TECHNICAL NOTE

A real-time PCR-based amelogenin Y allele dropoutassessment model in gender typing of degradedDNA samples

Kyung-Yong Kim & Younghyuk Kwon &Munkhtsetseg Bazarragchaa & Ae-Ja Park &Hyowon Bang &Won-Bok Lee & Junyoung Lee &Kwang-Ho Lee & Bum-Joon Kim & Kijeong Kim

Received: 13 October 2011 /Accepted: 20 December 2011 /Published online: 12 January 2012# Springer-Verlag 2012

Abstract Allelic dropout due to stochastic variation in de-graded small quantity DNA appears to be one of the mostserious genotyping errors. Most methods require PCR rep-lication to address this problem. The small amounts ofvaluable samples are often a limitation for such replications.We report a real-time PCR-based amelogonin Y (AMELY)allele dropout estimation model in an AMEL-based gender

typing. We examined 915 replicates of AMELY-positivemodern male DNA with varying amounts of DNA andhumic acid. A male-specific AMEL fragment (AMELy)dropped out in 143 genuine male replicates, leading togender typing errors. By graphing a scatter plot of thecrossing point versus the end cycle fluorescence of themale replicates, a standard graph model for the estimation of

Electronic supplementary material The online version of this article(doi:10.1007/s00414-011-0663-5) contains supplementary material,which is available to authorized users.

K.-Y. Kim :A.-J. Park :H. BangInstitute for Medical Sciences,Chung-Ang University,Seoul 156-756, South Korea

Y. Kwon :M. BazarragchaaDepartment of Microbiology,College of Medicine and Medical School,Chung-Ang University,Seoul 156-756, South Korea

K.-Y. Kim :W.-B. LeeDepartment of Anatomy, College of Medicine and MedicalSchool, Chung-Ang University,Seoul 156-756, South Korea

A.-J. ParkDepartment of Laboratory Medicine, College of Medicineand Medical School, Chung-Ang University,Seoul 156-756, South Korea

H. BangDepartment of Physiology, College of Medicine and MedicalSchool, Chung-Ang University,Seoul 156-756, South Korea

K.-H. LeeDepartment of Life Science, College of Natural Science,Chung-Ang University,Seoul 156-756, South Korea

J. LeeThe Hun School of Princeton,Princeton, NJ 08540, USA

B.-J. KimDepartment of Microbiology, College of Medicine,Seoul National University,Seoul 110-799, South Korea

K. Kim (*)Institute for Medical Sciences, College of Medicine and MedicalSchool, Chung-Ang University,221, Heukseok-dong, Dongjak-gu,Seoul 156-756, South Koreae-mail: kimkj@cau.ac.kr

K. KimDepartment of Microbiology, College of Medicine and MedicalSchool, Chung-Ang University,221, Heukseok-dong, Dongjak-gu,Seoul 156-756, South Korea

Int J Legal Med (2013) 127:5561DOI 10.1007/s00414-011-0663-5

the AMELy allele dropout was constructed with thedropout-prone and dropout-free zones. This model wasthen applied to ancient DNA (aDNA) samples. Ninesamples identified as female were found in the dropout-prone zone; with higher DNA concentrations, six wereshifted to the dropout-free zone. Among them, two femaleidentifications were converted to male. All the aDNAgender was confirmed by sex-determination region Ymarker amplification. Our data suggest that this modelcould be a basic approach for securing AMELy alleledropout-safe data from the stochastic variation of degradedinhibitory DNA samples.

Keywords AMELYalleledropout . Ancient bone . Real-timePCR .Melting curve analysis . Amelogenin

Introduction

DNA analysis of degraded or ancient samples suffers fromreduced reproducibility due to DNA degradation, contami-nation with other DNA, and the presence of PCR inhibitors[1]. These conditions severely increase the probability of agenotyping error [2]. Stochastic variation results in a loss ofthe true signals: heterozygote peak imbalance and increasedstutter products and a gain of false signal; allele dropout andcontamination (drop-in) [3]. The most frequent errorreported is allelic dropout [4]. Contamination can be con-trolled by following stringent laboratory protocols and theinclusion of multiple negative controls. False alleles areconsiderably less frequent and often show an unusual spec-tral pattern. In contrast, an allele that has dropped out leavesno trace of itself in the genotype data [5].

