afsor sbir phase i contract isothermal and multiplexed dna amplification protocols and their...

AFSOR SBIR Phase I ContractAFSOR SBIR Phase I Contract

Isothermal and Multiplexed Isothermal and Multiplexed DNA Amplification Protocols DNA Amplification Protocols and their Application to DNA and their Application to DNA

TaggantsTaggants

Eagle Eye, Inc. Proprietary Eagle Eye, Inc. Proprietary TechnologyTechnology

Talk by John H ReifTalk by John H ReifPresident, Eagle Eye, Inc. President, Eagle Eye, Inc.

Phone: 919-493-7978 Email: [email protected]: 919-493-7978 Email: [email protected]

Proprietary to Eagle Proprietary to Eagle Eye, Inc. Eye, Inc.

Outline of TalkOutline of Talk• Introduction to DNA Taggants

• Overview of Relevant DNA Biotechnology • DNA Taggants• Applications to Intelligence, Law Enforcement &

Customs• Prior Experimental Demonstrations of DNA Taggants:

• Design & Synthesis of DNA Taggants• Tagging Methods & Recovery • Multiplexed PCR Protocols • Prior Demonstrations of Detection of DNA

Taggants• The Current SBIR Phase I Project

• The Eagle Eye, Inc Team • Design & Synthesis of DNA Taggants• Our Isothermal PCR Protocols• Colormetric Output• Technical Challenges

•Phase II Plans • Applications to Disease Detection Assays• Partnering with Larger Biotechnology Companies

Brief Review of Relevant DNA Chemistry Brief Review of Relevant DNA Chemistry and Biotechnology.and Biotechnology.

DNA Bases and Strands:•The DNA bases are A, T, C, G. •The pairs of bases {A, T} and {C, G} are complementary. •A single strand of DNA is a sequence of DNA bases, •oriented from 5’ end to the 3’ end. •An oligonucleotide sequence lists the bases of a single stranded DNA.

DNA Synthesis: •1016 to 1017 DNA molecules synthesized in 100 nmole scale.•Can be ordered from a commercial synthesis company.

DNA Hybridization:•Two single strands of DNA, of opposite orientation and with complementary corresponding bases, can hybridize into a segment of doubly stranded DNA. •The melting temperature Tm for the doubly stranded DNA is that temperature where half of all such strands are hybridized. •Is increased by approx. 2 C for each additional A-T base pairing and increased by approx. 4 C for each C-G base pairing.

PCR amplification: •Use repeated cycles of primer extension, •each time doubling the number of selected strands

Introduction to DNA Introduction to DNA TaggantsTaggants

Taggants: any substance that can be added to an object or a surface so that the origin of such objects can be traced, or the movement monitored. Example: unique plastics added to explosive compounds to later aid identification of explosive origins.

DNA Taggants: Unique combinations of uniquely synthesized DNA that can be added to compounds or the surfaces or objects and/or personnel so that the origin of such objects can be traced, the movement monitored, or networks of interactions mapped. Since the taggants operate on a molecular level they are extremely discreet.

A set of DNA taggants working together can represent a unique molecular barcode, increasing the encoding capacity of the taggant system.

An Application of DNA Biotechnology Providing Potentially Revolutionary Improvements in Intelligence-gathering and Surveillance Capabilities.

Aerosol Dispersal of DNA TaggantsAerosol Dispersal of DNA Taggants

Hand held atomizers Aerosol Dispersal of DNA Taggant

•Illustration of Aerosol Dispersal of DNA Taggant in Open Area

http://londonfoggers.com/

TaggingTaggingMethods to apply taggants:Methods to apply taggants:

• Pipette loadingPipette loading• Aerosols (i.e. atomizers, Aerosols (i.e. atomizers,

sprays, explosions)sprays, explosions)• Contact with other tagged Contact with other tagged

objects/persons objects/persons

No toxic properties observed in studies in the literature.

Possible explanation:- large, diverse environmental DNA indicates that most DNA is nontoxic.

•Side Benefit:- diffuse quantities of environmental DNA will disguise DNA taggants.

•Literature on environmental DNA:- approximately 15 microgram of DNA is found per gram of soil.- mostly derived from living or dead bacteria

Reference:ANKE HENNE, ROLF DANIEL, RUTH A. SCHMITZ, AND GERHARD GOTTSCHALK, Construction of Environmental DNA Libraries in Escherichia coli and Screening for the Presence of Genes Conferring Utilization of 4-Hydroxybutyrate, APPLIED AND ENVIRONMENTAL MICROBIOLOGY,Sept. 1999, p. 3901–3907 Vol. 65, No. 9

Non-Toxicity of DNA Taggants:

Sample RecoverySample RecoverySamples can be collected by:

• Swabbing the surface with Swabbing the surface with a moist buccal swaba moist buccal swab

• Washing the surface w/ Washing the surface w/ water and collecting liquidwater and collecting liquid

• Sampling the surface of an Sampling the surface of an object that has come in object that has come in contact with surface in contact with surface in question.question.Our Experimental Demonstration of

Detection of DNA taggants on various surfaces:•Painted surfaces (oil and latex) •Metal•Wood•Plastic•Skin•Clothes•Money

Taggant TransferabilityTaggant Transferability

MaterialMaterial Index of Index of TransferabilityTransferability

Dollar billDollar bill .61.61

Metal, steelMetal, steel 11

Paint, oilPaint, oil .82.82

Paint, latexPaint, latex .84.84

PaperPaper .73.73

Plastic, floppy diskPlastic, floppy disk .62.62

Plastic, keyboardPlastic, keyboard .84.84

• We have compared the efficiency a surface transfers taggant by comparing a collected sample from a surface with a known amount of taggant.

• An index of these efficiencies was created to allow for comparison between surfaces.

Advantages to using Synthetic Advantages to using Synthetic DNA Sequences as Taggants:DNA Sequences as Taggants:

(1) The relative high stability of DNA(1) The relative high stability of DNA

(2) The chemical composition of DNA can be (2) The chemical composition of DNA can be readily and easily varied by varying the readily and easily varied by varying the sequence of the DNA.sequence of the DNA.

(3) Established related biotechnology:(3) Established related biotechnology: •many different short (< 100 base) strands of DNA can easily be synthesized using automated methods.

•DNA sequences can be amplified and sensitively detected using the polymerase chain reaction.

