alignment of the genomes of brachypodium distachyon ...genotypes, abr1 and abr5. the library...

Copyright � 2006 by the Genetics Society of AmericaDOI: 10.1534/genetics.105.049726

Alignment of the Genomes of Brachypodium distachyon and TemperateCereals and Grasses Using Bacterial Artificial Chromosome

Landing With Fluorescence in Situ Hybridization

Robert Hasterok,*,1 Agnieszka Marasek,† Iain S. Donnison,‡ Ian Armstead,‡ Ann Thomas,‡

Ian P. King,‡ Elzbieta Wolny,* Dominika Idziak,* John Draper§ and Glyn Jenkins§

*Department of Plant Anatomy and Cytology, Faculty of Biology and Environmental Protection, University of Silesia, 40-032 Katowice, Poland,†Department of Plant Physiology and Biochemistry, Research Institute of Pomology and Floriculture, 96-100 Skierniewice, Poland,

‡Institute of Grassland and Environmental Research, Plas Gogerddan, Aberystwyth SY23 3EB, Wales, United Kingdomand §Institute of Biological Sciences, University of Wales Aberystwyth, Penglais, Aberystwyth, Ceredigion SY23 3DA,

Wales, United Kingdom

Manuscript received August 17, 2005Accepted for publication February 14, 2006

ABSTRACT

As part of an initiative to develop Brachypodium distachyon as a genomic ‘‘bridge’’ species between rice andthe temperate cereals and grasses, a BAC library has been constructed for the two diploid (2n ¼ 2x ¼ 10)genotypes, ABR1 and ABR5. The library consists of 9100 clones, with an approximate average insert size of88 kb, representing 2.22 genome equivalents. To validate the usefulness of this species for comparativegenomics and gene discovery in its larger genome relatives, the library was screened by PCR using primersdesigned on previously mapped rice and Poaceae sequences. Screening indicated a degree of syntenybetween these species and B. distachyon, which was confirmed by fluorescent in situ hybridization of themarker-selected BACs (BAC landing) to the 10 chromosome arms of the karyotype, with most of the BACshybridizing as single loci on known chromosomes. Contiguous BACs colocalized on individual chromo-somes, thereby confirming the conservation of genome synteny and proving that B. distachyon has utility as atemperate grass model species alternative to rice.

TEMPERATE grasses diverged from rice almost 50million years ago (Gaut 2002) and, although the

rice genome sequence has proved useful in the analysisof the larger genomes of the temperate cereals, it haslimited value for the exploration of many agronomictraits of interest in temperate grasses. Brachypodium isa genus of temperate grasses that is more closely relatedto the temperate cereals and forage grasses than isrice (Catalan et al. 1995, 1997; Draper et al. 2001;Kellogg 2001). It contains species that have small ge-nomes, with sizes and proportions of repetitive DNAcomparable to the model plants Arabidopsis thaliana andrice (Moore et al. 1993a; Catalan et al. 1995). Theperennial, outbreeding species Brachypodium sylvaticumwas adopted initially (Moore et al. 1993a,b; Aragon-Alcaide et al. 1996) as a species of choice for developmentas a genomic ‘‘bridge’’ to agronomically important cereals,such as wheat, barley, and the forage grasses, therationale being that its close phylogenetic proximity tothis group would be reflected in similar gene reper-toires and synteny and would enable comparativegenomic approaches for gene isolation and discovery.As part of this study, a bacterial artificial chromosome

(BAC) library of B. sylvaticum was constructed, the anal-ysis of which demonstrated synteny among this species,rice, and wheat (Foote et al. 2004). BACs are the largeinsert library tool of choice because, compared to themain alternative, yeast artificial chromosomes, they areeasy to handle, and the clones are stable and less likelyto be chimeric (Shizuya et al. 1992; Woo et al. 1994; Yuet al. 2000; Peterson et al. 2002). In addition to pro-viding a mechanism for map-based cloning, a BAClibrary is also an important resource for physical map-ping, genome structural analysis, comparative genomics,and genome sequencing.

The only annual species in the genus B. distachyon wasproposed more recently as an alternative ‘‘bridge’’species on the basis of its highly desirable biologicalfeatures that make it suitable for functional genomicsstudies (Draper et al. 2001). B. distachyon has one of thesmallest genomes (355 Mb) described in grasses to date(Bennett and Leitch 2005) and only five pairs ofreadily identifiable chromosomes in diploid ecotypes.Knowledge of the genomic infrastructure of this specieshas continued to develop, with advances in the cytoge-netics of this species and its relatives (Hasterok et al.2004), its interaction with pathogens (Draper et al.2001; Routledge et al. 2004; Jenkins et al. 2005), itstissue culture and genetic transformation (Bablaket al. 1995; Christiansen et al. 2005), and mutagenesis

1Corresponding author: Department of Plant Anatomy and Cytology,Faculty of Biology and Environmental Protection, University of Silesia,Jagiellonska 28, 40-032 Katowice, Poland. E-mail: [email protected]

Genetics 173: 349–362 (May 2006)

(Engvild 2005). As part of this ongoing initiative, thisarticle reports on the construction and analysis of twoBAC libraries of two diploid (2n ¼ 2x ¼ 10) ecotypes ofB. distachyon, ABR1 and ABR5. To validate the usefulnessof B. distachyon as a ‘‘bridge’’ species, synteny to rice andsome other members of the Poaceae was assayed bymarker screening of the BAC libraries, coupled withthe ‘‘landing’’ of selected BACs onto chromosomes ofB. distachyon, other near relatives in the Brachypodiumgenus, as well as rice and Triticale.

The fluorescent tagging of BACs and their hybridiza-tion in situ to chromosome substrates has been usedeffectively in a number of ways to improve our under-standing of the organization of a variety of plantgenomes. In the Poaceae, BAC landing has been usedin studies of structural genomics, integrated karyotyp-ing, and chromosomal mapping in species as diverse asbarley (Lapitan et al. 1997), sorghum (Islam-Faridiet al. 2002; Kim et al. 2002), rice ( Jiang et al. 1995), andwheat (Zhang et al. 2004a,b). The method has also beenused for the positional cloning and mapping of partic-ular genes, such as the bacterial blight resistance genein rice ( Jiang et al. 1995), and for the integration ofgenetic, cytogenetic, and physical maps, such as in rice(Cheng et al. 2001). BAC landing is an integral part ofcomparative genomics and assays of colinearity, for exam-ple, between A. thaliana and Brassicae species ( Jacksonet al. 2000; Ziolkowski and Sadowski 2002), and hasbeen used to ‘‘paint’’ chromosome arms in Arabidopsis(Lysak et al. 2001, 2003). In addition to the primary aimof determining to what extent the genome of B. dis-tachyon is colinear to its relatives, the mapping of single-locus BACs in this study also has utility in determiningthe pattern of divergence of the genomes of relatedcereals and grasses, the reconstruction of the archetypalgrass genome, and the assembly of chromosome‘‘paints’’ in this species for molecular cytogenetic inves-tigations of chromosome-specific structure and func-tion. In this study we demonstrate the potential of BAClanding to develop rapidly tiles of clones syntenic toimportant regions of much larger Gramineae genomes.

