycoproteins in CO2 transport

may lie in the marine fish gills. This would be especially significant to understand the

preferential movement of ammonia and CO2 with the global issue of ocean acidification

as an increasingly significant threat to marine life.

32

Tables

Table 1. List of primers used to isolate fragments of Rh glycoprotein orthologs. Gene Sequence Remark Rhp2 5’-CCGGTACCCCATGTTCCARGAYGTNCA Degenerate PCR (S)

(Nakada et al. 2010)

Rhp2 5’-GGAGTTGAAGGAGGGCCARWANATCCA Degenerate PCR (AS)


TRhagF1 5’-CAACGCAGACTTCAGCAC Rainbow Trout Rhag

(Natawa et al. 2007)

TRhagR1 5’-CCACAGGTGTCCTGGATG Rainbow Trout Rhag


TRhbgF1 5’-CATCCTCATCATCCTCTTTGGC Rainbow Trout Rhbg


TRhbgR1 5’-CAGAACATCCACAGGTAGACG Rainbow Trout Rhbg


JBRhb479R 5’-CAACACCCCGATGTGGATCTTG Sculpin Rhbg

JBRhb1053F 5’-ATCATCTCCGTCTTGGGCTTCA Sculpin Rhbg

JBRhb1361R 5’-GGGGAGCTTCAAGATGAAACCG Sculpin Rhbg

JBRhbg1340F 5’-CGGTTTCATCTTGAAGCTCCCC Sculpin Rhbg

JBRhb1492R 5’-CGCGTCTAATTGAGCTTCTCGG Sculpin Rhbg

ZFRhcg1F 5’-AAGCATATGAACGGGTCCGTCTACC Zebra Fish Rhcg1


ZFRhcg1R 5’-AGCCCGACAAACGTTCCTCCGCCGA Zebra Fish Rhcg1


FRhcg1F 5’-TGGAGTCTTCATCCGCTACGACGAA Takifugu Rhcg1


FRhcg1R 5’-GGCTTGAAATGGCCACAGTGGTGAG Takifugu Rhcg1


33

RhcgDeg1F 5’-TTYCARGAYGTICAYGTIATG Degenerative Rhcg1

Rhcg1DegR 5’-CARGAYACITGYGGNATHCA Degenerative Rhcg1

TRhcg1F1 5’-CATCCTCAGCCTCATACATGC Rainbow Trout Rhcg1


TRhcg1R1 5’-GTTTCTGTCCAGCAGGCGTC Rainbow Trout Rhcg1


Sculp115F 5’-GTGGGCTTCAACTTCCTGATCG Sculpin Rhcg

Sculp711R 5’-AGCATTCTGGATGTGCACCATG Sculpin Rhcg

Sculp472F 5’-CAAAGCAGACGCCTCAATGGAT Sculpin Rhcg

Sculp1122R 5’-CCCCAGATAGGCAACCTCAGAA Sculpin Rhcg

TRhcg2F1 5’-GCACACTGTTCCTGTGGATG Rainbow Trout Rhcg2


TRhcg2R1 5’-CAGCAGGATCTCCCCAGA Rainbow Trout Rhcg2


34

Figures

Fig 1. Schematic of the movement of water, ions, and nitrogenous waste in saltwater teleost and elasmobranchs. A. The saltwater teleost fishes exist in a hyperosmotic environment and to combat the osmotic water loss, must constantly drink water. The excess ions ingested from the environment are absorbed in the intestine, transported via the bloodstream, and excreted along the gill. Ammonia is generated from the degradation of protein, transported via the bloodstream, and excreted at the gill (Adapted from Evans 2008). B. The saltwater elasmobranchs exists in a slightly hyposmotic environment due to the retention of the nitrogenous waste product urea. Urea is generated after ammonia is absorbed from the filtrate in the kidneys, transported via the bloodstream, and processed into urea in the OUC in the liver. Urea is then moved along the body to combat osmotic water loss and excess urea is excreted along the gills.

