advanced(project(thesis(in(biology( 30hp( vt2013(675844/fulltext01.pdf · 2013. 12. 4. ·...
TRANSCRIPT
![Page 1: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/1.jpg)
Advanced Project Thesis in Biology 30 hp VT2013
Lactobacilli suppress gene expression of key proteins involved in miRNA biogenesis in
HT29 and VK2/E6E7 cells
Annette Jacobsen [email protected]
Örebro University 2013
SCHOOL OF SCIENCE AND TECHNOLOGY
![Page 2: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/2.jpg)
Bacterial modulation of RNAi machinery
1
Abstract
It has previously been demonstrated that lactic acid bacteria are able to influence the innate
immune response of host cells. One way this can be achieved is through modulation of
inflammatory cascades initiated by pattern recognition elements such as toll-like receptors.
Micro RNA can also have an effect on innate immunity, and has been shown to have an
influence in regulation of these pathways in immune responsive cells. However, it is yet to be
determined if the interaction between lactic acid bacteria and host cells involves regulation of
the RNA interference machinery involved in micro RNA biogenesis. Three of the key
proteins responsible for miRNA production and activation are Argonaute 2, Dicer and
Drosha. Together, these are responsible for the processing and activation of miRNA to enable
post-transcriptional gene regulation. In this study we have used quantitative PCR to evaluate
changes in gene expression of these enzymes in HT29 and VK2/E6E7 mucosal epithelial cells
after treatment with Lactobacillus and uropathogenic bacteria. We have found that bacterial
treatment downregulates gene expression of elements responsible for miRNA biogenesis, and
our results showed different responses dependent on the cell line. In addition to this we have
also determined stable reference genes for use in further studies involving this model. Our
findings indicate that modulation of the RNAi machinery might be an important element of
immune regulation by bacterial colonists.
Keywords: Argonaute, Dicer, Drosha
![Page 3: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/3.jpg)
Bacterial modulation of RNAi machinery
2
Background
RNA interference (RNAi) is a phenomenon that has only been identified in the last 25 years,
but during that time much progress has been made in characterization of the pathways
involved. RNAi involves the mediation of gene expression by endogenous or exogenous
double-stranded RNA (dsRNA) (Peer and Lieberman, 2011). This can result in inhibition of
translation, mRNA degradation, or have a direct influence on gene transcription through
methylation pathways. RNAi is not only important for internal gene regulation and
developmental processes but also has relevance for the interaction between the host and
parasitic organisms such as viruses (Siomi and Siomi, 2009).
Endogenous RNAi is mediated by a number of different classes of short RNA molecules. One
of the most abundant and well characterised of these classes is micro RNA (miRNA). Mature
miRNA are 20-22 base pair long molecules that must be processed by a number of different
enzymes before they are functional. Primary precursors of miRNA (pri-miRNA) begin as
single strand hairpin RNA produced by RNA polymerase II or III (Winter et al., 2009). This
pri-miRNA is then processed by drosha, ribonuclease type III (DROSHA) to form a pre-
mRNA before export from the nucleus. In the cytoplasm, the enzyme dicer 1, ribonuclease
type III (DICER1) cleaves the hairpin region to form the mature double-stranded miRNA (Ma
et al., 2010). The miRNA then associates with an Argonaute protein, which is the catalytic
element of the RNA-induced silencing complex (RISC). As a result of this, one strand of the
miRNA is then degraded, and the remaining strand acts as a guide to determine which mRNA
the RISC associates with (Winter et al., 2009).
Of these enzymes, it is the Argonaute proteins that are of particular interest, as the type of
Argonaute within the RISC influences the type of RNAi that will be carried out (Siomi and
Siomi, 2009). Humans possess eight Argonaute genes, of which four are Argonaute-like
proteins and four are PIWI-like proteins (Höck and Meister, 2008). Of the four Argonaute-
like proteins (AGO1 - 4), only argonaute RISC catalytic compound 2 (AGO2) is associated
with slicer activity (Rand et al., 2004). This involves the ability to act as an endonuclease
against mRNA that is targeted by the RISC, making it a key mediator of the mRNA
degradation pathway of RNAi (Okamura et al., 2004). Further to this, it has been shown that
Argonaute proteins, in some circumstances, are able to act independently from Dicer in
processing miRNA (Yang and Lai, 2010).
![Page 4: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/4.jpg)
Bacterial modulation of RNAi machinery
3
Regulation through RNAi is believed to have a significant role in gene expression, and
influences a number of different pathways. One pathway that is regulated by miRNA is innate
immunity, particularly through toll-like receptors (TLRs) (Gantier, 2010). Some miRNAs
that are important to this pathway are miR-146, miR-155, and miR-132, all of which are
recognised to be responsive to the lipopolysaccharide (LPS) found in the cell walls of gram-
negative bacteria (Schulte et al., 2013; Zhou et al., 2012). LPS is recognised by host cells
through TLR-4, which then initiates a pro-inflammatory signalling cascade through the
nuclear factor kappa B (NF-kB) signalling pathway (Han and Ulevitch, 2005). The LPS-
sensitive miRNAs in this pathway affect the stability of mRNAs downstream of TLR-4 and
are thought to be a mechanism of preventing excessive activation of TLR-4 and tempering the
immune response (Gantier, 2010).
It has also been demonstrated that some commensal bacteria have the ability to modulate the
innate immune response through interaction with circulating immune cells and epithelial cells
(Howarth and Wang, 2013). This has also been found to occur through interactions between
bacteria and innate immune receptors, including TLRs and nucleotide-binding
oligomerisation domain-containing proteins (NODs) (Clarke et al., 2010; Karlsson et al.,
2012b; O’Hara et al., 2006). Lactic acid bacteria make up a significant proportion of the
commensal flora, and a number of these have been shown to influence the innate immune
response in response to pathogens (Karlsson et al., 2012a; Vizoso Pinto et al., 2009; Wagner
and Johnson, 2012). Recently, miRNA activation has also been shown to be involved in this
response (Archambaud et al., 2012; Singh et al., 2012).
Although there has been progress in determining how RNAi pathways function and the genes
they influence, little is still known about regulation of the RNAi machinery responsible for
miRNA biogenesis. However there is some evidence that these proteins can also be regulated
through activation of TLRs and miRNA pathways (Mallory and Vaucheret, 2010; Massirer
and Pasquinelli, 2013; Wiesen and Tomasi, 2010). In addition to this, it has been found that
certain pathogenic plant bacteria induce an upregulation of Argonaute proteins resulting in the
secretion on antimicrobial peptides (Zhang et al., 2011). These things have led us to
hypothesise that bacterial colonisation of mucosal surfaces could influence the transcription
rate of genes related to human RNAi machinery.