MATERIALS AND METHODS

Plant material: All Brachypodium ecotypes were sourcedfrom the collection held by Brachyomics of the University ofWales, Aberystwyth. Diploid ecotypes ABR1 and ABR5 ofB. distachyon (2n ¼ 2x ¼ 10) were collected from Kaman,Kiresihir (Turkey), and Huesca, Jaca (Spain), respectively.Accession ABR114 was collected from Formenterra (Spain)and originally classified as a cytotype of B. distachyon with2n ¼ 4x ¼ 20 (Robertson 1981). However, a recent studyhas shown that it is a distinctly different and unknown diploidwith 20 chromosomes (Hasterok et al. 2004). ABR113 wascollected from Lisbon (Portugal) and originally classified asan autohexaploid cytotype of B. distachyon (Robertson 1981).It has subsequently been shown to be an allotetraploid (2n ¼4x ¼ 30) with two diploid genomes similar to ABR1 andABR114 (Hasterok et al. 2004). Triticale cv. Lasko (2n¼ 6x¼

42; AABBRR), an intergeneric hybrid between tetraploidwheat and rye, and the standard rice genotype Oryza sativassp. indica IR64 were used as substrates for chromosomalmapping of Brachypodium BAC clones.Preparation of high-molecular-weight genomic DNA: High-

molecular-weight (HMW) DNA was isolated, in parallel, fromtwo ecotypes (ABR1 and ABR5) of B. distachyon (2n¼ 2x¼ 10).Approximately 20 g of young leaves were harvested fromglasshouse-grown plants and ground to a powder in liquidnitrogen. Nuclei were isolated using the method of Zhang et al.(1995) and embedded in agarose plugs. The nuclei contain-ing plugs were subjected to pre-electrophoresis in a Bio-Rad(Hercules, CA) CHEF-DR II pulsed-field gel electrophoresis(PFGE) apparatus as described by O’Sullivan et al. (2001).Preparation of insert DNA and partial digestion: The

B. distachyon HMW DNA was partially digested using HindIII(1.25 units of enzyme for one plug in 0.5 ml of reaction bufferat 37� for 1 hr). The partially digested DNA was subjected to asingle-step separation by PFGE (170 V for 16 hr, linear pulseramp from 0.5 to 40 sec). After migration, the sides of the gel-containing HMW markers (New England Biolabs, Beverly,MA) were stained with ethidium bromide. This was used todetermine the size of the partially digested DNA in the un-stained part of the gel. One to two gel slices containing DNA ofsizes ranging from 70 to 100 kb and from 100 to 130 kb wereexcised. The DNA was electroeluted into dialysis tubing anddrop dialyzed on ice as described by O’Sullivan et al. (2001).Ligation of size-selected DNA to a vector and trans-

formation: The purified DNA was ligated into the HindIII-digested pBeloBAC11 vector. The vector/insert ratio used waseither 5:1 or 10:1. Ligation was carried out as described byO’Sullivan et al. (2001). BAC clones were grown overnight at37� on LB–agar containing 12.5 mg/ml of chloramphenicolin 220- 3 220-mm plates (Genetix). BAC clones were pickedinto 96-well microtiter plates filled with 100 ml of LB withchloramphenicol and incubated at 37� overnight; glycerol wasthen added (to 25% of final volume) and the plates werestored at �80�. For quality control purposes, a representativesubset of 48 clones from the entire library was selected. Theclones were cultured overnight, and BAC DNA was isolatedand then restricted with NotI. After PFGE separation, theapproximate sizes of the genomic DNA inserts were estimated.Identification of BAC clones containing repetitive DNA:

High-density colony filters were prepared using a robotic work-station [QIAGEN (Chatsworth, CA) Bio-Robot 3000] customprogrammed to array using a 96-pin replicating tool (V&PScientific) as described by Donnison et al. (2005). BAC cloneswere gridded in duplicate in a 5 3 5 array on Hybond-N1

membrane (Amersham, Buckinghamshire, UK), which al-lowed 1200 clones to be represented on one 120- 3 80-mmfilter. The library screening was performed by Southernanalysis of eight filters representing 9100 clones.

Genomic DNA of B. distachyon (ABR1) was isolated fromfresh tissue using the DNeasy maxi kit (QIAGEN), labeled with[32P]dCTP by random priming using the Hi-Prime method(Stratagene, La Jolla, CA) and added to the hybridizationbuffer. Hybridization was performed overnight at 65� withgentle shaking. Filters were washed stringently (23 SSC 10.1% SDS; 13 SSC 1 0.1% SDS; 0.13 SSC 1 0.1% SDS, eachwashed twice for 15 min). Hybridization was detected both byusing a Typhoon PhosphorImager and by exposing X-ray film.A range of exposure times were used and BAC clones werecategorized into three classes: highly repetitive (H), moder-ately repetitive (M), and low or nonrepetitive (L).The pooling strategy for PCR-based screening: DNA pools

of BAC clones were generated to enable a PCR-based screen ofthe library. The entire libraries of ABR1 and ABR5 genotypeswere replicated in 90, 96-well microtiter plates with each well

350 R. Hasterok et al.

containing 200 ml of LB and chloramphenicol at a concentra-tion of 12.5 mg/ml. The BAC clones were grown overnight at37� with gentle agitation at 200 rpm. The cultures from eachmicrotiter plate were pooled into a 50-ml tube and centrifugedat 5000 rpm in an Eppendorf (Madison, WI) 5403 centrifuge.The supernatants were discarded and the pellets were frozenat �80�. Plasmid DNA was isolated using the alkaline lysismethod as described by Sambrook and Russel (2001). Afterscreening the DNA pools with PCR primers, positive plateswere identified and new plasmid DNA pools were created forthe rows and columns of the microtiter plate. Finally, plasmidDNA was isolated for the individual clone identified and thisDNA was rescreened by PCR to confirm the process.

Screening the BAC library for chloroplast DNA contami-nation: To evaluate the contamination of BAC libraries withchloroplast DNA, both BAC libraries were screened by PCRusing primers for three chloroplast genes (ndh, rbcL, psb). PCRamplification products were electrophoresed and bands ofthe predicted size for each gene were excised. The DNA waspurified with the QIAquick PCR gel purification method(QIAGEN) and sequenced using an ABI 3100 DNA analyzer.Sequences were characterized by BLAST analysis (http://www.ncbi.nlm.nih.gov).

PCR screening of the B. distachyon BAC libraries: Both BAClibraries were screened with 13 primer pairs designed toidentify single gene sequences from the region of ricechromosome 6, which had previously been identified ascontaining the rice Hd3 QTL and Hd3a gene (Monna et al.2002). Each primer pair (Table 1) was tested for amplifica-tion on B. distachyon ABR1 and ABR5 genomic DNA prior toBAC library screening. In addition, both BAC libraries werescreened with another nine primer pairs designed to amplifymarker sequences previously genetically mapped in Loliumperenne, Triticeae species, and rice (Tables 1 and 2; http://www.gramene.org). Thermal cycling was performed with 1min at 94� followed by 10 cycles of 1 min at 94�, 1 min at 60�(with the temperature reduced by 1�/cycle), and 3 min at 72�,

followed by 30 cycles of 1 min at 94�, 1 min at 50�, and 3 min at72�. Amplification products were electrophoresed on agarosegels and positive BAC clones were identified as describedpreviously. The identity of the amplification products pro-duced by markers LpF1-LpF4, LpHd3a, and B139776 andby the markers described in Table 2 was confirmed by directDNA sequencing of identified BACs.Preparation of root meristems: The somatic chromosome

preparations were made as described by Hasterok et al.(2004). Briefly, whole seedlings with roots 1.0–2.0 cm longwere immersed in ice-cold water for 24 hr, fixed in 3:1 (v/v)methanol:glacial acetic acid, and stored at �20�. After severalwashes in 0.01 m citric acid–sodium citrate buffer (‘‘citricbuffer,’’ pH 4.8), excised roots were digested in an enzymemixture comprising 20% (v/v) pectinase (Sigma, St. Louis),1% (w/v) cellulase (Calbiochem, La Jolla, CA), and 1% (w/v)cellulase Onozuka R-10 (Serva) for 2 hr at 37�. Prior tosquashing in a drop of 45% acetic acid, meristems weredissected out from root tips. After freezing, coverslips wereremoved and the preparations were postfixed in 3:1 ethanol:glacial acetic acid, dehydrated in absolute ethanol, and airdried.Preparation of anther cells: ABR1 and ABR5 were sown at

high density in compost and vernalized for 6 weeks at 5� toensure synchronous induction of flowering. They were thentransferred to a glasshouse. For meiotic chromosome prepa-rations, immature inflorescences (spikes) of different sizeswere fixed in 3:1 ethanol:glacial acetic acid and stored at �20�until required. Because of the minute size (150–250 mm) ofthe anthers compared to the rest of the floret, the anthers wereindividually dissected and collected into a container with acitric acid–sodium citrate buffer (0.01 m, pH 4.8). Enzymaticdigestion was carried out for 2 hr 15 min at 37� in a mixture of10% (v/v) pectinase (Sigma), 0.65% (w/v) cellulase OnozukaR-10 (Serva), 0.5% (w/v) cellulase (Calbiochem), 0.15% (w/v)cytohelicase (Sigma), and 0.15% (w/v) pectolyase (Sigma) in10 mm citric buffer (pH 4.8). After washing in citric buffer, the