Marine'Teleosts'

1000'mOsm'

400'mOsm'

H2O''Na+,'Cl8''

Na+,'Cl8','NH4+'

Na+,'Cl8,'H2O''Na+,'Cl8,'H2O''

Filtrate'

Salt'Water'

NH3'

A'

Marine'Elasmobranchs'

~1000'mOsm'NH3'

Na+,'Cl8''H2O''

Na+,'Cl8','NH4+'

Salt'Water'

Urea'

~1000'mOsm'

Filtrate'

B'

35

Fig 2. Detailed diagram of the Ornithine Urea Cycle. 1. The introduction of ammonia and carbondioxide to the cycle. 2. The phosphorylated carbamoyl phosphate transitions to the intermediate citrulline. 3. L-aspartate and ATP convert citrulline to argininosuccinate. 4. Fumarate transitions to L-Arginine. 5. The hydrolysis of L-Argenine produces the byproduct Urea and L-Ornithine, which allows the cycle to continue if carbamoyl phosphate is present. ( Medical Dictionary, 2011).

36

Fig 3. Detailed anatomy of a teleost fish gill. The water flows in through the fishes mouth and moves along the gill filaments and exits through the gill operculum. Water flow brings in oxygen to the fish as well as aids in waste removal across the gill. The gill is composed of the gill arch, which is innervated with the blood supply, gill filament, and the lamellae (Campbell and Reece 2002).

37

Fig 4. Gill cell types present in a fish gill. Mitochondion Rich Cells, MRC, are prevalent along the main stem of the filament, while Pavement Cells, PVC, line the apical edge of the filament, and pillar cells are in the center of the lamellae (Adapted from Edwards 2000).

38

Fig 5. Diagram of kidney nephrons structure in multiple groups of fishes, with phylogenetic groups listed across the bottom. The structural shift from having a glomerous, to being aglomeral teleost, impacts the physiology of the kidney and the osmoregulation of the fish. (http://www.snre.umich.edu/~pwebb/NRE422-BIO440/lec11.html)

39

Fig 6. Diagram of the transport processes present in the intestines of marine fish. Both the anion exchanger, AE, and Carbonic anhydrase, CAII, are present on the lumen of the intestines and are responsible for the movement of carbonic acid, carbon dioxie, and chloride ions. The ion tranporters NKA, NHE, and NBC move potassium, chloride, sodium, and carbonic acid across the apical epithelium (Grossel 200)

40

Fig 7. The composite model of ion movement in the gills and red blood cells of agnathans, elasmobranchs, and teleosts. The roman numerals denote the decreasing order of frequency of the pathways. Pathway 1 shows simple diffusion of ammonia across the gill membrane. Pathway 2 shows ammonia movement facilitated by the V-ATPase and NHE. Pathway 3 shows the utlilization of NHE to move ammonia based on charge. Pathway 4 shows direct excretion due to leaky junctions between chloride cells and accessory cells in marine telesots (Evans et al 2005).

41

Fig 7. The current model of NaCl movement via ion transporters in the marine teleost gill. Ion transporters Kir, Na+/K+ ATPase, and Na+/ K+/ Cl- cotransporter are localized to the basolateral edge of the MRC and facilitate the movement of ions into and out of the cell. The cystic fibrosis transmembrane protein is localize on the apical edge of the MRC and facilitates the movement of chloride into the surrounding waters. Sodium is shown to leak paracellularly across the junction between the MRC and the accessory cell (Evans et al 2005).

42

Fig 8. Current hypothesized model of Rh glycoproteins, Rhbg, Rhcg1, and Rhcg2, and ion transporters, NKCC, NKA, and NHE 2 present in the saltwater fish gill. Rhbg, NKCC, and NKA are localized on the basolateral edge of the gill cell, while Rhcg1, Rhcg2, NHE2, and NHEe are localized to the apical edge. These ion transporters and Rh glycoproteins facilitate the movement of ammonia, sodium, potassium, and hydrogen (Ip and Chew, 2010).

43

Fig 10. Tissue distribution of Rh proteins isolated through PCR A, Rhag, B Rhbg, C, Rhcg1, and D, Rhcg2 on 1% agarose gels in longhorned sculpin tissues. NTC is a no template control.