![Page 5: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/5.jpg)
Bacterial modulation of RNAi machinery
4
To accurately determine changes to transcription using quantitative PCR (qPCR) it is
important to normalise for any differences incurred in the experimental process. One of the
most common methods of doing this is by using reference genes, or internal control genes, as
they are subject to the same experimental conditions as the gene of interest (Huggett et al.,
2005). In this way, background noise from the experimental process can be eliminated and
true biological change can be identified (Derveaux et al., 2010). Selection of reference genes
is important, as they should show very little variation under the experimental conditions in
question. Although a number of traditional reference genes have been used to normalise
qPCR studies, it has now been found that these can vary under certain test conditions or
disease states (de Jonge et al., 2007; Suzuki et al., 2000). As such, reference gene validation
studies should ideally be conducted where an internal control has not already been validated
for a particular model or experimental stress (Bustin et al., 2009; Udvardi et al., 2008).
For both segments of the study, human mucosal cell lines were challenged with both health-
beneficial and pathogenic bacteria. Two bacterial strains with known health-beneficial effects
are Lactobacillus rhamnosus GR-1 and Lactobacillus acidophilus NCFM. L. rhamnosus GR-
1 has been shown to have protective influence against pathogens in the urogenital tract,
whereas L. acidophilus NCFM has more documented effect in the gastrointestinal tract
(Karlsson et al., 2012a; Kim and Mylonakis, 2012; Ouwehand et al., 2009; Wagner, 2012). In
this study we have examined the effect of these two bacteria and heat-killed Escherichia coli
GR-12, a uropathogenic strain, on gene expression of key RNAi machinery elements in
mucosal epithelial cell lines. In doing this we have also determined optimal reference genes
for use in similarly designed studies. We have found that probiotic bacteria tend to
downregulate gene expression of key proteins involved in RNAi biogenesis pathways. This
transcriptional suppression may contribute to increasing understanding of the mechanisms
involved in immune modulation as a result of bacterial colonisation in humans, and how
changes to this balance could impact human immune responses.
![Page 6: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/6.jpg)
Bacterial modulation of RNAi machinery
5
Methods
Candidate reference gene selection
Eight reference genes - glyceraldehyde-3-phosphate dehydrogenase (GAPDH),
phosphoglycerate kinase 1(PGK1), peptidylprolyl isomerase A (PPIA), ribosomal protein
large P0 (RPLP0), defensin beta 1 (DEFB1), transmembrane protein 222 (TMEM222),
mevalonate kinase (MVK), and polymerase (RNA) II (DNA directed) polypeptide A, 220 kDa
(POLR2A) - were selected as previously described (Jacobsen, 2013). In addition actin, beta
(ACTB), another commonly used reference gene whose primary function involves
cytoskeletal structure, was also included. The final two candidates from the miRNA biogenesis
pathway, DICER1 and DROSHA, were included in this analysis after initial results indicated
relatively stable expression in the HT29 cell line.
Primer design and validation
Reference gene primers already assessed in earlier analyses (GAPDH, PPIA, hBD1,
TMEM222, POLR2A, MVK, RPLP0, and PGK) were designed and validated as previously
described (Jacobsen, 2013). New primers introduced for this study (ACTB, DICER1,
DROSHA, and AGO2) were designed and checked for specificity against human mRNA using
the NCBI/Primer-BLAST tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Beacon
Designer (http://www.premierbiosoft.com/qpcr/index.html, Premier Biosoft, California, USA)
was used to assess potential primer-dimer associations, and UNAFold
(http://eu.idtdna.com/UNAFold, Integrated DNA Technologies, Iowa, USA) was used to
determine the likelihood of amplicon secondary structures. Primers were built by Eurofins
MWG Operon (Ebersberg, Germany), and a complete list of their sequences and locations are
shown in Table 1.
Conventional PCR, followed by electrophoresis on 1.5% agarose gels, was used to establish
amplification of a product of the correct size. Eight ten-fold serial dilutions of PCR product
were assessed using quantitative PCR (qPCR), including melting curve analysis, to determine
linear range, efficiency and specificity as previously described (Jacobsen, 2013).
![Page 7: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/7.jpg)
Bacterial modulation of RNAi machinery
6
Bacterial strains and culture conditions
Lactobacillus strains
Lactobacillus strains were prepared as previously described (Jacobsen, 2013; Tewelde, 2011).
Both strains (Lactobacillus acidophilus NCFM and Lactobacillus rhamnosus GR-1) were
grown under anaerobic conditions in GasPakTM EZ Anaerobe Generating Pouch Systems
(BD, Franklin Lakes, USA) on de Man Rogosa Sharp (MRS) agar (Becton Dickinson, Sparks,
USA) at 37°C for 24 hours. Then, one colony was used to inoculate a 15 mL falcon tube
containing MRS media, and incubated upright without shaking for a further 24 hours at 37°C.
A new falcon tube containing MRS broth was then inoculated with 1% of the overnight
culture and incubated for another 24hrs.
To quantify the bacteria a colony forming unit count was conducted. First, centrifugation of 1
mL of the bacterial suspension at 3000 x g for 10 minutes was performed, then the pellet was
washed twice and resuspended in 1 mL of phosphate buffer saline (PBS pH 7.4). Finally,
serial dilutions were plated on MRS agar and left to incubate overnight in anaerobic pouches
at 37°C.
Heat killed Escherichia coli GR-12
Heat killed (HK) E. coli GR-12 were prepared as previously described (Jacobsen, 2013;
Tewelde, 2011). In brief, bacteria were grown for 24 hours at 37°C on Luria Bertani agar
(LB; Sigma-Aldrich, St-Louis, USA), then one colony was used to inoculate 5 mL of LB
broth. This was shaken at 200 rpm overnight at 37°C, after which the colony was pelleted by
centrifugation for 10 minutes at 3000 x g. The bacteria were washed twice and resuspended in
500 µL sterile PBS, then heated in a water bath for 1 hour at 70°C. Heat-treated bacterial cells
were plated in LB agar and incubated overnight to confirm there were no viable cells.
Quantification of bacteria was achieved by plating of serial dilutions and counting of CFUs
alongside the heat-killing step.