Despite many methods introduced to overcome theseproblems [1, 6, 7], exaggerated stochastic sampling effectsstill occur [8]. This stochastic fluctuation makes interpreta-tion of the data problematic. When PCR inhibition is sus-pected, dilution of the extracts is often an undesirableapplication involving the highly degraded or otherwiselow-copy templates and is sometimes impossible due tofurther reduction of the template amounts [9]. In this study,we present a comprehensive real-time PCR-based approachto estimate the amelogonin Y (AMELY) allele dropout indegraded and low amount DNAs with PCR inhibitors. Weintroduce a laboratory standard graph model plotted withtwo variables, crossing point (CP) and end cycle fluores-cence (ECFL), for dropout. The CP is defined as the point atwhich the fluorescence rises appreciably above the back-ground fluorescence. The ECFL is defined as the fluores-cence at the final cycle of amplification. The standard modelwill be a useful guide for the quick tracing of allele dropoutdata and securing dropout-safe results in AMEL-based gen-der typing of degraded samples.

Materials and methods

Modern and ancient human DNA samples

A total of 50 modern DNA samples and 100 ancient DNA(aDNA) samples were used in this study. The aDNA wasextracted twice from different fragments of ten ancient hu-man bones excavated from Mongolia and Korea and aged10010,000 years (ESM 1). Single extractions were carriedout for 90 ancient human bones excavated from Mongolia,Korea, and Uzbekistan and aged 105,000 years (ESM 1).We strictly followed a previously described protocol foraDNA extraction [1, 10].

Real-time PCR

Gender was determined based on the melting temperature(Tm) difference of AMEL amplicons produced using pri-mers that co-amplify large fragments of AMELX (184 bp)and AMELY (190 bp) and a small Y-specific fragment ofAMELY (AMELy, 92 bp). AMELy binds specifically to a 6-bp insertion present only in Y-DNA (Table 1). Real-timePCR was performed using the LightCycler system (version2.0) (Roche). Reactions were performed with at least dupli-cate samples in 5 l reaction mixtures containing 2 ltemplate DNA, 1 l 5x LightCycler FastStart DNA Master-PLUS SYBR Green I reagent (Roche), 0.15 M AMEL-specific forward primer (F_amXY), 0.8 M AMELY-specific forward primer (F_amY), 0.8 M AMEL-specificreverse primer (R_amXY), 0.9 mg/ml BSA (Ambion), andDNA/DNase-free deionized water. A 3-l aliquot of themaster mix was placed in the capillaries using an elec-tronic pipet, and 2 l template DNA was added andslowly mixed three times. Cycling conditions were pre-incubation for 15 min at 95C and 45 cycles of 10 s at95C, 20 s at 56C, and 30 s at 72C. Melting curveswere generated by measuring the fluorescence signalwhile raising the temperature as follows: 10 s at 95C,1 min at 70C, and an increase from 70C to 90C at arate of 0.05C/s. The Tm was measured using Light-Cycler software V 4.05. Tms of AMEL amplicons pro-duced from modern male and female DNA templateswere estimated by calculations with LC PDS (version2.0) software before real-time PCR (Table 1).

To quantify the number of amelogenin DNA mole-cules in the DNA samples, tenfold serial dilutions (from5106 to five copies) of purified male (195 and 201 bp)and female (195 bp) amelogenin PCR products thatwere quantified by a NanoPhotometer (IMPLEN) weretested to generate a standard curve. The PCR conditionshave been described previously [10]. Standard curvesshowing trendline correlation coefficients greater than0.95 were used (ESM 2).

56 Int J Legal Med (2013) 127:5561

Plotting an allele dropout estimation model with CPand ECFL

To test the sensitivity and reproducibility of the real-timePCR method, modern male and female DNA samples were

serially diluted with different amounts of humic acid. A totalof 915 male and 135 female DNA replicates were tested. Bygraphing a scatter plot of CP versus ECFL values of themale replicates, a model of AMELy drop-out prone anddrop-out free zones was constructed.

Table 1 Primers used for the detection of amelogenin fragments and calculated melting temperatures (Tms) of products

Primera Product

Name Sequence (53) Tm (C)b Target Size (bp) Tm (C)

b

F_amXY GGTTATATCAACTTCAGCTATGAG 56.6 AMELX 184 79.1

AMELY 190 79.5

F_amY GGATTCTTCATCCCAAATAAAGT 57.1 AMELy 92 77.7

R_amXY GCCAACCATCAGAGCTTAAAC 60.8 AMELX

AMELY

AMELX large fragment of amelogenin gene on X chromosome, AMELY large fragment of amelogenin gene on Y chromosome, AMELy male-specific small fragment of amelogenin gene on Y chromosomea Kim et al. [1]b Calculated by using LC PDS software (version 2.0)