44

Fig 11. Longhorned Sculpin Rhag neucleotide sequence (677 bps) with 85% identity to the Clupea harengus, Atlantic herring, predicted ammonium transporter Rh type A (XP_012693009.1; gi|831320363|)

GAATTCACTAGTGATTCCACAGGTGTCCTGGATGCCCAGTT

TGGATGCCAGGATGGGAGTCAGGAACTTGAAGCCCAGGGTCGAC

ACGATGCCAGCCACTAATCCAATCAGCATCGCCCCAAATGGCCC

GATGTCCATGTCGGCACATGTTCCCACAGCAACGCCACCGGCCA

AGGTGGCATTCTGAATGTGCACCATGTCCAGTTTTCCTTTGTGCTC

CACAGGCTGGAGATGGCGTAGGCAGAGAGCACGCAGGCAGCCA

GGGAGAGGTAGGTGTTGATCACCGCTGTGAGCTGAGGTAAGCCG

GCATCAGCGATGGCCGAGTTAAAACTGGGCCAGAACATCCACAG

AAAGACGGTTCCAATCATGGCAAACAGATCAGAGTGGTAAACAG

AGCCATCGTTATCATGTCCGTTTTTCAAACTCGGTCGGTAAAGTAC

TCGAGCCACAGCCAGCCCAAAGTAGGCTCCATACGCATGGATGA

TCATGGATGCACCCACGTCACTAGCTCCGAGGATATTGACCACTA

GATGTTCATTGATGGAGAAGATGGTAATCTCCAGTATGGTCATGA

TGAGGAGCTGCACAGGGCTGGTTTTACCCAGAACAGCTCCGAAG

GAGATCAGGACTGTAGCTGTGCTGAAGTCTGCGTTGAATCGAATT

CCCGCGGCC -3’

5’-

45

Fig 12. Longhorned Sculpin Rhbg neucleotide (661 bps) with 89 % identity to the Larimichthys crocea, large yellow croaker, predicted ammonium transporter Rh type B isoform X1 and X2 (XP_010746197.1; gi|734635239|), and 92% identity to Takifugu rubripes, Japanese pufferfish, ammonium transporter Rh type B (XP_011617147.1; gi|768957319|)

GGCCGCGGGAATTCGATTCATCCTCATCATCCTCTTTGGCGT

CCTGGTGCAGTACGACCACGAGACGGACGCCAAGGAATGGCACA

ACCAGACCCACTCTGACTATGAGAACGACTTCTACTTCCGCTACCC

AAGTTTCCAGGACGTGCACGTGATGATCTTCATCGGTTTCGGCTTC

CTCATGACCTTCCTGCAGCGCTACGGCTTCAGCAGCGTGGGCTTCA

ACTTCCTGATCGCAGCCTTCTCCATTCAGTGGGCAACGCTCATGCA

GGGCTTCTTCCACGGCATGCATGGAGGCAAGATCCACATCGGGGT

GGAGAGCATGATCAATGCTGATTTCTGCACCGGCGCTGTGCTCATC

TCGTTCGGAGCCGTTTTGGGTAAAACCAGCCCCGTCCAGCTGCTGG

TCATGGCGATATTCGAGGTCACGCTGTTTGCTGTCAATGAGTTCGT

CCTGCTGTCCGCTCTTGGGGCTAAAGATGCAGGAGGCTCCATGAC

CATCCACACCTTTGGAGCCTACTTCGGCCTCATGGTGACCCGAGTC

CTGTACCGGCCCAACCTGAACAAGAGCAAACACAGGAACAGCTCG

GTGTACCATTCTGACCTGTTTGCTATGATCGGCACCGTCTACCTGTG

GATGTTCTGAATCACTAGTGAATTC- 3’

5’-

46

Fig 13. Longhorned Sculpin Rhcg neucleotide and protein sequence (610 bps) with 91% identitity to Cynoglossus semilaevis, tongue sole Rhcg1.

TTGCACACTGTTCCTGTGGATGTTCTGGCCCAGCTTCAA

CTCGGCCGTCACAGACCACGGGGACGGGCAGCACCGAGCA

GCCCTGAACACCTACCTGGCTTTGGCCTCGACTGTGCTCACT

ACTGTGGCGCTCTCCAGCCTCTTCCAGAAGCACGGAAAACT

AGACATGGTCCACATCCAGAACGCCACTCTTGCTGGAGGTG

TTGCTGTAGGAACTGCAGCAGAGTTCATGCTGATGCCCTACG

GGTCTCTGATCGTAGGATTCTGCTGTGGCATCATCTCCACGC

TGGGATATGTCTACCTCACGCCTTTCATGGAGAAGCACCTGA

AGATCCAGGACACGTGTGGAATCCATAACCTGCATGCCATG

CCCGGCGTCATAGGTGGCATCGTGGGAGCCATTACTGCCGC

GTCTGCAACAGAGTCTGTTTATGGTATTGAGGGGCTCAGGAA

CACCTTTGACTTTGAGGGTGATTTCAAAGACATGTTACCCAC

ACGCCAGGGTGGTCTCCAGGCTGCGGGCCTTTGTGTGGCCA

TCTGCTTCGGTGTGGGTGGAGGTATCCTTGTCGGTTGTATTTT

AAGATTACCTATCTGGGGAGATCCTGCTGAA - 3’