![Page 8: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/8.jpg)
Bacterial modulation of RNAi machinery
7
Epithelial cell culture
Epithelial cell lines were maintained as previously described (Jacobsen, 2013; Tewelde,
2011). HT-29 human intestinal epithelial cells were grown in McCoy’s 5A media (Hyclone,
Utah, USA) with 10% foetal bovine serum (FBS; Hyclone, Utah, USA). VK2/E6E7 human
vaginal epithelial cells were cultured in Keratinocyte-Serum Free medium with additional
calcium chloride (end concentration 0.4 mM), 0.05 mg/mL bovine pituitary extract and 0.1
ng/mL human recombinant endothelial growth factor 1-53 (all from Life Technologies,
Stockholm, Sweden). Cells were subcultured at 70% confluence with 0.25% trypsin, 0.53mM
EDTA. Cells were incubated at 37°C in 5% CO2 and stock cultures were maintained in liquid
nitrogen in growth medium containing 5% DMSO.
Cell treatment
For treatment, cells were seeded into 6 well plates (BD, Franklin Lakes, USA) at a density of
3x105 cells/well, and allowed to grow to a density of 3x106 cells/well, or approximately 90%
confluence. For HT29, cells were treated as previously described, with an additional two
treatment groups being utilised for the reference gene analysis (Jacobsen, 2013; Tewelde,
2011). VK2/E6E7 cells were treated as per HT29 cells. In brief, cells were changed to fresh
media with either 10 ng/mL TNFα, HK E. coli GR-12 (equivalent to 3x107 CFU/mL), L.
rhamnosus GR-1 (108 CFU/mL), L. acidophilus NCFM (108 CFU/mL), or with a combination
of HK E. coli GR-12 and one of the Lactobacillus strains. Cells were then incubated for 3
hours at 37°C in 5% CO2. Experiments were repeated three times for the VK2/E6E7 cell line
(n = 3), and five times for the HT29 cell line (n=5).
RNA extraction and cDNA synthesis
RNA was extracted as previously described using a Nucleospin II kit (Macherey-Nagel,
Düren, Germany) as per manufacturers instructions (Jacobsen, 2013; Tewelde, 2011). A
NanoVue Spectrophotometer (GE Healthcare, Buckinghamshire, UK) was used to estimate
quantity and purity, and then agarose gel electrophoresis was used to assess RNA quality. A
qScript kit (Quanta Bioscience, Gaithersburg, USA) was used to synthesise cDNA from 1 µg
of the extracted RNA as per the manufacturer’s instructions, and then diluted ten times before
use in the qPCR reaction.
![Page 9: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/9.jpg)
Bacterial modulation of RNAi machinery
8
Conventional polymerase chain reaction
Conventional PCR was performed using a Hybaid PCR Sprint thermocycler (Thermo
Scientific, Massachusetts, USA) as previously described (Jacobsen, 2013). Maxima Hot Start
Taq Buffer (10X; Thermo Scientific, Massachusetts, USA) was used to prepare 25 µL
reactions, using 2.5 mM MgCl2, 0.3 µM of forward and reverse primers, 0.2 mM dNTP, 1 µM
Maxima Hot Start Taq DNA Polymerase, and 25 pg template cDNA. The reaction was begun
with denaturation at 95°C for 4 minutes, followed by 40 cycles of denaturation for 30 seconds
at 95°C, annealing for 30 seconds at 60°C, and extension for 30 seconds at 72°C. A final five
minute extension at 72°C concluded the reaction. Gel elctrophoresis on 1.5% agarose was
used to confirm amplification of a product of the correct size.
Quantitative polymerase chain reaction
The qPCR reactions were performed as previously described (Jacobsen, 2013). An ABI
Prism® 7900HT Sequence Detection System (Applied Biosystems, California, USA) was used
for the qPCR reaction. A Maxima SYBR Green qPCR Master Mix (x2) (Thermo Scientific,
Massachusetts, USA) was used to prepare 15 µL reactions with 267nM final concentration of
ROX, 25 pg template cDNA, and a 0.2 µM end concentration of each of the forward and
reverse primers (except for ACTB). For ACTB, primer concentrations needed to be optimised
and were used at 0.2 µM of forward primer and 0.07 µM of reverse primer, with all other
elements of the reaction staying the same. The reaction was initiated with 10 minutes of
denaturation at 95°C, then 40 cycles of denaturation at 95°C for 15 seconds and
annealing/extension at 60°C for 60 seconds. A dissociation step was performed at the
conclusion of all reactions so as to collect melting curve data, and both no template and no
reverse transcriptase controls were performed. For experiments related to assessing gene
expression of miRNA biomachinery, PGK1 was used to normalise the HT29 data set and
RPLP0 was used to normalise the VK2/E6E7 data set.
Data analysis
Real-time PCR Miner (http://www.miner.ewindup.info/; Version 4.0) was used to generate
primer efficiency and Cq values of the candidate reference genes, using the raw fluorescence
![Page 10: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/10.jpg)
Bacterial modulation of RNAi machinery
9
data generated during the qPCR reactions. Assessment of candidate gene performance was
performed as previously described (Jacobsen, 2013). In brief, we used four different
algorithms: geNorm Plus, BestKeeper, Normfinder and the comparative ΔCq method.
Corrections for efficiency using the values generated by PCR Miner were performed prior to
analysis. Overall ranking of reference gene candidates was determined using the geometric
mean of the rankings generated from the individual algorithms.
In addition to the previous study, we included more reference gene candidates (ACTB,
DICER1, and DROSHA) and more test conditions (L. acidophilus NCFM with HK E. coli
GR-12 and L. rhamnosus GR-1 with HK E. coli GR-12) so as to best represent the conditions
of our current model. This included all treatments performed, excepting with TNFα. The data
sets were also separated so we could compare the effects of different Lactobacilli on our
model. After analysis these data sets were compared to assess potential differences between
both cell lines and treatment groups.
Statistical analysis
For analysis of gene expression in the RNAi pathway comparison of means was performed
using ANOVA combined with Tukey’s range test. All data sets had n = 3 except the
HT29/AGO2 data set, which had n = 5. HT29 expression was normalised against PGK1 and
VK2/E6E7 expression was normalised against RPLP0. Data is presented as mean ± s.d. and
statistical significance was taken as p < 0.05.
![Page 11: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/11.jpg)
Bacterial modulation of RNAi machinery
10
Results
Reference gene selection is cell line specific, and is not greatly influenced by the algorithm
used
Our analysis found PGK1 to be the best selection for the HT29 data set and RPLP0 to be
more appropriate for the VK2/E6E7 data set. All four algorithms used were in agreement with
the best and worst candidates in both data sets (Tables 2,3). Although there were some
differences in the rankings between the algorithms, all correlated well in elimination of the
less suitable reference genes from analysis. Overall, we found a strong comparison in
rankings between the GenormPLUS and BestKeeper results, and likewise between the
Normfinder and comparative ΔCq method.