•Theoretically: a single molecule of a particular DNA sequence might be identified.•In practice: can detect as few as a dozen per sample using off-the-shelf technologies.

Potential Advantages and Potential Advantages and Applications DNA Applications DNA

TaggantsTaggantsAdvantages of DNA Taggants:• DNA Taggants themselves can exist undetected on

surfaces• Taggant dispersion can designed so that taggants

can be transferred from surfaces upon contact• The taggant is itself the amplicon and therefore

those who know the exact sequence can amplify the amount of the taggant allowing for secured detection

Example of DNA Taggant applications:• Prevent forgeries• Track origins of objects and/or people• Map networks of interactions• Authentication of objects and/or personnel• Detection of objects that have been tampered with• Anonymous and discreet communications

Intelligence Applications of DNA TaggantsIntelligence Applications of DNA TaggantsMolecular taggant systems employing a large number of molecular Molecular taggant systems employing a large number of molecular barcodes with rapid and exquisitely sensitive detection capabilities barcodes with rapid and exquisitely sensitive detection capabilities can provide potentially high impact and revolutionary improvements can provide potentially high impact and revolutionary improvements to intelligence-gathering and surveillance capabilities.to intelligence-gathering and surveillance capabilities.

Typical Scenario Application of a Molecular Taggant System Using DNA Barcodes:•Goal: utilize molecular barcodes to map contact networks without alerting suspects to the surveillance.

•Target: an organization consisting of a network of a few hundred or thousand individuals.

•Placement of DNA Taggants: covertly placed on the individuals or objects they regularly touch (e.g., documents, doorknobs of buildings and autos).

•Movement of DNA Taggants: The DNA Taggants are distributed to other individuals and places by contact with the labeled individuals or objects.

•Cycles of detection: •Provide a timely monitoring of contacts between these individuals. •After some time duration, samples would be covertly collected from suspected network members (or objects likely to be touched by them) for testing.

•Determinations:•Positive identification of a molecular barcode would indicate the necessity for further monitoring of the suspect, while negative results might release assets for monitoring other suspects.

Advantages: The monitoring of such a large number of individuals by conventional intelligence methods would be extremely costly (or impractically asset-intensive)Refinements: Several sub-areas of a contact network can be labeled with different molecular barcodes which can be distinguished from one another during analysis.

Intelligence Uses of DNA Taggant Intelligence Uses of DNA Taggant Systems:Systems:

• Verification of human assets

within organizations

• Covert determination of networks of personal contacts

• Map flow of material within and betweentargeted organizations

• Internal monitoring and barcoding of materials:

• Monitor document circulation• Monitor access to tagged objects or areas

T2

T1

Opened?

T2

T1

Top Secret Database

Computer Used?

Who Read This?

Some Example Applications of Some Example Applications of DNA Taggants to IntelligenceDNA Taggants to Intelligence

Example 1:Example 1:•DNA taggants can be introduced onto a suspected terrorist in order to follow the path or associations of the suspect. •An individual need not even be specified.•An entire area could be covered with a sequence taggant.•Everything that moved into and out of that area could be accounted for via detection of the taggant.

Example 2:Example 2:•Sequence taggants can be introduced onto an object:

•Portable computer•Diplomatic Pouch•Potential bioweapon

•Applications:• identify the provenance of that object • identify people that have come in contact with the object

Some Example Applications of Some Example Applications of DNA Taggants to IntelligenceDNA Taggants to Intelligence

Example 3:Example 3:• Agents/Objects can be coated with a known unique

taggant or barcode so the authenticity can be determined if later challened

• Authentication• Forgery Prevenation

Example 4:Example 4:• A predetermined surface or handshakes can be

used to pass along taggant-encoded messages using a molecular codebook

• Anonymous Communications• Discreet Communications

Examples of Objects On Which Examples of Objects On Which DNA TaggantsDNA Taggants May be Placed May be Placed

Adams Bennett Campbell DavisSUBJECTS:

OBJECTS:

A B C D

1 2 3 4

Demonstration of Detection of Multiple DNA Taggants:

Mapping Acquaintance Mapping Acquaintance NetworksNetworks

Label with 1 mg Label with 1 mg plasmid DNA.plasmid DNA.

DNA still detectable after serial dilution through 6 handshakes.THL, 2002

Demonstrated Examples of Use of our Gen3 DNA Taggant System:

•Computer Use Detection: detection of use of a laptop computer using two taggants: one outside and one inside

T2

T1

Top Secret Database

Computer Used?

Example Application of our Gen3 DNA Taggant System:

•Opening detection: detection of opening of a 55 Gal. drum using two taggants: one outside and one inside

T2

T1

Opened?

Demonstration of Verification of Human Assets

Using one DNA Taggant

Agent X ?

Personnel can be tagged with a specific taggant (with or without their knowledge) which can then be analyzed and their trust verified (again with or without the knowledge of the test subject).

•Gen1 DNA Taggants: [widespread use in commercial sector] • No amplification• DNA molecules used to embed fluorescent dyes for tags of authenticity

•Gen2 DNA Taggants: [Ellington]• Use PCR Amplification• Use PCR to identify single known DNA molecules• Termed “forensic taggants” in commercial sector

•Gen3 DNA Taggants: [Reif group in prior work] • Use multiplexed PCR Amplification• Simultaneously identify many known DNA molecules

•Gen4 DNA Taggants: [current SBIR] • Vastly Improved Portability: Use of Isothermal Detection Protocols• Hardened against Counter Measures: Use various methods to protect DNA taggants

Historical Overview ofHistorical Overview ofDNA Taggant TechnologyDNA Taggant Technology

Primarily used for guarding against forgery: Example: to mark sports memorabilia and other valuable objects,

Current Drawbacks:• most commercially used DNA taggants are NOT amplicons• the DNA molecules are just platforms to embed fluorescent dyes

used as tags of authenticity.

Gen1 DNA Taggants Gen1 DNA Taggants Current Commercial use of DNA Current Commercial use of DNA

Taggants Taggants - generally without Amplification- generally without Amplification

Gen2 DNA Taggants:Gen2 DNA Taggants:Pioneering Prior Work of Andrew Ellington on DNA Pioneering Prior Work of Andrew Ellington on DNA

Taggants.Taggants.•Designed and synthesized a series of random sequence libraries

- up to 1015 nucleic acid taggants.