5’-

47

Fig 14. Longhorned Sculpin Rhcg2 nucleotide (1097 bps) and amino acid (365) sequence with 89% identity to Cynoglossus semilaevis, tongue sole (XP_008308471.1; gi|657746415|) Sculpin Primers Sculp115F/Sculp711R Shown in Blue, Sculp472F/ Sculp1122 Shown in Red

48

Fig 15. Spiny dogfish Rhp2 nucleotide sequence (1040 bp) with identity to 91% identity with the Triakis scyllium, banded hound shark, rhesus glycoprotein P2 (BAI49727.1; gi|269913342|).

GNNNNCCCAAATGCAATC-AAGGCG-TTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATTGGGTCGTCATTGAAACAATACTCGTCCTTAGGCTGAGCCAGAAAGGGTAGTTTTAATATGAAGCCAGTGATGGTCCCTCCTAGGACAGCGATGCCCAAACAGACTCCGATAGCTGCCGCCTGGTACTGTGCCTGATCCCAAGCGCTGCGGCCACCTCCAGCCTTCAGCTGCGGCAGCAATCGGACCAATTCGACCAGCTTCCTGTCCCCTTCCTTGGGGACCCTCTCTGGGAAGGTGTCATACAAGCCCTGGCCATATCTCTCGTCGGCTGTTAACAGGATAGTGGCAATGCCGGCAATCGCCCCGATAAAGCCGGGGATCCCGTGCAAGTTGTTGATGCCGCACACGTCTTGGATTTTGAGTCTCTTGGAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGGCTCCCTTTAGGG-TTCCGATTTAGTGCTTTACGG-CACCTCGACCCC--AAAAAACTTGATT--AGGGTGATGGGTTCACGT-AGTGGG-CCATCGCCCT--GATAGACGGGTTTTTCGCCCTTTGACGTT-3’

5’-

49

Fig 16. Western Blot analysis of Rhesus glycoproteins in epithelial tissues of longhorned sculpin, A, Rhag, B Rhbg, C, Rhcg, and D, Rhcg2.

50

Fig 17. Phylogenetic tree constructed utilizing the neighbor-joining method (bootstrapped with 10,000 replications) of various Rh proteins along with the isolated M. octodecemspinous Rhcg2. The tree is rooted using the green algae Chlamydomonas reinhardtii Rhp1 Accession number (XM_001695412). Bootstrap confidences and absolute number of differences are shown on the branches, while accession numbers are present in parenthesis on the right.

51

Fig 18. Representative confocal image demonstrating colocalization of NKA, in green, and Rhag(A) and Rhbg(B) in M. octodecemspinos (long horned sculpin) gill epithelium. Arrows denote areas of specific Rh glycoprotein expression while asterisks denote iontransporter expression in ionocytes. White Bar = 20µm.

52

Fig 19. Representative confocal image demonstrating colocalization of NKA, in green, and takifugu Rhcg1(A) and takifugu Rhcg2(B) in M. octodecemspinosn gill epithelium. Arrows denote areas of specific Rh glycoprotein expression while asterisks denote iontransporter expression in ionocytes. White Bar = 20µm.

53

Fig 20. Representative confocal image demonstrating colocalization NKCC, in green, and takifugu Rhag (A), Rhbg (B), Rhcg1(C), Rhcg2(D) in M. octodecemspinos gill epithelium. Arrows denote areas of specific Rh glycoprotein expression while asterisks denote iontransporter expression in ionocytes. White Bar = 20µm.

54

Fig 21. Laser Scanning confocal imagery of M. octodecemspinos gills colocalization of takifugu Rhcg1 (1:250) in red with sculpin HAT B (1:250) in green. Arrows indicate areas of Rhcg1 immunoreactivity. White bar = 20µm.

55

Fig 22. Laser Scanning confocal imagery of ammonia treaed M. octodecemspinos gills. A gill stained as a negative control for Alexa Fluor® 568, B gill stained as a negative control for Alexa Fluor® 488, C colocalization of sculpin NHE 3 (1:250) in red with NKA (1:250) in green. Arrows indicate areas of NHE 3 immunoreactivity. White bar = 20µm.