68.3%46.7%

Humic acid 0 ng

0%

20%

40%

60%

80%

100%

100-1000 50 20 10Template (pg)

Failedy-dropouty + X/Y

6060 0606

23.3%

Template 50 pg

0%

20%

40%

60%

80%

100%

0 200 300 400Humic acid (ng)

Failedy-dropouty X/Y

3030 5106

Template 20pg

0%

20%

40%

60%

80%

100%

0 25 50 100 150 200 300 400 500Humic acid (ng)

Failedy-dropouty X/Y

1530 5106 60 0606 6060

Template 10pg

0%

20%

40%

60%

80%

100%

0 25 50 100 150 200 300 400 500Humic acid (ng)

Failedy-dropouty X/Y

1515 5106 60 5106 3030

30%

30%

Fig. 1 Amelogenin real-time PCR sensitivity in male gender determi-nation with different amounts of male DNA templates and humic acid(HA). The male-specific small amelogenin amplicon (y) dropped outwith template amounts less than 50 pg for about 30% of the replicates

without HA and for about 18% with HA. PCR failures often occurredwith the smallest amounts of templates or the largest amounts of HA.X/Y, large amelogenin amplicon of X chromosome and/or Y chromo-some; y, male-specific small amelogenin amplicon

Int J Legal Med (2013) 127:5561 57

Gender determination of aDNA samples

Gender determination using amelogenin could be erroneous[1115]. We determined gender by three independent meth-ods, the amelogenin real-time PCR, a sex-determinationregion Y (SRY) PCR [16], and a method using an ABIPRISM 310 automatic sequencer with AmpFlSTR Mini-filer PCR Amplification Kit (ABI). Single extracts of 90aDNA samples were analyzed at least in duplicate by real-time PCR and SRY PCR.

Results and discussion

The CP and ECFL values obtained from the AMELreal-time PCR with male DNA samples were used tograph a standard scatter plot with experimentally iden-tified gender and to delineate the Y allele dropout-freeand dropout-prone zones. When a test sample generateda female result with a CP/ECFL value entering the Yallele dropout-prone zone of the standard graph, the

gender determination was considered unreliable. Thereal-time PCR with a more concentrated sample DNAcould shift the CP/ECFL spot from the unreliable zoneto the reliable zone; this might convert the femaleidentification to male.

Tms for gender determination and AMELy dropout

Only a single distinct Tm (79.980.5C) of the largeAMELX fragment was identified for 120 female replicatesby real-time PCR (ESM 1; ESM 2). The clear differentiationof Tms of AMELX/Y (80.080.6C) and AMELy (77.9

Humic acid 0 ng

05

1015202530354045

1000 100 50 20 10Template (pg)

CP

00.20.40.60.811.21.41.6

ECFL

CPECFL

(30/30)(30/30) (60/60) (59/60) (46/60)

Template 50 pg

05

1015202530354045

0 200 300 400Humic acid (ng)

CP

00.20.40.60.811.21.41.6

ECFLCP

ECFL

(30/30)

(30/30) (15/15)(0/15)

Template 20 pg

05

1015202530354045

0 25 50 100 150 200 300 400 500Humic acid (ng)

CP

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

ECFLCP

ECFL

(59/60)

(58/60)(25/30)

(58/60)

(59/60)

(6/15)(57/60)

(58/60)

(0/15)

Template 10 pg

05

1015202530354045

0 25 50 100 150 200 300 400 500Humic acid (ng)

CP

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

ECFLCP

ECFL

(46/60)

(10/15) (10/15)

(52/60)

(52/60)

(7/15)(25/30)(25/30)

(0/15)

Fig. 2 Crossing point (CP) and end cycle fluorescence (ECFL) valuesproduced by replicated real-time PCR with various amounts of tem-plate DNA and humic acid. CP was inversely proportional to DNA

amount but was directly proportional to HA amount. ECFL valueswere inversely proportional to the amount of HA

Fig. 3 A standard graph model for the estimation of AMELy dropoutof unknown DNA samples (a) and its application to ancient DNAsamples (b). a Values of CP versus ECFL of the gender data deter-mined by real-time PCR from the male replicates were plotted to definethe dropout-prone (shaded) and dropout-free (not shaded) zones. b Thefemale gender of nine aDNA samples (20 replicates) was located in thedropout-prone zone based on this model, and the concentration of sixunreliable samples shifted the coordinates to the dropout-free zone.The genders of three replicates were converted from female to male(big arrow)

b

58 Int J Legal Med (2013) 127:5561

Int J Legal Med (2013) 127:5561 59

78.5C) for the male identification was possible regardlessof the amount of humic acid. Humic acid decreased theAMEL Tms only slightly. The Tm of AMELy was detectableeven though those of AMELX/Y were not detected at higherlevels of humic acid. A blind gender test of all 50 modernhuman DNAs showed consistent results with the phenotype(ESM 2).