•Assessed the amplification properties of taggants from these libraries

-used real-time PCR on the Cepheid SmartCycler,

•Developed appropriate methods and assays for amplicon taggants,- Detected down to 4 individual molecules

•Identified how well nucleic acid taggants survive:- on common surfaces: up to 23 days in the context of a plasmid- in soil: up to 14 days in the context of a plasmid,

•Identified how readily taggants can be detected in soil: - down to 100 individual molecules.

•Determined ability of taggants to be transferred between individuals:

- 1 microgram of plasmid DNA, corresponding to ca. 1011 molecules- observed detection following six serial dilutions via handshake.

We have utilized Ellington’s research on DNA taggant recovery and We have utilized Ellington’s research on DNA taggant recovery and detection and extended it to a wide variety of conditions relevant detection and extended it to a wide variety of conditions relevant to field operations.to field operations.

Our Improved DNA Taggant Technology Used: • Novel Protocols • Off-the Shelf Biotechnology• Provides Fast Detection of Large Numbers

of DNA Taggants

Typical Examples of Enhanced Capability of our Gen3 DNA Taggant System:

• Target an organization consisting of a network of a few hundred or thousand individuals

• Monitoring by conventional intelligence methods would be extremely costly (or impractically asset-intensive).

These provided high impact and revolutionary improvements to intelligence-gathering and surveillance capabilities.

Our Prior Gen3 DNA TaggantsOur Prior Gen3 DNA Taggants(DARPA/AFSOR funded 2002-(DARPA/AFSOR funded 2002-

2003)2003)

Demonstrated DNA Taggant Technology: •Developed Algorithms and Software for Design of DNA Taggants•Demonstrated DNA Taggant Detection Protocols:

•Multiplexing use of multiple frequencies•Taggant Detection for up to 16 Taggants•Taggant Detection with as few as 100 DNA taggant molecules

•Used Off-the Shelf Biotechnology: The Smart Cycler•Tested Aerosol Dispersal Methods for DNA Taggants

Demonstrated Example Uses of DNA Taggant System:

•Opening detection: detection of use of a laptop using two taggants: one outside and one inside•Authentication of a person via a DNA taggant•Combinatorial use of pairs of k=16 DNA stands to represent

k(k-1)/2 = 120 taggants•Detection of Taggant residual after sequential chaining of multiple

handshakes•Detection of DNA taggants on various surfaces: painted(oil and latex) metal, wood, plastic, skin, clothes, money.

Our Prior Gen3 DNA Taggant Project Our Prior Gen3 DNA Taggant Project ResultsResults

Our Prior Funding for Our Prior Funding for Gen3 DNA Taggants Gen3 DNA Taggants

• Previously received funding in 2002-2003 via increment of existing DARPA contract for development of Antiterrorist Technology.

• Support:• Provided for technician and reagents. • PI John Reif time donated.

Our Prior Gen3 Demonstrations Our Prior Gen3 Demonstrations ExecutedExecutedSummary: Experimental demonstrations of molecular

taggant systems using synthetic DNA strands as the taggant molecules.

Molecular Barcodes: Defined by a subset of these DNA strands types. Tasks Executed:•Designed & Synthesized over 16 individual DNA Taggants,

•defining over 120 distinguishable Molecular Barcodes(pairs)•Demonstrated local and remote aerosol dispersal of DNA Taggants•Detection of DNA Taggants: Demonstrated:

•Single and multiple taggant identification•Scalability: 120 Molecular Barcodes (pairs)•Exquisitely sensitive detection: as small as 100 molecules. •Detection of Chained Sequences of Physical Contacts•Detection on painted surfaces, metal, wood, human flesh, cloth.•Rapid Readout of results: 20 min.. •2 Frequency Multiplexing for Readout

•Demonstrated Applications to Intelligence & Law Enforcement•Identification of an Individual•Detection of the Opening of a Sealed Container•Detection of the Use of a Portable Computer•Identification of Physical Contact over a Contact Chain

Our Gen3 Synthetic DNA Taggants.Our Gen3 Synthetic DNA Taggants.Each DNA strand consists of a single stranded DNA sequence with three non-overlapping subsegments P, Q, R in the 5’ to 3’ direction:

(i) the 5’-primer segment P5’-primer segment P is a prefix subsequence of the DNA strand of approximately 20 bases. (ii) the 3’-primer segment R3’-primer segment R is a suffix subsequence of the DNA strand with the same length. P and R are used as the primer sites for PCR amplification,

(iii) the probe sequence Qprobe sequence Q is the remaining middle sequence of the DNA strand.Q is used for annealing with fluorescent probes (TaqMan™ or molecular beacons) to specifically determine the success of the amplification and/or the probe melting temperature.

In our initial demonstration of a taggant system with N=64 molecular barcodes, we represented each molecular barcode by a set of four distinct DNA strand types: (i) one distinct DNA strand type will be used for protocols A or A*, and (ii) three DNA strand types will be used for protocols B or B*.

5’ 3’

Primer P Probe Q Primer R

DNA components of DNA components of Prior Gen3 DNA Taggant Prior Gen3 DNA Taggant

systemsystem

pi qi ri

Barcode strand

Probe Reverse Primer

Forward Primer

pi

qi

_ri

_

Biotechnology Overview:Biotechnology Overview:Commercial Molecular Probe systemsCommercial Molecular Probe systems The fluorescent signal is proportional to the The fluorescent signal is proportional to the

number of amplicons.number of amplicons.

•TaqMan™TaqMan™ Taq DNA polymerase is used to cleave hybridized probes, separating the reporter from the quencher, resulting in a fluorescent signal that is proportional to the number of amplicons.

•Molecular Beacons:Molecular Beacons:Uses a method based on secondary structure for separating the reporter from the quencher, and again results in a fluorescent signal proportional to the number of amplicons.

•Intercalating dye such as SYBR Green™:Intercalating dye such as SYBR Green™: •A non-sequence dependent dye that binds specifically to doubly stranded DNA, yielding an increase in fluorescence as the amount of PCR product increases.

Biotechnology Overview:Biotechnology Overview: Fluorophore and Quencher:Fluorophore and Quencher:

1.1. In order to monitor PCR reactions, In order to monitor PCR reactions, molecular beacons should be designed molecular beacons should be designed so that they are able to hybridize to so that they are able to hybridize to their targets at the annealing their targets at the annealing temperature of the PCR, whereas the temperature of the PCR, whereas the free molecular beacons should stay free molecular beacons should stay closed and be nonfluorescent at these closed and be nonfluorescent at these temperatures. Numerous fluorophores temperatures. Numerous fluorophores and quenchers are available.and quenchers are available.