56

Fig 23. Representative confocal image demonstrating hagfish Rhcg, in red, and either dogfish HAT, B, or NHE 2, C in green in the renal tubules of S. acanthias kidney. Arrows denote areas of immunoreactivity of Rhcg, A, HAT, B, or Rhcg and NHE 2 C. White Bar = 20µm.

57

Fig 24. Laser scanning confocal imagery of fluorescently stained S. acanthias gills. colocalized takifugu Rhcg1 in red (1:250) and dogfish HAT in green (1:250). Arrows indicate regions of Rhcg1 immunoreactivity. White Bar = 20µm.

58

Fig 25. Laser scanning confocal microscopy images of fluorescently labeled hagfish Rhcg, in red, in S. acanthias gill epithelium (Edwards, unpublished data 2014). Red bar = 50µm.

59

Fig 26. Laser scanning confocal microscopy of fluorescently labeled S. acanthias gills A Rhag in red, and NKA in green, B, Rhcg2 in red and NKA in green. Arrows denote areas of immunoreactive Rh expression, while asterisks denote NKA expression in ionocytes. White Bar = 20µm.

60

Fig 27. The hypothesized model of ammonia excretion via Rh proteins and ion transporters, NHE3, NKCC, and NKA, in the gill epithelium of M. octodecemspinous (Adapted from Weihrauch et al. 2009 and Nakada et al. 2007).

61

Fig 28. Laser scanning confocal imagery of negative control slides. A, negative control with alexa flora 488 in S. acanthias gill, B negative control with alexa flora 568 in S. acanthias gill, C negative control with alexa flora 488 in M octodecemsinous gill, D negative control with alexa flora 568 in M octodecemsinous gill.

C D

62

References

Albrecht J (2007) CH 12, Ammonia toxicity in the central nervous system. In Handbook

of neurochemistry and molecular neurobiology. Springer US.261-276.

Anderson PM (2001) Urea and glutamine synthesis: environmental influences on

nitrogen excretion. Pp. 239–278 in P.A. Wright and P.M. Anderson, eds. Fish

Physiology. Vol. 20. Nitrogen Excretion. Academic Press, San Diego, CA.

Anderson WG, Nawata CM, Wood CM, Piercey-Normore MD, and Weihrauch D (2012)

Body fluid osmolytes and urea and ammonia flux in the colon of two

chondrichthyan fishes, the ratfish, Hydrolagus colliei, and spiny dogfish, Squalus

acanthias. Comp Biochem Phys A 161(1), 27-35. Doi:DOI

10.1016/j.cbpa.2001.08.017

Andrade SLA, and Einsle O (2007) The Amt/Mep/Rh family of ammonium transport

proteins (Review). Molecular Membrane Biology 24(5-6): 357–365.

Anstee DJ, Tanner MJA (1993) Biochemical aspects of the blood group Rh (Rhesus)

antigens. Baillieres Clin Haematol.6(2):401–422. Doi:Doi 10.101016/S0950-

3536(05)80152-0

Bakouh NF, Benjelloun B, Cherif-Zahar B, Planelles G (2006) The challenge

of understanding ammonium homeostasis and the role of the Rh glycoproteins.

Transfus Clin Biol 13(1-2) :139 -146. Doi:10.1016/j.tracli.2006.02.008

Barimo JF, Walsh PJ (2006) Use of urea as a chemosensory cloaking molecule by a bony

fish. Journal of Experimental Biology. 209(21): 4254-4261. Doi:10.1242/ jeb.02533

Beyenbach KW (2004) Kidneys sans glomeruli. Am J Phsiol-Renal 286 (5):F811-F827.

Doi:10.1152/ajprenal.00351.2003

63

Braun MH Perry SF (2010) Ammonia and urea excretion in the pacific hagfish Eptatretus

stoutii: evidence for the involvement of Rh and UT proteins. Comp Biochem Physio

Part A: Mol & Integ Physio 157.4 :405-415.

Braun MH, Steele SL, Ekker M, Perry SF (2009a). Nitrogen excretion in developing

zebrafish (Danio rerio): a role for Rh proteins and urea transporters. American

Journal of Physiology-Renal Physiology, 296(5), F994-F1005.