AMELy dropout began to occur in male templates withless than 50 pg DNA and at a CP range higher than 34,regardless of the amount of humic acid (ESM 1; Fig. 1). For10- and 20-pg male DNA without humic acid (120 repli-cates), AMELy dropped out in 37 male replicates, and thus,the gender was falsely determined as female. There was nosignificant change in the rate of AMELy dropout for varyingamounts of humic acid. Frequent AMELy dropouts andPCR failures were observed for the decreased amounts ofDNA.

AMELy allele dropout estimation model

The CP was inversely proportional to the amount of DNAbut was proportional to the amount of humic acid; ECFLwas inversely proportional to the amount of humic acid(Fig. 2 and ESM 2). The CP was also proportional to theAMELy dropout rate in the male templates (ESM 1). Whenhumic acid was added to the templates, the CP ranges inwhich the AMELy dropout was not observed were expand-ed (ESM 1). These data suggested that humic acid increasedthe reliable range of CP. For example, the female genderresults with 20 pg DNA and CP 35 were not reliable if thetemplate had no humic acid but were reliable if the templatecontained 25 ng humic acid (ESM 1). It thus appeared thatthe amount of humic acid, which could be estimated byECFL, should be considered to determine the reliable rangeof CP.

We used CP and ECFL values to build a novel standardgraph model for the estimation of the male-specific alleledropout in the gender determination of unknown aDNAsamples (Fig. 3a). The dropout-prone zone of the plot wasdelineated by the CP/ECFL values of the false-positivelydetermined female data due to the AMELy dropout frommale DNA replicates. The dropout-free zone was deter-mined by those of the correctly determined male data with-out the AMELy dropout. This model may be used for theprediction of AMELy allele dropout of an unknown samplewith the given CP and ECFL values.

Gender determination of aDNA samples with the model

The AMEL real-time PCR gender data from the duplicateextracts of nine aDNA samples except for one sample(MN128) were all within the dropout-free zone (ESM 1and ESM 2). There were no conflicting results among the

three gender typing methods (ESM 1). Low ECFL values ofaDNA samples indicated a large amount of PCR inhibitors.The CP did not reflect the aDNA amount because of theinterference of PCR inhibitors. Supposing that there was noPCR inhibition in these ten aDNAs, the copy numberswould range from 0.9 to 87.3. The real-time PCR-basedgender of one aDNA sample (MN128) showed both gendersfrom each extract. The female CP/ECFL spots were in thedropout-prone zone. The results of the other methods werealso inconsistent. Real-time PCR of the concentrated sampleshifted the spots to the dropout-free zone, converting it fromfemale to male; the SRY marker was also amplified.

From single extractions of 90 ancient human bones,female identification of nine aDNA samples was unreliablebecause their CP/ECFL spots were in the dropout-pronezone. Upon concentration, the spots of six aDNA samplesshifted to the reliable range, and two were identified as male(Fig. 3b).

To our best knowledge, this study is the first report ofgender determination based on a melting curve analysis andof an allele dropout estimation standard model, which can-not be achieved with conventional PCR. At present, therecommended way to solve the stochastic variation problemis simply based on replicated PCR. The advantages of ourmethod come from real-time PCR technology, which israpid, sensitive, quantitative, and DNA- and labor-saving.

Our method, however, has some limitations. First, itdepends on the PCR product Tms, so the gender determina-tion could be difficult for aDNAs with an ambiguous Tms. Inthese cases, probe-based methods or nested PCR methodscan be used. Second, each laboratory should set up its ownmodel with CP and ECFL if other real-time PCR conditionsare used. Third, the sizes of AMELX/Y fragments might betoo big for the degraded DNA analysis. However, they arenot larger than the maximum size in the STR analysis kitsdeveloped for the degraded DNA samples. Lastly, genderdetermination is based on the amelogenin locus, which isreported to be unreliable. Therefore, the sole use of ourmethod is not appropriate for gender determination.