Biotechnology Overview:Biotechnology Overview: FRET ProbesFRET Probes

Quencher Fluorophore

Bind toComplement

Unbound Probe - Without available complementary strand to bind to, probes are held in a hairpin with fluorophore near quencher. Signal is low.

Bound Probe - When bound to complementary strand probe extends and quencher is removed from region of fluorophore. Signal is greatly enhanced.

Biotechnology Overview:Biotechnology Overview: Molecular BeaconsMolecular Beacons

1.1. Choice of Choice of Fluorophore and Fluorophore and QuencherQuencher

2.2. Design of Stem Design of Stem SequenceSequence

3.3. Check StructureCheck Structure

Quencher Fluorophore

Bind toComplement

Quencher FluorophoreQuencher Fluorophore

Bind toComplement

http://www.molecular-beacons.org/http://www.molecular-beacons.org/protocol.html#cap7protocol.html#cap7

Biotechnology Overview:Biotechnology Overview: The Cepheid The Cepheid SmartCycler™ System used by Our SmartCycler™ System used by Our Gen3 DNA Gen3 DNA Taggant Taggant detection systemdetection system URL: http://www.cepheid.com/pages/products.html

Has 16 reaction wells where biochemical operations can be Has 16 reaction wells where biochemical operations can be executed independently. Capabilities at each reaction well:executed independently. Capabilities at each reaction well: • It can amplify DNA stands containing specified primer sites, using a sequence of PCR cycles that are determined by a computer controller, and with a total amplification time required to yield readily detectable product (amplicon) of approximately 40 minutes.

• It has an optical readout capability at four standard wavelengths used by fluorescent probes.

• Can quantify levels of amplicons products in the sample for up to four possible products per reaction well.

• It also has a capability to determine the melting temperature of the product duplex DNA.

• Available as a ‘hardened’ machine that can survive in the field.

Ruggedized Advance Pathogen Identification Device (R.A.P.I.D System) by Idaho Technologies (URL: http://www.idahotech.com/) has similar capabilities.

Advanced Technology Advanced Technology

for Rapid for Rapid

Real Time PCRReal Time PCR

Brian J. Wendelburg, CepheidBrian J. Wendelburg, Cepheid

Biotechnology Overview:Biotechnology Overview:

The Cepheid The Cepheid Smart CyclerSmart Cycler®®

SystemSystem

Biotechnology Overview:Biotechnology Overview: AnalysisAnalysis• Once the samples have been Once the samples have been

collected, they were probed for any collected, they were probed for any known DNA taggant.known DNA taggant.

• Detection was achieved by selectively Detection was achieved by selectively amplifying suspected DNA taggants, amplifying suspected DNA taggants, through the use of PCR.through the use of PCR.

Our Prior Experimental Demonstrations Our Prior Experimental Demonstrations of of

Gen3 DNA Taggants: Gen3 DNA Taggants: DNA Molecular Barcodes With Rapid DNA Molecular Barcodes With Rapid

Detection.Detection.Experimentally Demonstrated fast and Experimentally Demonstrated fast and exquisitely sensitive DNA taggant detection exquisitely sensitive DNA taggant detection methodologies at a Usable Moderate Scale:methodologies at a Usable Moderate Scale:

• Demonstrated our novel molecular barcode system with:

- very rapid and exquisitely sensitive detection capabilities.- 40 minutes for 64 molecular barcodes

• Used compact, stand-alone, off-the-shelf commercial hardware: - the Cepheid SmartCycler™ system

Our Gen3 DNA Molecular Barcodes.

Our enhanced molecular taggant systems operates as follows:

(a) First, various distinct types of DNA taggant molecules are designed and synthesized.

(b) A large number of molecular barcodes are then defined, where each molecular barcode is identified by a subset of the possible types of these taggant molecules.

(c) Finally, they provide a capability for rapid and exquisitely sensitive identification of what distinct molecular barcodes are found in a given sample by determination of which taggant molecules are present.

Capabilities for Our Prior Gen3 Capabilities for Our Prior Gen3 DNA Taggant System: DNA Taggant System:

(i) a relative stable tag chemistry (allowing persistence of the molecular tags for considerable periods of time),

(ii) a method for synthesis of very large numbers - say, over 1015 – copies of each type of tag molecule,

(iii) a method for exquisitely sensitive and very rapid detection of molecular tags, as few as a hundred molecules detected in less than an hour,

(iv) an apparatus for molecular tag detection that is transportable, compact, low power and easily operated,

(v) it is difficult for an outside observer to detect the use of taggant surveillance,

(vi) and easily scalable to large numbers of molecular barcodes.

Overview of our Prior Gen3 DNA Gen3 DNA Taggant Taggant Detection Protocols.

Detection Protocol A:Detection Protocol A:•Used for determination of all possible N molecular barcodes that are present in a sample. •Uses a single unique DNA strand for each of the N molecular barcodes, and so a total of N distinct synthesized DNA strands. •Requires N reaction wells of the Cepheid SmartCycler™ system.

Improved protocol A*:Improved protocol A*:•Reduces the required number of reaction wells to N/4. •For N=64, the 16 reaction wells of the Cepheid SmartCycler™ system suffice to execute protocol A* for a given sample.

Detection Protocol B:Detection Protocol B:•More efficient detection protocols for discrimination of the molecular barcode in the special (but often occurring) case where at most one molecular barcode is present in the sample. •Requires log4(N) distinct types of DNA strands for each molecular barcode. •Makes redundant use of the additional types of DNA strands•Only a total of 4log4(N) additional types of DNA strands are required for all the molecular barcodes. •Uses 3 reaction wells per sample.

Improved Protocol B*:Improved Protocol B*:•Makes even more efficient use of the Cepheid SmartCycler™ system, •Use only one reaction well per sample. •Can processes up to 16 distinct samples at the same time on a single Cepheid SmartCycler™ system, using its 16 reaction wells.

Requirements for Protocols A* and B*:Requirements for Protocols A* and B*:•Only use a single Cepheid SmartCycler™system.•No other auxiliary steps or equipment are required.•Protocols take at most 40 minutes to execute.

Our Prior Gen3 DNA Our Prior Gen3 DNA

Detection ProtocolsDetection Protocols A: Barcode = 1 strand. A: Barcode = 1 strand.