Reference gene selection was more strongly influenced by the cell line than by the species of
Lactobacillus used in treatment
To fully determine reference gene stability we subdivided our data set to determine if there
was any difference in reference stability dependent on the species of Lactobacillus we were
using. We found there to be very little difference in reference gene suitability as a result of the
species used for treatment in both cell lines (Figs. 1A,B). The only notable exception was
PPIA in the VK2/E6E7 data set, which ranked as the best choice for L. rhamnosus, but only
7th best for L. acidophilus. When the full data set for this cell line was analysed PPIA was
placed in 4th position overall.
To further address the question of cell line specificity versus treatment specificity, we used
radar graphs to illustrate the differences between the comprehensive and sub-divided rankings
of both our cell lines. This showed clear differences between the cell lines assessed (Fig. 1C).
ACTB and TMEM222 ranked highly for the VK2 data set, but flagged as poor choices for the
HT29 cell line and, conversely, DICER1 was indicated as a good selection for HT29 but was
one of the lowest ranked for VK2/E6E7 cells.
![Page 12: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/12.jpg)
Bacterial modulation of RNAi machinery
11
Treatment with Lactobacillus is associated with decreased AGO2 mRNA expression
We found significant changes to expression of AGO2 in response to treatment with both
Lactobacillus strains (Fig. 2). For HT29, this was only seen in response to treatment with
Lactobacillus alone (from control: NCFM, p = 0.040; GR-1, p = 0.002). In the VK2/E6E7 cell
line, reduced expression of AGO2 was found whether live Lactobacillus or HK E. coli were
used (from control: NCFM, p = 0.009; GR-1, p = 0.006; GR-12, p = 0.001; NCFM/GR-12, p
< 0.001; GR-1/GR-12 = 0.004). Further to this, we also found an increased expression of
AGO2 in response to TNFα in the HT29 cell line (p = 0.046), which is consistent with
previous findings out of this laboratory.
mRNA expression of DICER1 is reduced after treatment with Lactobacillus in VK2/E6E7 cells
We found significant reductions of DICER1 expression in VK2/E6E7 cells in all bacterial
treatments involving Lactobacilli (Fig. 3B; NCFM, p = 0.004; GR-1, p = 0.0203; NCFM/GR-
12, p = 0.001; GR-1/GR-12, p = 0.0048). Interestingly, the most statistically significant effect
was seen after treatment with HK E. coli (GR-12, p < 0.001). Further to this, the HK E. coli
treatment was also the only one to significantly affect DICER1 transcription in the HT29 cells
(Fig. 3A; GR-12, p = 0.048).
Expression of DROSHA mRNA is reduced after bacterial treatment
We found small but significant decreases in DROSHA mRNA after treatments in both cell
lines (Fig. 4). In the HT29 data set, this included all bacterial treatments except the L.
acidophilus group (GR-1, p = 0.004; GR-12, p = 0.039; NCFM/GR-12, p = 0.008; GR-1/GR-
12, p = 0.005), and in the VK2/E6E7 cells this included all except the L. rhamnosus group
(NCFM; p = 0.023; GR-12, p = 0.004; NCFM/GR-12, p = 0.007; GR-1/GR-12, p = 0.029).
Both these groups, however, had relatively large standard deviations.
In the HT29 data set, we also found a small but significant reduction in DROSHA expression
after treatment with TNFα (p = 0.017).
![Page 13: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/13.jpg)
Bacterial modulation of RNAi machinery
12
Discussion
Both miRNA pathways and the interaction between commensal bacteria and the host are now
recognised as important aspects in the control of innate immunity, but only recently have
these two pathways been linked together (Archambaud et al., 2012; Singh et al., 2012). It has
also now been determined that the regulation of proteins involved in miRNA biogenesis can
influence the effect of RNAi (Betancur and Tomari, 2012; Cheloufi et al., 2010). In this study,
we have used qualitative PCR analysis to investigate whether gene expression of key proteins
involved in miRNA biogenesis in human mucosal cells is affected by bacterial treatment. Our
results indicate a transcriptional repression of the miRNA machinery in two human epithelial
cell lines after treatment with different strains of Lactobacillus. Further to this, we have
observed a downregulation of these genes after treatment with HK E. coli GR-12, particularly
in the VK2/E6E7 cell line. Also, we have been able to identify stable reference genes for use
in further studies involving this model.
Our findings also indicate cell-specific differences in the nature of the transcriptional
repression. In the VK2/E6E7 cell line, all three enzymes involved in the canonical pathway of
miRNA processing showed significant downregulation after bacterial treatment. We were
unable to find a significant downregulation of DROSHA after treatment with L. rhamnosus
GR-1, however due to the larger standard deviation seen here it is difficult to draw any
conclusion. For the HT29 data set we found a significant downregulation of AGO2 only
where the Lactobacillus alone were used. There was no significant effect on DICER1 as a
result of treatment involving either of the lactic acid bacteria, however a small but significant
response was found in response to HK E. coli GR-12. A significant downregulation of
DROSHA was observed as a result of most bacterial treatments, however it should be noted
that the magnitude of these changes was small. Further studies will need to be performed to
determine if there is any biological significance as a result of this.
These different effects in gene regulation seen as a result of our treatments are most likely due
to differences in the cell lines used as models. As they are representative of different
anatomical locations (colon and vagina) it is quite possible that it is simply a result of the
different signalling pathways and receptors that are necessary for their individual
physiological roles. However it should not be discounted that the method of immortalisation
of these cell lines may also have an impact on the responsiveness of the cells to treatment.
![Page 14: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/14.jpg)
Bacterial modulation of RNAi machinery
13
HT29 cells are colon carcinoma cells whereas the VK2/E6E7 cell line has been transformed
using the Human papillomavirus (HPV), and both these things may affect normal cell
physiology (Futscher, 2013; Kohlhof et al., 2009; Romilda et al., 2012).
The different affects on transcription of our targets may also indicate differences in the way
miRNA biogenesis is affected in these cell lines. Although sequential processing of miRNA
through DROSHA, DICER1 and AGO2 is the most well known mechanism of miRNA
biogenesis, alternate pathways have now been identified. One example of this that is
particularly relevant to the HT29 model involves biogenesis of miR-451. Processing of this
miRNA involves a DICER-independent mechanism, being processed directly by AGO2 after
being exported from the nucleus (Cheloufi et al., 2010). miR-451 is involved in a number of
different biological pathways, one of which involves regulation of P-glycoprotein 1, an ATP-
binding cassette transporter protein that is extensively distributed in the gastrointestinal
epithelium, and another being direct regulation of macrophage migration inhibitory factor
(Bandres et al., 2009; Bitarte et al., 2011). Both these factors can have an influence in the
innate immune response. This relationship may provide further information on location
specific colonisation mechanisms of Lactobacilli, and provides an interesting focus of
investigation for further study in this model.