TABLE 1

Primer sequences used in BAC library screening

Marker Primer 1 (59–39) Primer 2 (59–39)

LpF1 ACTATGGGCGTTTATGTGCG GTATCATCTGAACCAAGGCGLpF2 CTTCACTGAGCATGGTTCTTC CTCCCCAGCTTAGCATTGTCACCCTB139776 ACTCTCTGTAGACATTTGAGG CCACATCCAACATCAATAACLpC764 AGGATCTCTATTGCTGGTGCTTC GCTAACTCAGCAGCTTCCTCAB29786 CTCCACCGAGACTTGAAGCC AGACGTAGCTGATGGACATGB29797 AATCACATGCCTCAGGCAAT CCGACAAGCATATCTAGTGALpF3 TCATGTACGCCGACTTCTAC TGAGGTGGATGCCGTCCCAGLpHd3a CATGGTGTACATGCGCAGGT GAGGGCTCTCGTAGCACATCB87376 GCACGCTGGTTGTTAGCCAT CTCTCATCCATGGAACCAAGB87384 ATGGCATTGTCCTATGGTCT CATCTTGGGGCCAATCTGGTB7090 ACCAGGAAGTTTGTATGGAG TCGTTCACAACAAACATGCAB139345 AGTGCTCTGCTGGATGCTGA TTCTTGAGCAAGTTCAAGGGLpF4 GAGCGGTACCGCAGCTGCAACT TTATTAACATCTTGCAGTTGTTGTTLpCDO580 TTGGGGCATTGGCAATGAGTGAACC TTATGAATGCAGTTATTCCTTTTGALpCDO202 TGCATGTAGTCACAAGGCTTGGATG CTATCCTCATCTCTACTCCTAGAACLpCDO36 GTGTTCCCGTCGCCGTCCTTGAT GAACTTGGTGACATCCATGTTTCCHO15851 AGCAGATCTCGTGCTCCATG CTCACCTCATCCACCACATTLpCDO20 CAGCTAGCTCAGCTCCAAGA ACGGGCGCGCCGGAGTTGGTGLpCDO127 TTTCCAGCCATGTTGCACTTGTG ATGCCCACGCTGTCTGATGAGGALpCDO412 GCCAAATCAGCCTGTGGCATTGGCA TTACCCAGACGGGCGCTGACCATGLpBCD880 TCATTGCAGATGTTGTTCT TCACGCGCCTGGTCAAGGTCCGCATLpCDO516 ATGCTGGGTTCTACATGAACAC GAAGTAGTGGCAGATTCTGAACT

BAC–FISH in B. distachyon 351

anthers were individually transferred onto a slide and gentlyhomogenized in a drop of 45% acetic acid. For one prep-aration, 10–20 anthers of different sizes were used. Theremainder of the procedure is the same as for somaticchromosome preparations. For high-resolution FISH map-ping, only meiotic chromosome preparations at late zygoteneand pachytene were used.DNA probes and fluorescence in situ hybridization: The

following DNA probes were used in this study:

1. DNAs isolated from BACs were labeled with digoxigenin-11-dUTP or tetramethyl-rhodamine-5-dUTP (Roche, Indianap-olis) by nick translation as described by Hasterok et al. (2002).

2. A 2.3-kb ClaI subclone of the 25S rDNA coding region ofA. thaliana (Unfried and Gruendler 1990) was labeledcombinatorially with digoxigenin-11-dUTP and tetramethyl-rhodamine-5-dUTP by nick translation and used to detect18S-5.8S-25S rDNA loci (45S rDNA).

3. Wheat clone pTa794 (Gerlach and Dyer 1980) wasamplified and labeled by PCR with digoxigenin-11-dUTPand used to detect 5S rDNA loci. The sequences of oligo-nucleotide primers and conditions for this reaction aredescribed in detail by Hasterok et al. (2004).

The FISH procedure was adopted from Hasterok et al.(2002) with some modifications described below. The generalconditions of the FISH procedure were as follows. Twokinetically different hybridization mixtures were used: (i) alow-stringency (65%) mixture consisting of inter alia 30%deionized formamide, 23 SSC, salmon sperm blocking DNAin 75–1003 excess of labeled probe and 2.5–3.0 ng/ml of eachDNA probe and (ii) a high-stringency (77%) mixture in whichthe concentration of formamide was increased to 50%. Chro-mosome preparations and denatured (80� for 10 min) hy-bridization mixtures were denatured together for 4.5 min at70� and allowed to hybridize overnight in a humid chamberat 37�. Posthybridization washes were carried out for 10 mineither in 20% deionized formamide in 23 SSC at 37� (which isequivalent to 59% stringency) or in 10% deionized formamidein 0.13 SSC at 42� (which is equivalent to 79% stringency).Lower stringency was used to localize heterologous BACclones (i.e., those from B. distachyon library) onto targets fromrelated species of Brachypodium as well as onto Triticale and

rice. Immunodetection of digoxigenated probes was per-formed according to standard protocols using FITC-conjugatedantidigoxigenin antibodies (Roche). The chromosomes weremounted and counterstained in Vectashield (Vector Lab-oratories, Burlingame, CA) containing 2.5 mg/ml of 49,6-diamidino-2-phenylindole (DAPI).

All fluorescent images were digitally captured, either usinga Hamamatsu ORCA monochromatic CCD camera attachedto a Zeiss Axioplan epifluorescence microscope and tintedusing Wasabi software or using a Hamamatsu (Bridgewater, NJ)C5810 color CCD camera attached to an Olympus Provis AXmicroscope. All images were processed uniformly and super-imposed using Micrografx (Corel) Picture Publisher software.

RESULTS

BAC library construction and quality control: Thelibrary was constructed in two separate size-selectionexperiments. A total of 9100 BAC clones were ‘‘picked’’into 96-well plates, and with an estimated average insertsize of �88 kb/clone, the coverage is of .800 Mb. Ingeneral, slightly larger inserts were observed for BACsderived from the higher-molecular-weight gel slices(size selection 2; Table 3; Figure 1) compared to thosederived from the lower-molecular-weight gel slices (sizeselection 1; Table 3). However, in the experimentswhere higher-molecular-weight gel slices of 130 kb andabove were selected, the number of colonies derived wasvery low and a high proportion of the clones containedvery short or no inserts. The library was therefore gen-erated from the region 70–130 kb.