N probes. N reactions.N probes. N reactions.

A*: Barcode = 1 strand.A*: Barcode = 1 strand. N/4 primer pairs. N/4 reactions.N/4 primer pairs. N/4 reactions. Probe differentiation via 4 dye types.Probe differentiation via 4 dye types.

B: Barcode = multiple strands (4).B: Barcode = multiple strands (4). loglog44(N) reactions.(N) reactions. Identify by 4 distinct melting temps. (TIdentify by 4 distinct melting temps. (Tmm))

B*: Barcode = multiple strands (4).B*: Barcode = multiple strands (4). 1 reaction.1 reaction. Identify probe by TIdentify probe by Tmm and dye type. and dye type.

Our Prior Gen3 DNA Taggant System:Our Prior Gen3 DNA Taggant System: Protocol BProtocol BMultiple Barcode Strands With Same Primer Multiple Barcode Strands With Same Primer Pairs Detected by Distinct Melting Pairs Detected by Distinct Melting TemperaturesTemperatures

p1

q1

r1

Barcode strand

Reverse PrimerForward Primer

p1

r1

_

q2

q4

q3

Strands q1 - q4 are distinguished from one another by:

melting temperature. THL, 2002

Our Prior Gen3 DNA Taggant Our Prior Gen3 DNA Taggant System:System:

Multiple fluorescent dyes Multiple fluorescent dyes allow simultaneous detection by multiple allow simultaneous detection by multiple

probesprobes

THL, 2002

Our Prior Gen3 DNA Our Prior Gen3 DNA Taggant Capabilities & Taggant Capabilities &

ConclusionsConclusions• Demonstrated Semi-automatic Design of DNA Taggants: requires a few hours by specialized personnel using our software

• Demonstrated Detection:• Detection of 64 DNA Taggants demonstrated• 120 Molecular Barcodes (pairs) also demonstrated• Demonstrated exquisitely sensitive detection• Demonstrated robust to many surfaces

• Conclusions:• Many applications key to intelligence and law

enforcement can apply our DNA taggant technology as current scale.

• Further scaling will also be of use for certain large scale applications

Current Phase I SBIR Technical Current Phase I SBIR Technical MilestonesMilestones

• Improved Algorithms and Software for taggant design.• Refinement of software to provide improved predictability and

decreased design time for diverse taggant systems to provide operational demonstrations in the field.

• Develop software to interface with hardware to provide output analysis and advanced taggant design software through more developmental iterations.

• Experimentally Demonstrate a Portable DNA Taggant system.• Develop further multiplexing capabilities and increase scale. • Careful refinement of system to enhance detection and specificity.

• Demonstration of Applications• Careful testing to provide evaluation of operational

characteristics in a variety of environmental settings.• Development of more application protocols to increase field

capabilities of taggants.

Proprietary to Eagle Proprietary to Eagle Eye, Inc.Eye, Inc.

Phase I SBIR TasksPhase I SBIR Tasks

• Task 1a : Experimental Demonstrations of Molecular Barcodes With Task 1a : Experimental Demonstrations of Molecular Barcodes With Rapid DetectionRapid Detection

• demonstrate fast and exquisitely sensitive taggant detection demonstrate fast and exquisitely sensitive taggant detection methodologies methodologies

• a series of experimental demonstrations of increasing scale. a series of experimental demonstrations of increasing scale.

• Task 1b: Improvements to Provide Enhanced Performance of the Molecular Barcode Taggant System:

• Sequence Design Improvements. • Use of improved probes for Detection. • Improved Multiplexing. • Environmental Surface Testing and Optimization.


Phase I SBIR Tasks, ContinuedPhase I SBIR Tasks, Continued

• Task 2a: Investigation of Hardened TaggantsTask 2a: Investigation of Hardened Taggants

• for limiting unintended environmental degradation of DNA for limiting unintended environmental degradation of DNA Taggants Taggants

• Possible Hardened Taggants to be investigated include: Possible Hardened Taggants to be investigated include:

• amplicon taggants with terminal modifications, altered amplicon taggants with terminal modifications, altered backbone chemistry, cyclization, and secondary structure backbone chemistry, cyclization, and secondary structure formation.formation.

• Task 2b: Avoidance of Detection.Task 2b: Avoidance of Detection.

• The methods being investigated include: The methods being investigated include:

• burying the primer binding sites in secondary structure, burying the primer binding sites in secondary structure,

• masking the ends by cyclization, masking the ends by cyclization,

• the use of non-standard residues, and the use of non-standard residues, and

• use of oligonucleotide (as opposed to amplicon) taggants.use of oligonucleotide (as opposed to amplicon) taggants.


Phase I SBIR Tasks, ContinuedPhase I SBIR Tasks, Continued

Task 3: Experimental Methods for Taggant Dispersal and CaptureTask 3: Experimental Methods for Taggant Dispersal and Capture

We are making a comprehensive series of experiments to gauge We are making a comprehensive series of experiments to gauge the utility of our various proposed new taggants for field, the utility of our various proposed new taggants for field, and will take the following steps in this experimental testing and will take the following steps in this experimental testing effort: effort:

• taggant dispersal, taggant dispersal,

• capture of amplicon taggants, and capture of amplicon taggants, and

• detection of oligonucleotide taggants. detection of oligonucleotide taggants.

• Task 4: Improved Portability of the Detection Apparatus.Task 4: Improved Portability of the Detection Apparatus. • We are testing two new isothermal detection assays:We are testing two new isothermal detection assays:

• A method using enzymes

• An enzyme free method


Personnel: SBIR Project ManagementPersonnel: SBIR Project Management

John Reif, Ph.D, Applied Mathematics and Computer Science•President of Eagle Eye, Inc. (also Professor of Computer Science, Duke University) •Other Current Related Research: DNA computing and DNA Nanostructures.•Responsibilities: Overall project co-ordination and management responsibilities.•URL: http://www.cs.duke.edu/~reif/ •Designer of the DNA taggant detection protocols and isothermal PCR protocol.

•design of the detection apparatus and•software for optimized design of DNA tag sequence

PI: Scott Norton, Ph.D, Optical Science•6 years industrial experience in biomedical instrumentation design, specifically in the areas of fluorescent-based assays using nanobarcode particles•Responsibilities: Project Principal Investigator


Project Personnel: Senior PersonnelProject Personnel: Senior PersonnelThomas LaBean, Ph.D, Biochemistry

•Research Assistant Professor, Duke University•URL: http://www.cs.duke.edu/~thl/•Expertise in Biochemistry •Responsibilities: Sequence design and optimization of the DNA taggants and DNA detection protocols.