We also noted cell-specific differences in the gene expression regulation of the RNAi
machinery after treatment with the HK E. coli. As E. coli GR-12 is a uropathogenic strain,
this response may provide more information about their ability to cause infection in the
genitourinary tract. Although we were not using viable bacteria, elements able to regulate an
immune response are still present after the heat-killing process. Most commonly, this is used
as a model for LPS/Lipid A stimulation of TLR4, but elements such as flagellum, fimbriae
and pili may also activate innate immunity through activating TLR5 or TLR2 (Kawai and
Akira, 2010). This may also provide an interesting avenue for further investigation.
In both cell lines, further studies are required before any strong conclusions are made. Our
initial studies have focused on changes to mRNA levels only, and this does not always
provide an accurate picture of what is occurring at a functional level. This is particularly
relevant to our data, as although statistical significance was found in a number of cases, often
this only represented small absolute changes. A first step to determine the biological
significance of our results would be analysis of protein expression in response to our
![Page 15: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/15.jpg)
Bacterial modulation of RNAi machinery
14
treatments. Further to this, it would be worthwhile conducting a time point analysis of both
protein and mRNA to determine where maximal effect of treatment occurred. If these data
provide evidence of a biological significance, further indication could be done to investigate
the specific pathways involved. This could include screening of miRNA expression, or the
use of inhibitors to investigate the activation of specific TLRs.
If these findings are supported by functional analyses and become biologically significant,
these results could help to increase our understanding of the mechanisms involved in bacterial
regulation of host gene expression, and its impact on immune modulation. This could prove
important when considering using health-beneficial bacteria as prophylactic or active
treatment for disease, or in understanding changes that may occur when commensal
populations are disrupted, such as after antibiotic use (Clemente et al., 2012; Wolvers et al.,
2010). A general suppression of immune responses by colonising bacteria is not unusual in
itself, but identification of new pathways involved in this process creates novel targets for
drugs designed to increase the body’s own immune response (Hancock et al., 2012; Round et
al., 2010). This could become particularly relevant if there is found to be significant
differences in the way pathogenic bacteria affect miRNA biogenesis, but could also provide
new avenues of treatment for a range of diseases that are believed to occur as a result of
disruption of the interaction between the host and commensal bacteria.
As our hypothesis focussed on the changes in gene expression, we felt it important that the
study was normalised with an appropriate reference gene. There are a number of common
reference genes used for such studies, including glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) and actin, beta (ACTB), but we were unable to locate evidence of thorough
validation studies being performed specific to our model (Bahrami et al., 2011; Libby et al.,
2008; Węglarz et al., 2006). As commonly used reference genes such as these have now been
found to be unsuitable for a number of different studies, this led us to question whether they
were the most suitable choice for our model (de Jonge et al., 2007; Huggett et al., 2005). To
determine this we performed an in-depth validation study, using four different algorithms, to
compare expression pattern of these two genes against nine other reference gene candidates.
This was an extension on a previous reference gene study in which eight reference gene
candidates were assessed (Jacobsen, 2013). After doing this we did note some changes in the
overall rankings of our reference gene candidates compared to the previous study, which may
be as a result of either the newly introduced genes (ACTB, DICER1, and DROSHA) or the
![Page 16: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/16.jpg)
Bacterial modulation of RNAi machinery
15
newly introduced test conditions (L. acidophilus NCFM with HK E. coli GR-12 and L.
rhamnosus GR-1 with HK E. coli GR-12). However, most of the changes were minor, with
the exception of RPLP0 moving from a poor ranking to a middle ranking in the HT29 data
set, and GAPDH improving from last ranked to poor in the VK2/E6E7 data set, and from well
ranked to middle ranked in the HT29 results. Also, the additional cDNA synthesis performed
to complete the analysis may have a minor influence on the overall ranking, despite
calibration. In general, we found increasing the data set for the reference gene analysis tended
to make results more comparable across the different algorithms. In both data sets the best and
worst candidates were the same in all four methods applied. For the HT29 data set PGK1 was
found to be most suitable and RPLP0 was found to be the best choice for the VK2/E6E7 cells.
Two of the genes examined in the miRNA processing study were included into the reference
gene study, DICER1 and DROSHA, as they were found to show minimal expression changes
as assessed in an unnormalised pilot study, particularly in relation to the HT-29 data set.
Inclusion of these genes in the reference gene analysis served two purposes. Firstly, if our
hypothesis in regards to gene regulation of the miRNA processing machinery was wrong and
these genes were stable expressed, it could have provided novel reference gene candidates for
further studies involving this model. Secondly, if our hypothesis was correct, and there was
some change to gene expression, a second method of analysing gene stability could help to
clarify and strengthen these results. This was especially pertinent when changes to gene
expression levels were small. We found DROSHA to be a poor choice as a reference gene
candidate for both data sets, and DICER1 to be a poor choice for the VK2/E6E7 data set. This
is in line with the final normalised expression analysis, which showed significant changes to
these genes under most experimental conditions. Interestingly, DICER1 was found to be the
second best candidate for the HT29 data set. This is supported by the normalised expression
analysis, in which only treatment with E. coli GR-12 showed a significant expression change.
It is worth noting the fold change here is small (-0.2±0.12 fold) and only just statistically
significant (p = 0.048).
In addition to assessing overall stability, we also performed an additional two analyses using
all four algorithms for each data set where only one Lactobacillus strain was involved (e.g.
control, NCFM, GR-12, and NCFM/GR-12 combined compared to comtrol, GR-1, GR-12,
and GR-1/GR-12 combined). This was done to try and determine whether the strain of
Lactobacillus of the cell type being investigated had a larger impact on reference gene
![Page 17: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/17.jpg)
Bacterial modulation of RNAi machinery
16
suitability. Overall, our results also indicated that the type of cell line had a greater effect than
the species of Lactobacillus we were investigating. This suggests that these genes may also
prove suitable for normalising other studies in these cell lines where different lactic acid
bacteria are used as the challenge. Depending on the sensitivity required, a second reference
gene could be added to increase the robustness of the normalisation.