BAC library characterization: To estimate the num-ber of clones containing repetitive DNA, the library washybridized with radioactively labeled genomic DNA ofB. distachyon. BAC clones were categorized as highly (H)or moderately repetitive (M) after hybridization to thetotal genomic DNA probe. This provided an estimate of

TABLE 2

Genetic map positions in L. perenne and rice of markers targeted by selected primers in the B. distachyonBAC library PCR screen

Chromosome and genetic map positionsa

Primers Associated marker L. perenne b Ricec B. distachyond

LpCDO580 CDO580 1 (16) 5 (24) 1–5LpCDO202 CDO202 1 (71) 5 (116) 2LpCDO36 CDO36 2 (105) 4 (89) 5CHO15851 CHO15851 2 (36)e — 5LpCDO20 CDO20 4 (86) 3 (7) 1LpCDO127 CDO127 5 (5) 11 (15) 4

12 (10)LpCDO412 CDO412 5 (19) 9 (62) 4LpBCD880 BCD880 6 (61) 2 (152) 3LpCDO516 CDO516 6 (92) 2 (102) 3

a Number in parentheses following chromosome designation indicates genetic distance in centimorgans.b Armstead et al. (2002)c Cornell RFLP 2001 map (http://www.gramene.org).d See Table 5.e I. Armstead (unpublished results).


2.9% of clones, which were measurably repetitive in thelibrary. Chloroplast contamination as measured by PCRscreening using primers for a number of chloroplastsequences was estimated as 3%.

Physical mapping of B. distachyon BACs targeted torice chromosome 6: All of the markers used in the PCRscreen described in Table 4 were targeted to a contig-uous region of �884 kb on rice chromosome 6 from2,284,490 bp (LpF1) to 3,168,414 bp (LpF4) (rice 6pseudomolecule; http://www.tigr.org; Table 4). All ofthese markers produced amplification products fromgenomic DNA derived from ABR1 and ABR5 except forB139345, which amplified only from ABR1. In addition,two other primer pairs, B29794 and B139282, failed toamplify a product from either ABR1 or ABR5 genomicDNA. The presence of a degree of conserved physicalsynteny between this region in rice and the identifiedregion(s) in B. distachyon is indicated in the results ofthis study. Of the 13 markers that could be amplified

from the BAC libraries, only 2 could not be physicallyassociated with at least one other marker. Four markers(LpC764, B29786, B29797, and LpF3) could be associ-ated in a single contiguous region spanning the equiv-alent distance of �140 kb in the rice genome and tiledby a minimum of two B. distachyon BACs (Table 4).Chromosomal mapping of BAC clones: Table 5 lists

the physical features of selected BAC clones used in thisstudy, together with their chromosomal map positionsdetermined by FISH. The majority of the clones eitherare syntenic to the region of rice chromosome 6 de-scribed in Table 4 or are selected on the basis of geneticmap position on chromosomes ofL. perenne and Triticeaespecies (Table 2).

Of 39 BAC clones, 32 hybridize in situ to single loci inthe genome of the diploid ABR1. Since all five pairs ofchromosomes are identifiable on the basis of morphol-ogy and relative size ( Jenkins et al. 2005), each of thesesingle-locus clones was assigned to individual chromo-somes. Furthermore, by cross-referencing the mappositions of these clones to those already anchored toparticular chromosome arms, it was possible to build uplinkage groups of clones for every chromosome arm ofthe complement. In this way, each arm was designated‘‘p’’ and ‘‘q’’ in the conventional way, although thesymmetry about the centromere of chromosomes 1–3precludes identification of actual long and short arms.Figure 2, A–F, shows the precision of the BAC ‘‘landing’’on 9 of 10 chromosome arms of ABR1. It is worth em-phasizing not only that coverage of all chromosomearms of the complement was achieved with �30 clonesand one additional rDNA-based landmark, but also thatthe high resolution of BAC mapping was achieved with-out customary blocking with genomic or C0t-1 DNA andis unaffected by lower stringency conditions.

Several of the BAC clones do not map to single loci,but rather occupy pericentromeric regions or ‘‘paint’’the entire chromosome complement (Table 5; Figure4G). A representation of the physical map of all clones,together with the 25S and 5S rDNA loci, is shown inFigure 2G. Because of the small size of the somaticchromosomes of this species, it is not surprising thata number of clones map to the same chromosomal

TABLE 3

General characteristics of B. distachyon BAC library

Sizeselection

Size of genomicDNA fragments

excised fromthe gel (kb) No. of clones

No. of NotItest-digested clones

Averageinsert size (kb)

Genomecoveragea

1 (ABR1) 70–100 5968 27 83.8 1.412 (ABR5) 100–130 3132 21 92.3 0.81

Total 9100 48 �88.1 2.22

a Nuclear (1C) DNA content for B. distachyon ¼ 355 Mb (Bennett and Leitch 2005).

Figure 1.—DNA from B. distachyon BAC clones was NotI re-stricted and the fragments were separated by PFGE. BACswere obtained by partial restriction of B. distachyon ABR5 ge-nomic DNA with HindIII, followed by PFGE and cloning ofthe size-separated genomic DNA from a gel slice in the regionof 100–130 kb (size selection 2 in Table 3). The average insertsize of the BAC inserts in this size selection experiment is es-timated to be 92.3 kb. M, l-ladders (New England Biolabs andRoche); V, the position of the 7.0-kb pBeloBAC11 NotI vectorfragment.


positions. Figure 3A shows two such clones colocalizingto the distal tip of chromosome 1q. However, if theresolution of mapping is enhanced through the use oflonger chromosomes at zygotene of meiosis, the two lociare clearly separable (Figure 3, B and C). A similar exam-ple of improved mapping is shown in Figure 3, D–F. Thecloser proximity of the signals in Figure 3E compared toFigure 3B probably reflects the greater degree of chro-mosome compaction at the pachytene stage of meiosis.

Table 5 shows 30 clones that were hybridized in situto chromosomes of related genotypes of Brachypodium,to Triticale, and to rice. ABR114 was originally classifiedas a cytotype of B. distachyon with 20 chromosomes(Robertson 1981). The notion that ABR114 was an auto-tetraploid was refuted by Hasterok et al. (2004) on thebasis of its unique chromosome size and morphologyand the fact that its chromosomes were not labeledby genomic DNA of ABR1. Interestingly, only 15 of theclones mapping to single loci of ABR1 map to singlesites in ABR114, albeit with relatively lower signal in-tensity. Figure 4 shows one such clone (ABR1-32-C1) thatmaps together with 5S rDNA onto one arm of chromo-some 4 of ABR1 (Figure 4A), which together map on asingle arm of a pair of unidentifiable chromosomes ofABR114 (Figure 4B). By contrast, two clones (ABR1-32-C1 and ABR5-33-F2) map to opposite arms of chromo-some 4 of ABR1 (Figure 4D), but land on two differentpairs of chromosomes of ABR114 (Figure 4E). Thecontrasting map positions of these clones in ABR1 and

ABR114 are reproduced for clarity in Figure 4, J and K,which have been assembled by extracting the relevantchromosomes from Figure 4, A, B, D, and E. The twosingle-locus clones (ABR1-41-E10 and ABR5-1-H3) thatmap to opposite arms of chromosome 2 of ABR1(Figure 2B) also land on two different pairs of chromo-somes in ABR114 (data not shown). The clone ABR1-63-E6 with a pericentromeric/dispersed distribution inABR1 has a similar but significantly less distinct distri-bution in ABR114 (Figure 4, G and H).

ABR113 (Table 5) was considered to be an autohexa-ploid form of B. distachyon until Hasterok et al. (2004)showed that it comprises two genomes of 10 and 20chromosomes, each bearing close similarity to ABR1and ABR114, respectively. The mapping data of thisstudy largely reinforce these conclusions. All the single-locus clones of ABR1 map to the same positions andwith the same intensity to the ABR1-like chromosomesof this allotetraploid. Most of the single-locus cloneshybridizing to ABR114 have counterparts in ABR113(Figure 4, C, F, J, and K). Furthermore, dispersed re-peats in ABR1, such as ABR1-63-E6, depict 10 chromo-somes in this hybrid and effectively ‘‘paint’’ one of thegenomes (Figure 4I).