Hao Yan, Ph.D, Chemistry•Assistant Professor, University of Arizona•URL: http://www.cs.duke.edu/~hy1/•Expertise in experimental DNA protocals•Responsibilities: Experimental Demonstration of Isothermal DNA Amplification protocol using enzymes

Peng Yin, Masters, Biochemistry•Design of Enzme-free DNA detection Assay•Developed software for optimized design of DNA tag sequences.

Amy Murtha, MD•Assistant Professor, Duke Medical School•Expertise in DNA detection assays and medical applications•Responsibilities: oversee Experimental Testing of DNA detection protocols.


Project Personnel: Biochemistry Lab AssistantsProject Personnel: Biochemistry Lab Assistants

Responsibilities: Experimental Demonstration of Isothermal DNA Amplification protocol

Bryan Yonish Senior Lab Technician

Natalie Sidberry-Johnson

Liping Feng


Additional Affiliated PersonnelAdditional Affiliated Personnel

Anne Lazarides, (technical assistance)•Assistant Professor, Duke Department of Mechanical Engineering & Material Science•Expertise in Colormetric Detection Methods


Multidisciplinary Expertise Required Multidisciplinary Expertise Required by Project:by Project:

• Biochemistry Techniques: e.g. PCR, Optimization of Enzymic & DNA hybridization Reactions, fluorescent and colormetric readout techniques

• Newly emerging Biotechnologies: e.g. fluorescent dyes & readers; portable fluorescent reader devices

• Software, Mathematics, and Statistics:

- algorithms and software for combinatorial design of large synthetic DNA libraries developed by the DNA computing community

- statistical software used to determine taggant detection and error analysis


Eagle Eye’s Isothermal DNA Detection AssaysEagle Eye’s Isothermal DNA Detection Assays

54

• Goal: Ready to use kit to detect trace amount of specific DNA or RNA strand

Detection Detection AssayAssay


5555

Eagle Eye’s Eagle Eye’s Isothermal First DNA Detection Assay using Isothermal First DNA Detection Assay using Enzymes: Enzymes: Our Exponential Amplification Rolling Circle Our Exponential Amplification Rolling Circle Assay Assay

SummarySummary• Input:

- one primer strand

- an exponential number of circle strands

- an exponential number of assisting strands

• Output:

- an exponential number of primer strands

• Time: liner time

• Methylation protection of circle strands to prevent them from getting digested by endonuclease


5656Eagle Eye’s Exponential Amplification Rolling Eagle Eye’s Exponential Amplification Rolling Circle Assay Circle Assay

Circle strand

Primer strand

(to be detected)

Enzyme restriction site



Primer strand anneals to circle strand and initiates polymerization



Assisting strands annealed to

Assisting strand

Enzyme cleavage !



Primer strands number multiplied in one round


6060

Experimental demonstrationExperimental demonstration

• Restriction enzyme: Aci I

• Polymerase: Phi-29 polymerase

• DNA strands:

- Circle strand: 78 nt, with two restriction site, protected by CpG methylation

- Primer strand: 28 nt

- Assisting strand: 16 nt

Eagle Eye’s Exponential Amplification Rolling Eagle Eye’s Exponential Amplification Rolling Circle Assay Circle Assay


6161

DNA strands:

Set 1

Set 2

Experimental demonstrationExperimental demonstration

Eagle Eye’s Exponential Amplification Rolling Eagle Eye’s Exponential Amplification Rolling Circle Assay Circle Assay


Eagle Eye’s New Enzyme Free DNA Detection Assay:

using DNA Nanostructures for

Exponential Signal AmplificationJohn H Reif and Peng Yin

Eagle Eye Inc


Eagle Eye’s New Enzyme Free DNA Detection Assay:using DNA Nanostructures for Exponential Signal Amplification


A + B is stable

Eagle Eye’s New Enzyme Free DNA Detection Assay


Introduction of I initialize exponential amplification

To be detected



Reactions

Initialization:

I + A __> I.A

I.A + B __> I + A.B

Amplification:

A.B + A __> A.B.A

A.B.A + B __> 2A.B



Initialization Step 1: A + I __> I.A

+



Initialization Step 2: I.A + B __> A.B + I

+

+



Initialization: I + A + B __> I + A.B

+

+

+



Initialization: I + A + B __> I + A.B

+

+

I



Replication Step 1: A.B + A __> A.B.A

+



Replication Step 2: A.B.A + B __> 2A.B

+

+



Replication : A.B + A + B __> 2A.B

+

+

+



Exponential DNA Detection I

A.B

A.B A.B

I

A.B A.B

A.B I

A.B A.B A.B A.B A.B I

2T amplification of input stand I = ab after T stages.

T stages

Eagle Eye’s New Enzyme Free DNA Detection Assay:


Experimental demonstration• Sequence design:

Strand I: 20 bases

CGCTCGCTAGGTTGAAGTCA

Strand A: 103 bases

ATGCAATGAGGGCATAAGCATCTCTGGCCCTCATTGCATTGACTTCAACCTAGCGAGCGAACGTGCCAATTCTGATCTACTGTGTGGTAAACGCTCGCTAGGT

Strand B: 135 bases

TCCGCGACGATTCATAAGCATCTCTGGAATCGTCGCGGATTTACCACACAGTAGATCAGAATTGGCACGTTCGCTCGCTAGGTTGAAGTCAAACGTGCCAATTCGCTCGCTAGGTTGAAGTCACTGATCTACTGT

• Native gel electrophoresis

• FRET detection TAMRA

TET

Quenched Fluorescence



7676Error reduction by logic AND operation using FRET Error reduction by logic AND operation using FRET FlourescenceFlourescence

TAMRATET

Quenched

Fluorescence

Only when both strands Only when both strands aa ANDAND bb are displaced can fluorescence are displaced can fluorescence be detected !be detected !


7777

TAMRATETQuenched

Fluorescence

Only when Only when aa ANDAND b b ANDAND c c ANDAND d d are displaced can are displaced can fluorescence be detected !fluorescence be detected !