In conclusion, our studies indicate a general suppression of transcription of key proteins
involved in miRNA transcription. Although further studies are required to substantiate these
findings, this may help in better characterising the pathways involved in immune modulation
and colonisation strategies of commensal and pathogenic bacteria in specific mucosal cell
lines.
![Page 18: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/18.jpg)
Bacterial modulation of RNAi machinery
17
Acknowledgements
Sincere thanks to my supervisor, Dr Nikolai Scherbak (School of Life Science and
Technology, Örebro Life Science Centre), for his support and encouragement during my time
at Örebro University, and for giving me the opportunity to be involved in such an interesting
project. Thanks also to Bisrat Tewelde, who was responsible for cell treatments and sample
preparation in relation to this study.
![Page 19: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/19.jpg)
Bacterial modulation of RNAi machinery
18
References
Archambaud, C., Nahori, M., Soubigou, G., Bécavin, C., Laval, L., Lechat, P., Smokvina, T., Langella, P., Lecuit, M. and Cossart, P. (2012). Impact of lactobacilli on orally acquired listeriosis. Proc. Natl. Acad. Sci. 109, 16684–16689.
Bahrami, B., Macfarlane, S. and Macfarlane, G. T. (2011). Induction of cytokine formation by human intestinal bacteria in gut epithelial cell lines. J. Appl. Microbiol. 110, 353–63.
Bandres, E., Bitarte, N., Arias, F., Agorreta, J., Fortes, P., Agirre, X., Zarate, R., Diaz-Gonzalez, J. a, Ramirez, N., Sola, J. J., et al. (2009). microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin. Cancer Res. 15, 2281–90.
Betancur, J. G. and Tomari, Y. (2012). Dicer is dispensable for asymmetric RISC loading in mammals. RNA 18, 24–30.
Bitarte, N., Bandres, E., Boni, V., Zarate, R., Rodriguez, J., Gonzalez-Huarriz, M., Lopez, I., Javier Sola, J., Alonso, M. M., Fortes, P., et al. (2011). MicroRNA-451 is involved in the self-renewal, tumorigenicity, and chemoresistance of colorectal cancer stem cells. Stem Cells 29, 1661–71.
Bustin, S. a, Benes, V., Garson, J. a, Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., et al. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–22.
Cheloufi, S., Dos Santos, C. o, Chong, M. M. W. and Hannon, G. J. (2010). A Dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465, 584–589.
Clarke, T. B., Davis, K. M., Lysenko, E. S., Zhou, A. Y., Yu, Y. and Weiser, J. N. (2010). Recognition of peptidoglycan from the microbiota by Nod1 enhances systemic innate immunity. Nat. Med. 16, 228–31.
Clemente, J. C., Ursell, L. K., Parfrey, L. W. and Knight, R. (2012). The impact of the gut microbiota on human health: an integrative view. Cell 148, 1258–70.
De Jonge, H. J. M., Fehrmann, R. S. N., de Bont, E. S. J. M., Hofstra, R. M. W., Gerbens, F., Kamps, W. a, de Vries, E. G. E., van der Zee, A. G. J., te Meerman, G. J. and ter Elst, A. (2007). Evidence based selection of housekeeping genes. PLoS One 2, e898.
Derveaux, S., Vandesompele, J. and Hellemans, J. (2010). How to do successful gene expression analysis using real-time PCR. Methods 50, 227–230.
Futscher, B. W. (2013). Epigenetic Alterations in Oncogenesis. Adv. Exp. Med. Biol. 754, 179–194.
Gantier, M. P. (2010). New perspectives in MicroRNA regulation of innate immunity. J. Interf. cytokine Res. 30, 283–9.
Han, J. and Ulevitch, R. J. (2005). Limiting inflammatory responses during activation of innate immunity. Nat. Immunol. 6, 1198–205.
Hancock, R. E. W., Nijnik, A. and Philpott, D. J. (2012). Modulating immunity as a therapy for bacterial infections. Nat. Rev. Microbiol. 10, 243–54.
Höck, J. and Meister, G. (2008). The Argonaute protein family. Genome Biol. 9, 210.
![Page 20: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/20.jpg)
Bacterial modulation of RNAi machinery
19
Howarth, G. S. and Wang, H. (2013). Role of endogenous microbiota, probiotics and their biological products in human health. Nutrients 5, 58–81.
Huggett, J., Dheda, K., Bustin, S. and Zumla, A. (2005). Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 6, 279–84.
Jacobsen, A. (2013). Reference gene selection and validation for HT29 and VK2 / E6E7 human epithelial cell lines treated with probiotic and pathogenic bacteria. 1–30.
Karlsson, M., Scherbak, N., Reid, G. and Jass, J. (2012a). Lactobacillus rhamnosus GR-1 enhances NF-kappaB activation in Escherichia coli-stimulated urinary bladder cells through TLR4. BMC Microbiol. 12, 15.
Karlsson, M., Scherbak, N., Khalaf, H., Olsson, P.-E. and Jass, J. (2012b). Substances released from probiotic Lactobacillus rhamnosus GR-1 potentiate NF-κB activity in Escherichia coli-stimulated urinary bladder cells. FEMS Immunol. Med. Microbiol. 66, 147–56.
Kawai, T. and Akira, S. (2010). The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11, 373–84.
Kim, Y. and Mylonakis, E. (2012). Caenorhabditis elegans immune conditioning with the probiotic bacterium Lactobacillus acidophilus strain NCFM enhances gram-positive immune responses. Infect. Immun. 80, 2500–8.
Kohlhof, H., Hampel, F., Hoffmann, R., Burtscher, H., Weidle, U. H., Hölzel, M., Eick, D., Zimber-Strobl, U. and Strobl, L. J. (2009). Notch1, Notch2, and Epstein-Barr virus-encoded nuclear antigen 2 signaling differentially affects proliferation and survival of Epstein-Barr virus-infected B cells. Blood 113, 5506–15.
Libby, E. K., Pascal, K. E., Mordechai, E., Adelson, M. E. and Trama, J. P. (2008). Atopobium vaginae triggers an innate immune response in an in vitro model of bacterial vaginosis. Microbes Infect. 10, 439–46.
Ma, J., Dong, C. and Ji, C. (2010). MicroRNA and drug resistance. Cancer Gene Ther. 17, 523–31.
Mallory, A. and Vaucheret, H. (2010). Form, function, and regulation of ARGONAUTE proteins. Plant Cell 22, 3879–89.
Massirer, K. B. and Pasquinelli, A. E. (2013). MicroRNAs that interfere with RNAi. Worm 2, 1–6.