Braun MH, Steele SL, Perry SF (2009b). The response of zebrafish (Danio rerio) to high

external ammonia and urea transporter inhibition: nitrogen excretion and expression

of rhesus glycoproteins and urea transporter proteins. Journal of Experimental

Biology 212 (23): 3846-3856. Doi:10.1242/jeb.034157

Brix KV, Esbaugh AJ, Mager EM, Grosell M (2015). Comparative evaluation of Na+

uptake in Cyprinodon variegatus variegatus (Lacepede) and Cyprinodon variegatus

hubbsi (Carr)(Cyprinodontiformes, Teleostei): Evaluation of NHE function in high

and low Na+ freshwater. Comp Biochem Phys A 185: 115-124.

Doi:10.1016/j.cbpa.2015.04.002

Brix KV, Grosell M (2012) Comparative characterization of Na+ transport in Cyprinodon

variegatus variegatus and and Cyprinodon variegatus hubbsi: a model species

complex for studying teleost invasion of freshwater. Journal of Experimental

Biology 215 (7) 1199-1209. doi:Doi 10.1242/Jeb.067496

Caner T, Abdulnour-Nakhoul S, Brown K, Islam MT, Hamm LL, Nakhoul NL (2015)

Mechanisms of ammonia and ammonium transport by Rhesus-associated

glycoproteins. Am J Physiol-Cell Ph 309(11), C747-C758.

64

Catches JS, Burns JM, Edwards SL, Claiborne JB (2006) Na+/H+ antiporter, V-H+-

ATPase and Na+/K+-ATPase immunolocalization in a marine teleost

(Myoxocephalus octodecemspinosus). Journal of Experimental Biology 209(17):

3440-3447. Doi:10.1242/jeb.02384

Claiborne JB, Evans DH (1988) Ammonia and acid-base balance during high ammonia

exposure in a marine teleost (Myoxocephalus octodecimspinosus). Journal of

Experimental Biology, 140(1): 89-105.

Claiborne JB, Edwards SL, Morrison-Shetlar AI (2002) Acid–base regulation in fishes:

cellular and molecular mechanisms. J Exp Zool 293(3): 302-319. doi:

10.1002/jez.10125

Clifford AM, Goss GG, Wilkie MP (2015) Adaptations of a deep sea scavenger: High

ammonia tolerance and active NH4+ excretion by the Pacific hagfish (Eptatretus

stoutii), Comp Biochem and Physio Part A, 182 : 64-74.

doi:10.1016/jcbpa.2014.12.2010

Currie S, Edwards SL (2010) The curious case of the chemical composition of hagfish

tissues-50 years on. Comp Biochem Phys A 157 (2): 11-115. doi:DOI

10.1016/j.cbpa.2010.06.164

Edwards, S.L. (2000). Identification of NHEs in the gills of fishes. Doctoral Dissertation,

Deakin University, Geelong Victoria, Australia.

Edwards SL, Marshall WS (2013) Principles and patterns of osmoregulation and

euryhalinity in fishes. Euryhaline Fishes. By Stephen D. McCormick, Anthony

Peter Farrell, and Colin J. Brauner. Vol. 32. Oxford: Academic. 18-21.

65

Edwards SL, Wall BP, Morrison-Shetlar A, Sligh S, Weakley JC, Claiborne JB.

(2005) The effect of environmental hypercapnia and salinity on the expression of

NHE-like isoforms in the gills of a euryhaline fish (Fundulus heteroclitus). J Exp

Zool 303A(6) : 464–475. doi:10.1002/jez.a.175

Edwards SL, Arnold J, Blair SD, Pray M, Bradley R, Erikson O, Walsh PJ (2015)

Ammonia excretion in the Atlantic hagfish (Myxine glutinosa) and responses of an

Rhc glycoprotein. Am J Physiol-Reg I 308(9): R769-R778.

Doi:10.1152/ajpregu.00355.2014

Edwards SL, Claiborne JB, Morrison-Shetlar AI, Toop T(2001) Expression of Na+?H+

echanger mRNA in the gills of the Atlantic hagfish (Myxine glutionsa) in response

to metabolic acidosis. Comparative Biochemistry and Physiology a-Molecular and

Integrative Physiology 130(1):81-91. Doi:Doi 10.1016/S1095-6433(01)00367-1

Endeward V, Cartron JP, Ripoche P, Gros G (2008) RhAG protein of the Rhesus

complex is a CO2 channel in the human red cell membrane. FASEB J 22(1): 64-

73.doi:10.1096/fj.07-9097com

Evans DH, Piermarini PM, Choe KP (2005) The multifunctional fish gill: Dominant site

of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous

waste. Physiol Rev 85(1): 97–177. Doi:10.1152/physrev.00050.2003

Evans DH (2010) A brief history of fish osmoregulation: the central role of the Mt.