In conclusion, we have developed a method and modelapplicable to the assessment of the AMELy allele dropoutpotential for degraded DNAs with/without PCR inhibitors.Further study is required to examine the possible use of ourstrategy for estimating the allele dropout in short tandemrepeat genotyping assays.

Acknowledgments We thank Jehyeok Lee and Yeong-mi Chang fortheir kind assistance in administration work and purchase of laboratorymaterials. We also thank Jee-hyun Yoon for the maintenance of thereal-time PCR system. This research was supported by the BasicScience Research Program through the National Research Foundationof Korea (NRF) funded by the Ministry of Education, Science andTechnology (2010-0021367).

60 Int J Legal Med (2013) 127:5561

Ethical standards All sampling was done according to Korean lawsand ethical standards.

Conflict of interest The authors declare that there is no conflict ofinterest.

References

1. Kim K, Kim KY, Jeon E, Togloom A, Cho YO, Lee MS, Lkhag-vasuren G et al (2008) Technical note: improved ancient DNApurification for PCR using ion-exchange columns. Am J PhysAnthropol 136:114121

2. Taberlet P, Friffin S, Goossens B, Questiau S, Manceau V, EscaravageN, Waits LP, Bouvet J (1996) Reliable genotyping of sampleswith very low DNA quantities using PCR. Nucleic Acids Res24:31893194

3. Cowen S, Debenham P, Dixon A, Kutranov S, Thomson J, Way K(2011) An investigation of the robustness of the consensus methodof interpreting low-template DNA profiles. Forensic Sci Int Genet5:400406

4. Gagneux P, Boesch C, Woodruff DS (1997) Microsatellite scoringerrors associated with noninvasive genotyping based on nuclearDNA amplified from shed hair. Mol Ecol 6:861868

5. Miller CR, Joyce P, Waits LP (2002) Assessing allelic dropout andgenotype reliability usingmaximum likelihood. Genetics 160:357366

6. Hanson EK, Ballantyne J (2005) Whole genome amplificationstrategy for forensic genetic analysis using single or few cellequivalents of genomic DNA. Anal Biochem 346:246257

7. Strom CM, Rechitsky S (1998) Use of nested PCR to identifycharred human remains and minute amounts of blood. J ForensicSci 43:696700

8. Budowle B, Eisenberg AJ, van Daal A (2009) Validity of low copynumber typing and applications to forensic science. Croat Med J50:207217

9. King C, Debruyne R, Kuch M, Schwarz C, Poinar H (2009) Aquantitative approach to detect and overcome PCR inhibition inancient DNA extracts. Biotechniques 47:941949

10. Kim K, Brenner CH, Mair VH, Lee KH, Kim JH et al (2010) Awestern Eurasian male is found in 2000-year-old elite Xiongnucemetery in Northeast Mongolia. Am J PhysAnthropol 142:429440

11. Jobling MA, Lo IC, Turner DJ et al (2007) Structural variation on theshort arm of the humanY chromosome: recurrentmultigene deletionsencompassing amelogenin Y. Hum Mol Genet 16:307316

12. Cadenas AM, Regueiro M, Gayden T, Singh N, Zhivotovsky LA,Underhill P, Herrera RJ (2007) Male amelogenin dropouts: phylo-genetic context, origins and implications. Forensic Sci Int166:155163

13. Kumagai R, Sasaki Y, Tokuta T, Biwasaka H, Aoki Y (2008) DNAanalysis of family members with deletion in Yp11.2 region con-taining amelogenin locus. Leg Med (Tokyo) 10:3942

14. Yong RY, Gan LS, Chang YM, Yap EP (2007) Molecular charac-terization of a polymorphic 3-Mb deletion at chromosome Yp11.2containing the AMELY locus in Singapore and Malaysia popula-tions. Hum Genet 122:237249

15. Mitchell RJ, Kreskas M, Baxter E, Buffalino L, van Oorschot RA(2006) An investigation of sequence deletions of amelogenin(AMELY), a Y-chromosome locus commonly used for genderdetermination. Ann Hum Biol 33:227240

16. Drobni K (2006) A new primer set in a SRY gene for sexidentification. Int Congr Ser 1288:268270

Int J Legal Med (2013) 127:5561 61

A real-time PCR-based amelogenin Y allele dropout assessment model in gender typing of degraded DNA samplesAbstractIntroductionMaterials and methodsModern and ancient human DNA samplesReal-time PCRPlotting an allele dropout estimation model with CP and ECFLGender determination of aDNA samples

Results and discussionTms for gender determination and AMELy dropoutAMELy allele dropout estimation modelGender determination of aDNA samples with the model

References