O’Hara, A. M., O’Regan, P., Fanning, A., O’Mahony, C., Macsharry, J., Lyons, A., Bienenstock, J., O’Mahony, L. and Shanahan, F. (2006). Functional modulation of human intestinal epithelial cell responses by Bifidobacterium infantis and Lactobacillus salivarius. Immunology 118, 202–15.
Okamura, K., Ishizuka, A., Siomi, H. and Siomi, M. C. (2004). Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655–66.
Ouwehand, A. C., Tiihonen, K., Saarinen, M., Putaala, H. and Rautonen, N. (2009). Influence of a combination of Lactobacillus acidophilus NCFM and lactitol on healthy elderly: intestinal and immune parameters. Br. J. Nutr. 101, 367–75.
Peer, D. and Lieberman, J. (2011). Special delivery: targeted therapy with small RNAs. Gene Ther. 18, 1127–33.
Rand, T. a, Ginalski, K., Grishin, N. V and Wang, X. (2004). Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity. Proc. Natl. Acad. Sci. U. S. A. 101, 14385–9.
![Page 21: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/21.jpg)
Bacterial modulation of RNAi machinery
20
Romilda, C., Marika, P., Alessandro, S., Enrico, L., Marina, B., Andromachi, K., Umberto, C., Giacomo, Z., Claudia, M., Massimo, R., et al. (2012). Oxidative DNA damage correlates with cell immortalization and mir-92 expression in hepatocellular carcinoma. BMC Cancer 12, 177.
Round, J., O’Connell, R. and Mazmanian, S. (2010). Coordination of tolerogenic immune responses by the commensal microbiota. J. Autoimmun. 34, J220–5.
Schulte, L. N., Westermann, A. J. and Vogel, J. (2013). Differential activation and functional specialization of miR-146 and miR-155 in innate immune sensing. Nucleic Acids Res. 41, 542–53.
Singh, N., Shirdel, E. a, Waldron, L., Zhang, R.-H., Jurisica, I. and Comelli, E. M. (2012). The murine caecal microRNA signature depends on the presence of the endogenous microbiota. Int. J. Biol. Sci. 8, 171–86.
Siomi, H. and Siomi, M. C. (2009). On the road to reading the RNA-interference code. Nature 457, 396–404.
Suzuki, T., Paul, J. and Dana, R. (2000). Review Control Selection for RNA Quantitation. Biotechniques 29, 332–337.
Tewelde, B. (2011). Influence of probiotic bacteria on the expression of RNA interference proteins. 1–14.
Udvardi, M. K., Czechowski, T. and Scheible, W.-R. (2008). Eleven golden rules of quantitative RT-PCR. Plant Cell 20, 1736–7.
Vizoso Pinto, M. G., Rodriguez Gómez, M., Seifert, S., Watzl, B., Holzapfel, W. H. and Franz, C. M. a P. (2009). Lactobacilli stimulate the innate immune response and modulate the TLR expression of HT29 intestinal epithelial cells in vitro. Int. J. Food Microbiol. 133, 86–93.
Wagner, R. D. (2012). Protection of Vaginal Epithelial Cells with Probiotic Lactobacilli and the Effect of Estrogen against Infection by Candida albicans. Open J. Med. Microbiol. 02, 54–64.
Wagner, R. D. and Johnson, S. J. (2012). Probiotic lactobacillus and estrogen effects on vaginal epithelial gene expression responses to Candida albicans. J. Biomed. Sci. 19, 58.
Węglarz, L., Molin, I., Orchel, A. and Parfiniewicz, B. (2006). Quantitative analysis of the level of p53 and p21WAF1 mRNA in human colon cancer HT-29 cells treated with inositol hexaphosphate. Acta Biochem. Pol. 53, 349–356.
Wiesen, J. L. and Tomasi, T. B. (2010). Dicer is regulated by cellular stresses and interferons. Mol. Immunol. 46, 1222–1228.
Winter, J., Jung, S., Keller, S., Gregory, R. I. and Diederichs, S. (2009). Many roads to maturity: microRNA biogenesis pathways and their regulation. Nat. Cell Biol. 11, 228–34.
Wolvers, D., Antoine, J., Myllyluoma, E., Schrezenmeir, J., Szajewska, H. and Rijkers, G. (2010). Guidance for substantiating the evidence for beneficial effects of probiotics: prevention and management of infections by probiotics. J. Nutr. 140, 698S–712S.
Yang, J.-S. and Lai, E. C. (2010). Dicer-independent, Ago2-mediated microRNA biogenesis in vertebrates. Cell Cycle 9, 4455–4460.
Zhang, X., Zhao, H., Gao, S., Wang, W.-C., Katiyar-Agarwal, S., Huang, H.-D., Raikhel, N. and Jin, H. (2011). Arabidopsis Argonaute 2 regulates innate immunity via miRNA393(∗)-mediated silencing of a Golgi-localized SNARE gene, MEMB12. Mol. Cell 42, 356–66.
![Page 22: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/22.jpg)
Bacterial modulation of RNAi machinery
21
Zhou, R., Gong, A.-Y., Eischeid, A. N. and Chen, X.-M. (2012). miR-27b targets KSRP to coordinate TLR4-mediated epithelial defense against Cryptosporidium parvum infection. PLoS Pathog. 8, e1002702.