Despite numerous attempts, no single-locus clone wassuccessfully hybridized to the chromosomes of eitherTriticale or rice, even under low-stringency conditions.Two dispersed, repetitive clones highlighted primarilythe centromere in Triticale only (Table 5; Figure 4L).

TABLE 4

Physical position of target sequences on rice 6 pseudomolecule

MarkerTarget sequence

TIGR locusPhysical position in rice 6

pseudomolecule (bp) B. distachyon BAC tilingc

LpF1 LOC_Os06g05150 2284490–2288493

LpF2 LOC_Os06g05890 2694461–2698473B139776 LOC_Os06g05900 2698911–2704116

LpC764 LOC_Os06g06030 2770074–2773038B29786 LOC_Os06g06090 2805657–2811851B29794a LOC_Os06g06160 2854454–2858560B29797 LOC_Os06g06190 2862463–2866679B139282a LOC_Os06g06230 2882907–2883915LpF3 LOC_Os06g06290 2907045–2909439

LpHd3a LOC_Os06g06320 2939157–2941298B87376 LOC_Os06g06370 2965770–2972191B87384 LOC_Os06g06440 3000111–3008251

B7090b LOC_Os06g06560 3078060–3085809

B139345 LOC_Os06g06730 3147016–3157356LpF4 LOC_Os06g06750 3161843–3168414

a Marker failed to amplify from B. distachyon genomic DNA.b Marker amplified from B. distachyon genomic DNA but was not detected in BAC libraries.c Vertical solid bars indicate markers spanned by a single B. distachyon BAC.


TABLE 5

Selected clones from B. distachyon ABR1/5 library used for physical mapping in chromosomes of relatedBrachypodium species, Triticale, and O. sativa

Chromosomal localization

Insertsize (kb)

No. of NotIrestriction sites

ABR1 ABR113 ABR114Clone Origin (n ¼ x ¼ 5) (n ¼ 2x ¼ 15) (n ¼ x ¼ 10)

ABR1-13-A2a 120 4 LpHd3a1–5; PC/P

NA NA(111/11)

ABR1-15-D3a 90 1 Random

1–5; PC/P 1–5; PC/Pb

(111/11) (111/11)1–10; PC/P 1–10; PC/P

(1/1) (11/1)

ABR1-41-H4c 80 3 Random

1–5; PC/P 1–5; PC/Pb

(111/11) (111/11)1–10; PC/P 1–10; PC/P

(1/1) (11/1)

ABR1-63-E4c 45 1 Random

1–5; PC/P 1–5; PC/Pb

(111/11) (111/11)1–10; PC/P 1–10; PC/P

(1/�) (11/1)

ABR1-63-E6 86 6 Random

1–5; PC/P 1–5; PC/Pb

(111/111) (111/111)1–10; PC 1–10; PC

(1) (1)

ABR1-63-E10 80 2 Random1–5; PCd /P 1–5; PC(111/1) (11)

(-) (-)

ABR5-3-H4a 93 1 LpCDO580 1–5; PCd /P NA NA


1p; INT 1p; INT

NA(111) (111)

?p/q; ST(1)

ABR1-15-F11 63 2 Random

1; PCe 1; PCe

(111) (111)?p/q; ST ?p/q; ST

(1) (1)

ABR1-15-G12 55 0 Random

1q; INT 1q; INT(111) (111)

?p; INT ?p; INT(11) (11)

ABR1-41-E4 95 4 LpF3

1q; INT 1q; INT(111) (111)

?q; INT ?q; INT(1) (1)

ABR1-43-E8 94 5B139345LpF4

1q; INT 1q; INT(111) (111)

?q; ST ?q; ST(11) (11)

ABR1-58-H2a 130 3LpHd3a

1q; INT NA NAB87376B87384

(continued )


TABLE 5

(Continued)


Insertsize (kb)



ABR1-59-F9a 135 3LpHd3a

1q; INT 1q; INT

B87376(111) (111)

(-) (-)

ABR1-26-H1a 105 2 Randomf 1q; ST NA NA

ABR1-41-A8a 85 3 LpCDO201q; ST 1q; ST(111) (111)

(-) (-)

ABR1-63-E1a 95 4 Random 1q; ST NA NA

ABR5-33-F3 106 5 Random 1q; ST NA NA

ABR1-15-B2 83 2 Random 2p; ST NA NA

ABR1-41-E10a 105 3 Randomf

2p; INT 2p; INT(111) (111)

?q; INT ?q; INT(111) (111)


2p; INT/1–5; P 2p; INT/1–5; Pb

(111/11) (111/11)?q; INT/1–10; PC ?q; INT/1–10; PC

(11/1) (11/1)


2q; INT 2q; INT(111) (111)

?p/q; INT ?p/q; INT(11) (11)

ABR1-15-H6 86 2 Random

2q; INT/1-5; P 2q; INT/1-5; Pb

(111/1) (111/1)?p/q; ST ?p/q; ST

(1) (1)

ABR1-42-H8a 45 0 LpCDO202

2q; INT 2q; INT(111) (111)

?q; INT(-)

(1)

ABR5-1-H3a 112 2 LpCDO202

2q; INT 2q; INT(111) (111)

?q; ST ?q; ST(1) (1)

ABR5-33-G4 85 1 Random 2q; INT/ST NA NA

ABR5-33-F12 130 1 Random 3p; ST NA NA

ABR1-54-D7a 74 3 LpCDO516

3q; ST 3q; ST(111) (111)

?q; ST ?q; ST(11) (11)

(continued )


DISCUSSION

This article describes the construction and exploita-tion of the first reported BAC library of B. distachyon andwe believe this to be the smallest monocot genome for

which a BAC library is available. There have beenconflicting reports of genome size in B. distachyon (e.g.,Draper et al. 2001; Bennett and Leitch 2005). Thissituation may reflect the use of nuclei from differentspecies to produce nuclear DNA content calibration

TABLE 5

(Continued)


Insertsize (kb)



ABR1-56-H6a 145 3 LpBCD880

3q; ST 3q; ST(111) (111)

?p/q; ST ?p/q; ST(11) (11)

ABR5-33-F2 114 2 Random

4p; ST 4p; ST(111) (111)

?p/q; INT ?p/q; INT(1) (1)

ABR1-32-C1a 80 3 LpCDO412

4q; ST 4q; ST(111) (111)

?; PC ?; PC(11) (11)

ABR1-47-F4a 80 1 LpCDO1274q; ST 4q; ST(111) (111)

(-) (-)

ABR1-63-E5 100 1 Random 4q; ST NA NA


4q; ST 4q; ST

NA(111) (111)

?p/q; ST(111)

ABR1-63-F2 117 3 Random4q; ST 4q; ST(111) (111)

(-) (-)

ABR5-16-G10 110 5 CHO15851

5q; INT 5q; INT(111) (111)

?q; ST(-) (1)

ABR1-19-C12a 75 3 LpCDO36 5q; ST NA NA



Localization of FISH signals in chromosomes: PC, pericentromeric; INT, inerstitial; ST, subterminal; P, paint along whole chro-mosomes. (1) and (�) represent, respectively, the presence or absence of hybridization signals: (111), strong signal; (11),intermediate signal; (1), weak signal. NA, not analyzed.