Error reduction by logic AND operation using FRET Error reduction by logic AND operation using FRET FlourescenceFlourescence


Nanosphere's Colorimetric Assay (Chad A. Mirkin)•Nanoparticle probes appear red when suspended in solution

•Turn blue if a complementary DNA target is present in the sample. •Red to blue color change provides a yes/no answer to the presence of a specific DNA target.•Avoids need for fluorescent, chemiluminescent, radioactive or electrochemical methods.

http://www.nanosphere-inc.com/2_tech/1_nanoprobes.html

Elghanian, R.; Storhoff, J. J.; Mucic, R. C.; Letsinger, R. L.; Mirkin, C. A. Selective Colorimetric Detection of Polynucleotides Based on the Distance-Dependent Optical Properties of Gold Nanoparticles, Science, 1997, 277, 1078-1080.

Storhoff, J. J.; Elghanian, R.; Mucic, R. C.; Mirkin, C. A.; Letsinger, R. L. One-Pot Colorimetric Differentiation of Polynucleotides with Single Base Imperfections Using Gold Nanoparticle Probes, J. Am. Chem. Soc., 1998, 120, 1959-1964.

AND Colorimetric Assay

• Nanoparticle probes appear red when suspended in solution

• Turn blue if a chain of k complementary DNA targets are present in the sample.

• Red to blue color change provides a yes/no answer to the presence of a SET of k specific DNA targets.

Applications of AND Assay:• Reduces rate of FALSE POSITIVES from to k for DNA

and RNA detection assays. • Allow efficient of small number of DNA sequences to

represent many possible Taggants:• first synthesize 2k distinct DNA sequences • use k of these DNA sequences to represent a single

Taggant • allows use of 2k Taggants possible


Further Technical Challenges for Use of DNA Further Technical Challenges for Use of DNA Taggants:Taggants:

Two Significant Challenges To Use of DNA Taggants in Two Significant Challenges To Use of DNA Taggants in Surveillance Applications:Surveillance Applications:

(a) Degradation of taggants through harsh environmental conditions.

(b) Avoidance of detection through deliberate environmental flooding with DNA sequences designed to mask the signal of detected taggants.

A number of methods for overcoming both of these A number of methods for overcoming both of these obstacles are to be investigated: obstacles are to be investigated: Possible enhancement of Possible enhancement of molecular taggant systems:molecular taggant systems:

•Generally assumed that sequence taggants will be recovered and amplified. •But a sequence taggant could directly trigger a collector or sensor; for example, a single-stranded DNA taggant could activate a molecular beacon.

Further Development of Gen4 DNA Taggant Further Development of Gen4 DNA Taggant Systems:Systems:

Further Obstacles to Be OvercomeFurther Obstacles to Be OvercomeThe use of DNA taggants in surveillance applications faces two significant obstacles:

•degradation of taggants through harsh environmental conditions•apprehension of taggants by an adversary.

To the extent that an adversary can find or identify a taggant, they can potentially destroy, obscure, or even counter the information represented by the taggant.

(A)“Hardened” Taggants:(A)“Hardened” Taggants: Methods for limiting unintended environmental degradation of DNA Taggants

• amplicon taggants with terminal modifications, • altered backbone chemistry, • cyclization, and • secondary structure formation.

(B) Avoidance of Detection:(B) Avoidance of Detection:Methods for avoidance of detection of DNA taggants which we will investigate are:

• burying the primer binding sites in secondary structure, • masking the ends by cyclization, •use of non-standard residues, and • use of oligonucleotide (as opposed to amplicon) taggants.

Related Research in DNA–based steganography (Carter Bancroft & John Reif):

•Carter Bancroft: Use obscuring DNA for avoidance of detection•John Reif: Counter-methods for DNA–based steganography

Counter-Measures for Molecular Counter-Measures for Molecular Taggant TechnologiesTaggant Technologies

Various ways to detect and defeat molecular taggant technology.

=> Will result in methods that would detect and defeat hostile use of molecular taggant technology against US interests.

Knowing what sorts of methods can be developed and are effective:

=> can "harden" implementation of molecular taggant technology against hostile efforts to detect and defeat the molecular taggants to be developed.

Counter-Measures for Counter-Measures for Molecular Taggant Molecular Taggant

technologiestechnologies• Intentional taggant destruction:

• Acid-Base• Nuclease• Radiation

• Intentional taggant masking:• Application of taggant analogues to

overwhelm signal from suspected surveillance taggant (but requires knowledge of primer binding sequences to be effective)

Methods to Detect and Methods to Detect and Identify Unknown DNA Identify Unknown DNA

TaggantsTaggants• Direct analysis of suspected taggant

sample by mass spectrometry• Sequence analysis by exonucleolytic

cleavage• Amplification and sequencing by

ligation of foreign primer binding sites to taggant termini

• Detection by hybridization to sequencing arrays

Detection and Amplification Detection and Amplification of Unknown DNA Taggants of Unknown DNA Taggants

by Primer Ligationby Primer Ligation

Primer O

Primer S’

Tailing and/or ligation of synthetic primer binding sites to unknown taggant

Amplification and sequencing using new primer binding sites

PQ R

O

S

DJK, 2002

Hardening DNA Taggants Hardening DNA Taggants Against Unintended Against Unintended Sequence DetectionSequence Detection

• Use of non-standard bases:Use of non-standard bases: defeats defeats hybridization analysishybridization analysis

• Use of non-standard backbones:Use of non-standard backbones: (eg. PNAs): (eg. PNAs): defeats standard chemical analysis and defeats standard chemical analysis and intentional degradationintentional degradation

• Cyclization:Cyclization: defeats exonucleolytic defeats exonucleolytic sequencing and primer binding site ligation; sequencing and primer binding site ligation; also increases stability and residence time.also increases stability and residence time.

• Primer binding site masking:Primer binding site masking: defeats defeats detection and amplification by random detection and amplification by random primer sets.primer sets. DJK, 2002

Hardening DNA Hardening DNA Taggants:Taggants:

Cyclization of TaggantsCyclization of Taggants5’-P-OH OH-3’

DNA Ligase

Site P Site RSite RSite P

DJK, 2002

Hardening DNA Hardening DNA Taggants: Masking of Taggants: Masking of

primer binding sites by primer binding sites by secondary structuresecondary structure

PQ R

Primer P

Primer R’

Heat,Denaturants,Optimized Primer Mixes

DJK, 2002

(a) Time Stamped DNA Taggants:(a) Time Stamped DNA Taggants:•Label some sites or objects with specifically destabilized DNA taggant whose known rate of degradation could act as a type of time-stamp.