Desert Island Biological Laboratory. Front Physio 1:1-10.

Doi:10.3389/Fphys.2010.00013

66

Evans DH, Cameron JN (1986) Gill ammonia transport. J Exp Zool 239(1): 17-23.

Doi:Doi 10.1002/jez.1402390104

Evans DH (2008) Teleost fish osmoregulation: what have we learned since August

Krogh, Homer Smith, and Ancel Keys (vol 295, pg R704, 2008). Am J Physiol-Reg

I 295 (4): R1359-R1359. Doi:10.1152/ajpregu.zh6-6523-corr.2008

Evans DH (1982) Mechanisms of acid extrusion by two marine fishes: the teleost,

Opsanus beta, and the elasmobranch, Squalus acanthias. J. Exp. Biol. 97 (Apr):

289-299

Giles S, Freidman M, Brazeau MD (2015) Osteichthyan-like cranial conditions in an

Early Devonion stem gnathostone. Nature 520 (7545): 82-85

Grosell M (2006) Intestinal anion exchange in marine fish osmoregulation. Journal of

Experimental Biology 209(15): 2813-2827. Doi:10.1242/jeb.02345

Guffey SC, Fliegel L, Goss GG (2015). Cloning and characterization of Na+/H+

Exchanger isoforms NHE2 and NHE3 from the gill of Pacific dogfish Squalus

suckleyi. Comp Biochem Phys B 188: 46-53. Doi:10.1016/j/cbpb.2015.06.03

Havird JC, Henry RP, Wilson AE (2013) Altered expression of Na /K –ATPase and other

osmoregulatory genes in the gills of euryhaline animals in response to salinity

transfer: a meta-analysis of 59 quantitative PCR studies over 10years. Comparative

Biochemistry and Physiology Part D: Genomics and Proteomics 8.2: 131-40.

Hill RW, Wyse GA, Anderson. M. (2012) Animal Physiology. Sunderland, MA: Sinauer

Associates.

67

Horng JL, Lin LY (2008) Expression of the Na-K-2Cl cotransporter in branchial

mitochondrion-rich cells of Mozambique tilapia (Oreochromis mossambicus)

subjected to varying chloride conditions. Zool Stud 47 (6): 733-740.

Houlihan DF, McCarthy ID, Carter CG, Marttin F (1995). Protein turnover and amino

acid flux in fish larvae. Ices Mar Sc 201:87-99

Huang CH, Liu PZ (2001). New insights into the Rh superfamily of genes and proteins in

erythroid cells and nonerythroid tissues. Blood Cell Mol Dis 27(1): 90-101.

Doi:DOi 10.1006/Bcmd.200.0355

Huang CH, Peng J (2005). Evolutionary conservation and diversification of Rh family

genes and proteins. Proc Natl Acad Sci U S A 102(43): 15512–15517.

Doi:10.1073/pnas.0507886102

Huang C, Ye M (2010) The Rh protein family: gene evolution, membrane biology, and

disease association. Cell Molec Life Sci 67(8): 1203-1218. Doi:10.1007/s00018-

009-0217-x

Hung CC, Nawata CM, Wood CM, Wright PA (2008) Rhesus glycoprotein and urea

transporter genes are expressed in early stages of development of rainbow trout

(Oncorhynchus myxiss). J Exp Zool A Ecol Genet Physiol 309 (5):262-268. Doi:

10.1002/jez.456

Hung, CYC, Tsui KNT, Wilson JM, Nawata CM, Wood CM, Wright PA (2007) Rhesus

glycoprotein gene expression in the mangrove killifish Kryptolebias marmoratus

exposed to elevated environmental ammonia levels and air. Journal of Experimental

Biology 210(14), 2419-2429. Doi:Doi 10.1242/Jeb.002568

68

Hwang PP, Lee TH, Lin LY (2011). Ion regulation in fish gills: recent progress in the

cellular and molecular mechanisms.(vol 301, pg R28, 2011). Am J Physiol-Reg I

301 (4): R1206-R1206. Doi:10.

ammonia transportation via rhesus ... laura_2016_thesis...and spiny dogfish (squalus acanthias)....

Documents