a This clone gave negative results when hybridized to Triticale and rice chromosomes.b This clone also gives a genomic in situ hybridization-like discrimination of the ABR1 from the ABR114 genome.c This clone gave positive results when hybridized to Triticale chromosomes and negative results when hybridized to rice

chromosomes.d The intensity of FISH signals near the centromeres of different chromosomes of B. distachyon ABR1 seems to vary significantly.e This clone also gives weak signals in pericentromeric regions of chromosomes 2–5 in the ABR1 genome.f This clone was selected using LpHd3a primers but found to be false positive on sequencing.


curves and, particularly, the frequent occurrence ofpolyploid nuclei in Arabidopsis is likely to have led to anunderestimate in size in our previous study (Draper

et al. 2001). Indeed, recent comparisons of mitoticmetaphase karyotypes (data not shown) suggested that

diploid (2n ¼ 2x ¼ 10) B. distachyon chromosomes weresimilar in size to those of B. sylvaticum, thus negating anysuggestion (Foote et al. 2004) that B. distachyon mayhave deleted many of the genes that would have beenfound in other grasses. The B. distachyon BAC library will

Figure 2.—Identificationof B. distachyon ABR1 (2n ¼2x ¼ 10) chromosomes bydual-color FISH with BACclones. (A) 1p, ABR1-63-E11 (red); 1q, ABR1-26-H1(green). (B) 2p, ABR1-41-E10 (green); 2q, ABR5-1-H3(red). (C) 3p, ABR5-33-F12(red); 3q, ABR1-56-H6(green). (D) 4p, ABR5-33-F2 (green); 4q, ABR5-32-C1(red). (E) Multicolor FISHwith three different BACclones and 25S rDNA(yellow): 1q (subterminal),ABR1-41-A8 (green); 1q (in-terstitial), ABR1-59-F9 (red);4q, ABR1-47-F4 (green); 5p(NOR),25SrDNA.(F)Multi-color FISH with one BACclone (red), 5S rDNA(green), and 25S rDNA (yel-low). 4q (interstitial), 5SrDNA;5p(NOR),25SrDNA;5q (subterminal), ABR1-63-E2. Color symbols in A–Edescribe the localization oflandmarks in particularchromosome arms of ABR1(p, short arm; q, long arm).(G)IdeogramofB.distachyonABR1 (n¼ 5) chromosomesshowing physical localiza-tion of all mapped BACclones and the two auxiliarylandmarks (5S and 25SrDNA). Asterisks indicatethe clones from B. distachyonABR5 library. Blue fluores-cence, DAPI. Bar, 5 mm.


therefore provide a useful tool for grass comparativegenomics to complement the existing BAC libraries ofcereal and forage grass crops, including rice (Zhanget al. 1996), bread wheat (Allouis et al. 2003), durumwheat (Cenci et al. 2003), barley (Yu et al. 2000), sor-ghum (Woo et al. 1994), maize (O’Sullivan et al. 2001;Tomkins et al. 2002), and Festuca pratensis (Donnison

et al. 2005). Moreover, our investigation illustrates therelative ease with which BAC clones can be hybridizedto single loci of the 10 chromosomes of B. distachyon. Itis not considered likely that this efficiency is due entirelyto the selection of clones on the basis of their syntenyto gene-rich regions of the genomes of rice and othermembers of the Poaceae, since 19 of the 24 clonesselected randomly from the library also ‘‘landed’’ atdiscrete loci. Rather, it is a consequence of the com-pactness and economy of the genome of B. distachyon,in which genes are not spaced out by large tracts ofrepetitive DNA as in other temperate grasses andcereals.

Clones ABR1-13-A2, ABR1-58-H2, and ABR1-59-F9were identified by three markers as having sequencessyntenic to a 69-kb section of rice chromosome 6 (Table4). The latter two of these hybridize in situ to chromo-some 1q of ABR1 (Table 5; Figure 2G). This indicatesnot only sequence conservation between rice andBrachypodium in this area, but also some degree of con-servation of relative map positions. In addition, BACclones ABR1-41-E4 and ABR1-43-E8 also colocalize withABR1-58-H2 and ABR1-59-F9 on 1q and were identifiedby markers targeted to this same region on ricechromosome 6 (Table 4). While it was not establishedthat ABR1-41-E4 and ABR1-43-E8 were directly contig-uous with ABR1-58-H2/59-F9 or with each other in B.distachyon, this does indicate that they are located inapproximately the same physical position on chromo-some 1. Clone ABR1-13-A2 did not hybridize in situ tochromosome 1q but instead highlighted pericentro-meric regions of all five chromosomes of the comple-ment. Clearly, this clone contains a repetitive elementthat confounds its map position relative to its contigs.

Another two clones, ABR1-26-H1 and ABR1-41-E10,were identified by marker LpHd3a but found to be falsepositives on sequencing. End sequencing of ABR1-26-H1 showed that it had a weak correspondence with adifferent region of the rice 6 pseudomolecule at �12Mb. Physical mapping of this clone in B. distachyonshowed it to be associated with chromosome 1q, alongwith ABR1-58-H2, ABR1-59-F9, ABR1-41-E4, and ABR1-43-E8, but located subterminally rather than interstitially(Table 5). Clone ABR1-41-E10 mapped to chromosome2p of B. distachyon ABR1 and could not be further asso-ciated with a region of the rice genome.

A previous comparative genome analysis betweenB. sylvaticum and rice using cross-hybridization of BACclones on filters concentrated on clones syntenic tochromosome 9 of rice (Foote et al. 2004). Using BAC

Figure 3.—High-resolution FISH mapping of closelylinked on mitotic metaphase preparations (A and D) pairs of B.distachyon BAC clones on B. distachyon (2n ¼ 2x ¼ 10) zygotene(B) and pachytene (E) chromosomes. (A and B) ABR1-26-H1(green) and ABR1-41-A8 (red) apparently colocalizing (yel-low) in the distal part of the long arm of chromosome pair1 at mitotic metaphase (A), while, on the zygotene chromo-somes, ABR1-41-A8 is clearly more distal than ABR1-26-H1.(D) ABR1-56-H6 (red) and ABR1-54-D7 (green) at mitoticmetaphase colocalizing (yellow) in the distal part of the longarm of chromosome pair 3 at mitotic metaphase. (E) BAC–FISH of the same clones to the pachytene chromosome re-veals that ABR1-54-D7 (green) is located more distally thanABR1-56-H6. (C and F) Diagrams showing different resolu-tion of BAC–FISH mapping on A and B and D and E. Bluefluorescence, DAPI. Bar, 5 mm.


landing as an alternative approach in B. distachyon, wehave extended this analysis and demonstrated that,excepting marker CHO15851, an STS marker mappedonly in L. perenne, the primer pairs used successfully inthe PCR screen described in Table 2 identified sequen-ces associated with RFLP markers with known mappositions on different chromosomes within L. perenne,Triticeae species, and rice. Interestingly, with the excep-tion of LpCDO580, all of the markers that mapped todifferent chromosomes in L. perenne identified BACsthat likewise hybridized to different chromosomes inB. distachyon (the BAC identified by LpCDO580 showed

nonspecific hybridization in the B. distachyon genome).Conversely, all of the markers that mapped to the samechromosome in L. perenne identified BACs that hy-bridized to the same chromosome in B. distachyon.Additionally, if the physical positions on the samechromosome in B. distachyon of the BACs identified bythe markers that map to L. perenne C5 reflect the com-plex conserved syntenic relationship seen between L.perenne C5 and rice C9/11/12, the implication is thatthere may also be conservation between B. distachyonand rice in this region (Armstead et al. 2002, 2006;Jones et al. 2002).