•The longer the DNA has been exposed to environmental degradation, the shorter the length of taggant template remaining for amplification.

•Strands could be specifically destabilized on one end of the strand or at incremental points along the length of the strand.

•Another possible degradation time-stamp: monitor the ratio of two strands, one composed of RNA and one of DNA.

•RNA is more susceptible to hydrolysis than DNA, so the longer a taggant is exposed the lower would be the RNA/DNA ratio.

(b) Triggering Sensors:(b) Triggering Sensors:•Enhancement of molecular taggant systems

•A sequence taggant could directly trigger a collector or sensor;

•Example: a single-stranded DNA taggant could activate a molecular beacon.

Further Improvements to Molecular Taggant TechnologyFurther Improvements to Molecular Taggant Technology

JHR & THL, 2002

Summary of Major Phase I Summary of Major Phase I SBIR Results to DateSBIR Results to Date

Major Breakthrough (Proprietary to Eagle Eye, Inc)• The current SBIR project has developed an assay

for detection of a given segment of DNA or RNA. • Our detection assay is novel - it makes use of self-

assembling DNA nanostructures and uses no enzymes.

• But like PCR, our detection assay is exquisite sensitive, requiring only a dozen or so DNA strands in the sample for detection.

Advantages over conventional PCR:• The assay requires no additional apparatus, so is highly compact and transportable - it requires only a small dipstick. •It is isothermal, requiring no temperature cycling, so requires no thermal cycling apparatus.- It uses no enzymes, so no there is no need for refrigeration.•The results are indicated visually by a color transition detectable by the human eye, requiring no detection apparatus.


Comparison with Other DNA Amplification Comparison with Other DNA Amplification SystemsSystems

LCR Detection(Abbott Labs): Uses Thermal Cycling with antibody-antigen reaction to detect ligated probes using fluorescent labels.

TMA Detection(GEN-PROBE): Uses Thermal Cycling with Polymerase & Reverse Transcriptase for Amplificatipon

SDA Detection(BD Tech): Isothemal. Uses Polymerase in Amplification

Phase II PlansPhase II Plans• Our Overall Phase II goal will be to demonstrate a prototype DNA Taggant Detection/BooeanEvaluation system using an isothermal biochemical protocol using no external control or changes.

• The detection portion of the system will be able to detect very small amounts of multiple distinct DNA strands.

• The BooeanEvaluation portion of the system will evaluate a Boolean formula whose Boolean variables each indicate the presence or absent of particular DNA strands.

• The response of the detection/BooeanEvaluation system will be detectable by visually detectable color change.

•The BooeanEvaluation capability of the system will allow for significant decrease of false positives, the scaling to large number of Taggants, and additional applications:

• watermarking• authentication, and• transduction and information extraction from DNA

computations to detectable outputs.• Expected customers for the Taggant detection system are the military, intelligence agencies, customs and police forces.•The demonstrations will be in a realistic working environments that would be encountered in practice by these customers.•The project will also include development of software design tools for the Taggants and detection methods.Proprietary to Eagle Proprietary to Eagle Eye, Inc.Eye, Inc.

Potential Customers of DNA Potential Customers of DNA TaggantsTaggants(1) Federal Intelligence and Law Enforcement Agencies:

CIA, FBI, DoE, and Homeland Security (Customs & Secret Service),

as well internal security branches of other Federal agencies that deal with sensitive material,

(2) Armed Forces (Military Intelligence groups within branches of Armed Forces).

(3) State and Local Police,(4) Commercial manufacturersSpecific Markets & CustomersSpecific Markets & Customers

• Material distribution and administration systems:• the US Armed Forces and • commercial manufactures of copyrighted goods,

• Tamper detection systems ; potential customers: • Dept Homeland Security & the Armed Forces, • shipping and pharmaceutical companies,

• Intelligence: CIA, FBI, Secret Service, military intelligence.Proprietary to Eagle Proprietary to Eagle Eye, Inc.Eye, Inc.

Potential Phase II Company Potential Phase II Company PartnersPartners•

•Geomet Industries, Arlington, VA. (Hank) Contact Person: Henrietta Kulaga. Intestered in applications to Taggants and bioagent detection.

•Nanosphere Technologies, Northbrook, IL. (founded by Chad Mirkin). They market colormetric spot assays using nanostructures. Contact persons: founder Chad Mirkin and Uwe Muller, VP who is visiting Eagle Eye Nov 11 to discuss possible joint venture and partnering for both Taggants and disease detection.

•Syngenta, RTP Office, NC. Janis McFarland, Ago Bussiness Manager in discussions with Eagle Eye about applications for both Ago Taggants and disease detection.

• BD (Beck and Dickerson) Technologies, RTP Office, NC. Prior meeting with Eagle Eye in July, 2004. Currently in discussions with Eagle Eye about possible joint venture and partnering for both Taggants and disease detection. Contact person: Detection demo to be done in November.

•Glaxo-Smith-Kline, RTP, NC. Contact person: Tadataka (Tachi) Yamada, Chairman, Research and Development.


Potential Phase II Institutional Potential Phase II Institutional PartnersPartners

•NC Biotechnology Center, RTP, NC. They partner with emerging NC small biotech companies. Contact person: Ken Tindell, Senior VP, Science and Business Development to meet with Reif.

•Virginia Institute of Forensic Science and Medicine, Richamond, VI. They partner with emerging small companies developing products for police and federal law enforcement agencies. •Department of Homeland Security, Homeland Security Institute/Threats Division, Arlington, VA. They may partner with us on portable Taggant technology. Contact person: Nancy Forbes, Senior Researcher, •MITRE, Arlington, VI. Testing Taggant Technologies. Contact person: Jorden Feidler•FBI. Forensic Science Research Center. Contact Person: Mona Thiss, Director, Grants and Research•In-Q-Tel, Langley, VI. Partners with small companies on development of technology with applications of interest to CIA. Contact Person: Steve Stassinos •CIA, Langley, VI. DS&T: Directorate of Science and Technology, ITIC: Innovative Technology Intelligence CenterNorm Kah, CIA Langley, VI


afsor sbir phase i contract isothermal and multiplexed dna amplification protocols and their...

Documents

dna taggants taggants

dna synthesis

dna taggants introduction

synthesized dna

dna hybridization

dna molecules

set of dna taggants

dna taggants eagle eye