Figure 4.—Comparativeanalysis of (A, D, and G) B.distachyon ABR1 (2n ¼ 2x ¼10), (B, E, and H) ABR114(2n ¼ 2x ¼ 20), (C, F, andI) ABR113 (2n ¼ 4x ¼ 30),and (L) Triticale (2n ¼ 6x ¼42) genomes by FISH ofthe B. distachyon ABR1/5BAC clones. (A–C) ABR1-32-C1 (green), 5S rDNA(red). (D–F) ABR1-32-C1(green); ABR5-33-F2 (red).Color symbols on A and Ddescribe the localization oflandmarks on particularchromosome arms. (G–I)ABR1-63-E6 (green). (L)ABR1-41-H4 (green). ( Jand K) Selected chro-mosomes from putative an-cestral diploid species (B.distachyon ABR1 andABR114) and an interspe-cific hybrid (ABR113) hy-bridizing with the BACclones or a 5S ribosomalDNA probe. The chromo-somes were extracted from(A and D) B. distachyonABR1, (B and E) ABR114,and (C and F) ABR113.Bars: (A–I) 5mm; (L) 10mm.


No single-locus clone of ABR1 hybridized in situ to thechromosomes of Triticale or rice, even under conditionsof very low stringency. This is unlikely to be due in allcases to the absence of homologous sequences, sincemarkers targeted to the rice sequence identify syntenicBACs from the Brachypodium library. It is more likelythat syntenic regions in rice and Triticale are inter-spersed with genome-specific repeats that interfere withhybridization in situ. Subcloning of fragments of thelarge inserts of the BACs may be a means of circum-venting this problem. Alternatively, it might be instruc-tive to attempt a BAC ‘‘landing’’ on species that arephylogenetically more closely related to Brachypodiumthan rice, wheat, or rye, such as species of Lolium,Festuca, or Bromus. Using this approach, it may be pos-sible to define a phylogenetic distance beyond which aheterologous BAC ‘‘landing’’ becomes unprofitable.

BAC ‘‘landing’’ also enabled further investigation intothe phylogeny of the cytotypes of B. distachyon. Thehybridization of single-locus clones and rDNA probeshas confirmed that ABR114 is an unknown diploidspecies with 20 chromosomes in its own right and thatABR113 is an allotetraploid comprising two genomesthat are similar to ABR1 and ABR114. Furthermore,Figure 4, A, B, and J, shows that the 5S rDNA probe andthe clone ABR1-32-C1 mapping to the same chromo-some arm of chromosome 4 of ABR1 land on a singlepair of chromosomes in ABR114, albeit in reverseorientation to the centromere. However, by contrast,two clones (ABR1-32-C1 and ABR5-33-F2) mapping toopposite arms of chromosome 4 in ABR1 land on twodifferent pairs of chromosomes in ABR114 (Figure 4, D,E, and K). Similarly, clones ABR1-41-E10 and ABR5-1-H3 map to opposite arms of chromosome 2 of ABR1(Figure 2B) and land on two different pairs of chromo-somes in ABR114 (data not shown). Although fewclones have been compared in this way, the inferenceis that ABR1 and ABR114 may be related by multiplecentric fission/fusion events. This would be entirelyconsistent with the observation that ABR1 has 10 large,mostly metacentric chromosomes, compared with 20small, subtelocentric chromosomes of ABR114. This isnot the complete story, however. In situ hybridization ofABR114 with genomic DNA of ABR1 does not label thecomplement to any great extent (Hasterok et al. 2004).It is necessary, therefore, to invoke at least some se-quence divergence of repetitive DNA to explain theobservations.

Although the intention of this study was not toestablish a detailed alignment among the genomes ofB. distachyon, L. perenne, and rice, these data do demon-strate the potential of B. distachyon as a monocot com-parative genomics resource. Linking and calibratingsequence data and chromosome map positions at thislevel of resolution is fraught with difficulties, but maybe ameliorated by the careful selection of a small setof tiles from the BAC library and their ‘‘landing’’ on

meiotic chromosomes or extended DNA fibers. A pre-vious study (Foote et al. 2004) has suggested that B.sylvaticum, a related perennial species with a similargenome size, is also a useful ‘‘bridge’’ species in thegrasses. However, the annual, self-fertile, fast-cycling B.distachyon has many biological features to recommendit as a model for future functional genomics studies(Draper et al. 2001).

The authors acknowledge financial support from the Royal Society( Joint Project in 2001–2002 to R.H. and G.J.) and the Biotechnologyand Biological Sciences Research Council (International ScientificInterchange Scheme award to R.H. and to J.D. in 2003–2004).

LITERATURE CITED

Allouis, S., G. Moore, A. Bellec, R. Shah, P. Faivre Rampant et al.,2003 Construction and characterisation of a hexaploid wheat(Triticum aestivum L.) BAC library from the reference germplasm‘Chinese Spring.’ Cereal Res. Commun. 31: 331–338.

Aragon-Alcaide, L., T. Miller, T. Schwarzacher, S. Reader andG. Moore, 1996 A cereal centromeric sequence. Chromosoma105: 261–268.

Armstead, I. P., L. B. Turner, I. P. King, A. J. Cairns and M. O.Humphreys, 2002 Comparison and integration of geneticmaps generated from F-2 and BC1-type mapping populationsin perennial ryegrass. Plant Breed. 121: 501–507.

Armstead, I. P., J. A. Harper, L. B. Turner, L. Skot, I. P. King et al.,2006 Introgression of crown rust (Puccinia coronata) resistancefrom meadow fescue (Festuca pratensis) into Italian ryegrass(Lolium multiflorum): genetic mapping and identification of asso-ciated molecular markers. Plant Pathol. 55: 62–67.

Bablak, P., J. Draper, M. R. Davey and P. T. Lynch, 1995 Plantregeneration and micropropagation of Brachypodium distachyon.Plant Cell Tissue Organ Cult. 42: 97–107.

Bennett, M. D., and I. J. Leitch, 2005 Nuclear DNA amounts inangiosperms: progress, problems and prospects. Ann. Bot. 95:45–90.

Catalan, P., Y. Shi, L. Armstrong, J. Draper and C. A. Stace,1995 Molecular phylogeny of the grass genus BrachypodiumP-Beauv based on RFLP and RAPD analysis. Bot. J. Linn. Soc.117: 263–280.

Catalan, P., E. A. Kellogg and R. G. Olmstead, 1997 Phylogenyof Poaceae subfamily Pooideae based on chloroplast ndhF genesequences. Mol. Phylogenet. Evol. 8: 150–166.

Cenci, A., N. Chantret, X. Kong, Y. Gu, O. D. Anderson et al.,2003 Construction and characterization of a half million cloneBAC library of durum wheat (Triticum turgidum ssp. durum). Theor.Appl. Genet. 107: 931–939.

Cheng, Z., G. G. Presting, C. R. Buell, R. A. Wing and J. Jiang,2001 High-resolution pachytene chromosome mapping of bac-terial artificial chromosomes anchored by genetic markersreveals the centromere location and the distribution of geneticrecombination along chromosome 10 of rice. Genetics 157:1749–1757.

Christiansen, P., C. H. Andersen, T. Didion, M. Folling and K. K.Nielsen, 2005 A rapid and efficient transformation protocolfor the grass Brachypodium distachyon. Plant Cell Rep. 23: 751–758.

Donnison, I. S., D. M. O’Sullivan, A. Thomas, P. Canter, B. Moore

et al., 2005 Construction of a Festuca pratensis BAC library formap-based cloning in Festulolium substitution lines. Theor. Appl.Genet. 110: 846–851.

Draper, J., L. A. J. Mur, G. Jenkins, G. C. Ghosh-Biswas, P. Bablaket al., 2001 Brachypodium distachyon: a new model system forfunctional genomics in grasses. Plant Physiol. 127: 1539–1555.

Engvild, K. C., 2005 Mutagenesis of the model grass Brachypodiumdistachyon with sodium azide. Risoe-R-1510 (EN) Report, RisoeNational Laboratory, Roskilde, Denmark.

Foote, T., S. Griffiths, S. Allouis and G. Moore, 2004 Con-struction and analysis of a BAC library in the grass Brachypodiumsylvaticum: its use as a tool to bridge the gap between rice and wheatin elucidating gene content. Funct. Integr. Genomics 4: 26–33.


Gaut, B. S., 2002 Evolutionary dynamics of grass genomes. NewPhytol. 154: 15–28.

Gerlach, W. L., and T. A. Dyer, 1980 Sequence organization of therepeating units in the nucleus of wheat which contain 5S rRNAgenes. Nucleic Acids Res. 8: 4851–4865.

Hasterok, R., T. Langdon, S. Taylor and G. Jenkins, 2002 Com-binatorial labelling of DNA probes enables multicolour fluores-cence in situ hybridisation in plants. Folia Histochem. Cytobiol.40: 319–323.

Hasterok, R., J. Draper and G. Jenkins, 2004 Laying the cytotax-onomic foundations of a new model grass, Brachypodium distachyon(L.). Beauv. Chromosome Res. 12: 397–403.

Islam-Faridi, M. N., K. L. Childs, P. E. Klein, G. Hodnett, M. A.Menz et al., 2002 A molecular cytogenetic map of sorghumchromosome 1: fluorescence in situ hybridization analysis withmapped bacterial artificial chromosomes. Genetics 161: 345–353.

Jackson, S. A., Z. Cheng, M. L. Wang, H. M. Goodman and J. Jiang,2000 Comparative fluorescence in situ hybridization mappingof a 431-kb Arabidopsis thaliana bacterial artificial chromosomecontig reveals the role of chromosomal duplications in the ex-pansion of the Brassica rapa genome. Genetics 156: 833–838.

Jenkins, G., L. A. J. Mur, P. Bablak, R. Hasterok and J. Draper,2005 Prospects for functional genomics in a new model grass,pp. 305–325 in Plant Functional Genomics, edited by D. Leister.Haworth Press, Binghampton, NY.

Jiang, J., B. S. Gill, G. Wang, P. C. Ronald and D. C. Ward,1995 Metaphase and interphase fluorescence in situ hybridiza-tion mapping of the rice genome with bacterial artificial chromo-somes. Proc. Natl. Acad. Sci. USA 92: 4487–4491.

Jones, E. S., N. L. Mahoney, M. D. Hayward, I. P. Armstead, J. G.Jones et al., 2002 An enhanced molecular marker based geneticmap of perennial ryegrass (Lolium perenne) reveals comparativerelationships with other Poaceae genomes. Genome 45: 282–295.

Kellogg, E. A., 2001 Evolutionary history of the grasses. Plant Physiol.125: 1198–1205.

Kim, J.-S., K. L. Childs, M. N. Islam-Faridi, M. A. Menz, R. R. Kleinet al., 2002 Integrated karyotyping of sorghum by in situ hybrid-ization of landed BACs. Genome 45: 402–412.

Lapitan, N. L. V., S. E. Brown, W. Kennard, J. L. Stephens and D. L.Knudson, 1997 FISH physical mapping with barley BAC clones.Plant J. 11: 149–156.

Lysak, M. A., P. F. Fransz, H. B. M. Ali and I. Schubert, 2001 Chro-mosome painting in Arabidopsis thaliana. Plant J. 28: 689–697.

Lysak, M. A., A. Pecinka and I. Schubert, 2003 Recent progress inchromosome painting of Arabidopsis and related species. Chro-mosome Res. 11: 195–204.

Monna, L., X. Lin, S. Kojima, T. Sasaki and M. Yano, 2002 Geneticdissection of a genomic region for a quantitative trait locus, Hd3,into two loci, Hd3a and Hd3b, controlling heading date in rice.Theor. Appl. Genet. 104: 772–778.

Moore, G., M. Gale, N. Kurata and R. B. Flavell, 1993a Molec-ular analysis of small grain cereal genomes: current status andprospects. BioTechnology 11: 584–589.

Moore, G., S. Abbo, W. Cheung, T. Foote, M. Gale et al., 1993b Keyfeatures of a cereal genome organization as revealed by the use

of cytosine methylation-sensitive restriction endonucleases. Ge-nomics 15: 472–482.

O’Sullivan, D. M., P. J. Ripoll, M. Rodgers and K. J. Edwards,2001 A maize bacterial artificial chromosome (BAC) libraryfrom the European flint inbred line F2. Theor. Appl. Genet.103: 425–432.

Peterson, D. G., J. P. Tomkins, D. A. Frisch, R. A. Wing and A. H.Paterson, 2002 Construction of plant bacterial artificial chro-mosome library (BAC) libraries: an illustrated guide (http://www.mgel.msstate.edu/newbac.htm).

Robertson, I. H., 1981 Chromosome numbers in BrachypodiumBeauv. (Gramineae). Genetica 56: 55–60.

Routledge, A. P. M., G. Shelley, J. V. Smith, N. J. Talbot, J. Draper

et al., 2004 Magnaporthe grisea interactions with the model grassBrachypodium distachyon closely resemble those with rice (Oryzasativa). Mol. Plant Pathol. 5: 253–265.

Sambrook, J., and D. W. Russel, 2001 Molecular Cloning: A Labora-tory Manual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

Shizuya, H., B. Birren, U.-J. Kim, V. Mancino, T. Slepak et al.,1992 Cloning and stable maintenance of 300-kilobase-pair frag-ments of human DNA in Escherichia coli using an F-factor-basedvector. Proc. Natl. Acad. Sci. USA 89: 8794–8797.

Tomkins, J. P., G. Davis, D. Main, Y. Yim, N. Duru et al., 2002 Con-struction and characterization of a deep-coverage bacterial artifi-cial chromosome library for maize. Crop Sci. 42: 928–933.

Unfried, I., and P. Gruendler, 1990 Nucleotide sequence of the5.8S and 25S rRNA genes and of the internal transcribed spacersfrom Arabidopsis thaliana. Nucleic Acids Res. 18: 4011.

Woo, S.-S., J. Jiang, B. S. Gill, A. Paterson and R. A. Wing,1994 Construction and characterization of a bacterial artificialchromosome library of Sorghum bicolor. Nucleic Acids Res. 22:4922–4931.

Yu, Y., J. P. Tomkins, R. Waugh, D. A. Frisch, D. Kudrna et al.,2000 A bacterial artificial chromosome library for barley (Hor-deum vulgare L.) and the identification of clones containing pu-tative resistance genes. Theor. Appl. Genet. 101: 1093–1099.

Zhang, H. B., X. P. Zhao, X. L. Ding, A. H. Paterson and R. A. Wing,1995 Preparation of megabase-size DNA from plant nuclei.Plant J. 7: 175–184.

Zhang, H. B., S. D. Choi, S.-S. Woo, Z. K. Li and R. A. Wing,1996 Construction and characterization of two rice bacterial ar-tificial chromosome libraries from the parents of a permanentrecombinant inbred mapping population. Mol. Breed. 2: 11–24.

Zhang, P., W. Li, J. Fellers, B. Friebe and B. S. Gill, 2004a BAC-FISH in wheat identifies chromosome landmarks consistingof different types of transposable elements. Chromosoma 112:288–299.

Zhang, P., W. Li, B. Friebe and B. S. Gill, 2004b Simultaneouspainting of three genomes in hexaploid wheat by BAC-FISH.Genome 47: 979–987.

Ziolkowski, P. A., and J. Sadowski, 2002 FISH-mapping of rDNAsand Arabidopsis BACs on pachytene complements of selectedBrassicas. Genome 45: 189–197.

Communicating editor: C. Haley


alignment of the genomes of brachypodium distachyon ...genotypes, abr1 and abr5. the library...

Documents