![Page 23: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/23.jpg)
Bacterial modulation of RNAi machinery
22
Table 1. Primer sequences used for qPCR analysis. Target Gene Accession
Number Primer Sequence (5'-3') Tm *
(°C) Location
(exon) Product Size (bp)
Design Method
POLR2A* NM_000937 F: AAGTTCAACCAAGCCATTGCG R: GACACACCAGCATAGTGGAAGG
62.00 62.69
19-20 20
116 QuantPrime
TMEM222* NM_032125 F: TCTACGGGAAGTACGTCAGC R: CCATCACCGGAGGTTAAAGACC
60.63 62.44
2-3 3
110 QuantPrime
MVK* NM_000431 F: AAGGTAGCACTGGCTGTATCC R: CCAATGTTGGGTAAGCTGAGG
61.28 60.66
6-8 8
95 QuantPrime
DEFB1* NM_005218
F: GTTCCTGAAATCCTGGGTGTTG R: CTGTGAGAAAGTTACCACCTGAG
61.20 60.44
1 1-2
114 QuantPrime
PPIA* NM_021130 F: GCTTGCTGGCAGTTAGATGTC R: AGAGGTCTGTTAAGGTGGGC
61.32 60.79
5 5
73 Primer-BLAST
GAPDH* NM_002046 F: ATTTGGCTACAGCAACAGGG R: TCAAGGGGTCTACATGGCA
60.93 61.17
10 10
192 Primer-BLAST
RPLP0* NM_001002 F: ACAATGGCAGCATCTACA R: GTAATCCGTCTCCACAGA
55.50 54.61
6 7
191 Sigma-Aldrich**
PGK1* NM_000291 F: GAGATGATTATTGGTGGTGGAA R: AGTCAACAGGCAAGGTAATC
57.62 57.09
7 8
160 Sigma-Aldrich**
AGO2 NM_012154 F: CATGGACGCCCACCCCAATCG R: CCACTTTTCCCAACCCGCTCGT
67.15 66.71
15 16-17
333 Primer-BLAST
DICER1 NM_177438 F: GTACGACTACCACAAGTACTTC R: ATAGTACACCTGCCAGACTGT
57.13 59.36
24 25
253 Primer-BLAST
DROSHA NM_013235 F; GCAGCGCAAAGGCAAGACGC R: AGGCGGGGAGACTGTGATCCG
65.00 66.67
10 11
131 Primer-BLAST
ACTB NM_001101.3 F: CACACAGGGGAGGTGATAGC R: GACCAAAAGCCTTCATACATCTCA
59.82 59.06
6 6
169 Primer-BLAST
POLR2A - polymerase (RNA) II (DNA directed) polypeptide A, TMEM222 - transmembrane protein 222, MVK - mevalonate kinase, DEFB1 - defensin beta 1, PPIA - peptidylprolyl isomerase, GAPDH - glyceraldehyde-3-phosphate dehydrogenase, RPLP0 - ribosomal protein large P0, PGK1 - phosphoglycerate kinase 1, AGO2 - argonaute RISC catalytic compound 2, DICER1 - dicer 1, ribonuclease type III, DROSHA - drosha, ribonuclease type III, ACTB – actin, beta, F - forward, R - reverse * sequences taken from previous study (Jacobsen, 2013) ** Tm values for primers generated using primer-BLAST for specific conditions of the qPCR assay in this study *** Sigma-Aldrich primers not designed by this laboratory
![Page 24: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/24.jpg)
Bacterial modulation of RNAi machinery
23
Table 2. Comprehensive ranking of reference gene candidates by calculation of a geometric mean for HT-29 data set. Genorm+ BestKeeper Normfinder ΔCq Previous
ranking1 New
ranking2 Geometric
mean
PGK1 PGK1 PGK1 PGK1 PGK1 PGK1 1.000
RPLP0 PPIA DICER DICER GAPDH DICER* 2.632
PPIA DICER PPIA PPIA PPIA PPIA 2.711
DICER POLR2A POLR2A GAPDH POLR2A RPLP0 4.356
GAPDH RPLP0 MVK POLR2A TMEM222 POLR2A 5.030
DROSHA MVK RPLP0 RPLP0 MVK GAPDH 5.595
MVK GAPDH GAPDH MVK RPLP0 DROSHA* 5.856
POLR2A DROSHA DROSHA DROSHA DEFB1 MVK 6.192
TMEM222 TMEM222 TMEM222 TMEM222 TMEM222 9.000
ACTB ACTB ACTB ACTB ACTB* 10.00
DEFB1 DEFB1 DEFB1 DEFB1 DEFB1 11.00 Genes are ranked with the most stable positioned first (top) and the least stable positioned last (bottom). * newly introduced candidate for this study 1 Rankings generated from previous study (Jacobsen, 2013) 2 Rankings genrated from the current study
![Page 25: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/25.jpg)
Bacterial modulation of RNAi machinery
24
Table 3 . Comprehensive ranking of reference gene candidates by calculation of a geometric mean for VK2/E6E7 data set.
Genorm+ BestKeeper Normfinder ΔCq Previous ranking1
New ranking2
Geometric mean
RPLP0 RPLP0 RPLP0 RPLP0 TMEM222 RPLP0 1.000
ACTB ACTB TMEM222 TMEM222 PPIA TMEM222 3.440
GAPDH GAPDH PPIA PPIA RPLP0 ACTB* 3.600
PGK1 PGK1 POL2RA POLR2A PGK1 PPIA 4.054
TMEM222 PPIA PGK1 PGK1 DEFB1 GAPDH 4.409
PPIA POLR2A GAPDH ACTB POLR2A PGK1 4.472
POLR2A TMEM222 ACTB GAPDH MVK POLR2A 5.091
DEFB1 DEFB1 DICER DEFB1 GAPDH DEFB1 8.239
MVK MVK DEFB1 DICER DICER* 9.212
DICER DICER MVK MVK MVK 9.487
DROSHA DROSHA DROSHA DROSHA DROSHA* 11.00 Genes are ranked with the most stable positioned first (top) and the least stable positioned last (bottom). * newly introduced candidate for this study 1 Rankings generated from previous study (Jacobsen, 2013) 2 Rankings genrated from the current study
![Page 26: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/26.jpg)
Bacterial modulation of RNAi machinery
25
Figure Legends
Figure 1 Comparison of reference gene rankings based on cell type and bacterial
challenge: Gene names are around the outside of the wheel. The further away from the centre
the line is the better the reference gene. Where lines are close together along the spoke, a
better correlation between analyses is indicated. A. HT29 data set. Blue: combined data set.
Red: Lactobacillus acidophilus NCFM used as the commensal strain. Green: Lactobacillus
rhamnosus GR-1 used as the commensal strain. B. VK2/E6E7 data set. Blue: combined data
set. Red: L. acidophilus NCFM used as the commensal strain. Green: L. rhamnosus GR-1
used as the commensal strain. C. Comparison of combined data sets of the HT29 and
VK2/E6E7 cell lines. Blue: HT29. Red: VK2/E6E7.
Figure 2 Changes to mRNA expression of AGO2: Data is shown as mean±s.d. All
significance indicated is relative to control. C = control, TNF = TNFα, N = Lactobacillus
acidophilus NCFM, Gr1 = Lactobacillus rhamnosus GR-1, and Gr12 = heat-killed
Escherichia coli GR-12 A. In HT29 cells we found a significant decrease in mRNA
expression of AGO2 after treatment with L. acidophilus NCFM and L. rhamnosus GR-1. We
also noted a significant increase after treatment with TNFα. (control -> TNF, p = 0.0459;
control -> N, p = 0.0399; control -> Gr1, p = 0.0017; Gr-1 -> Gr12, p = 0.0441; n = 5; * p <
0.05, ** p < 0.01)
B. . In VK2/E6E7 cells we found a significant decrease in mRNA expression of AGO2 after
all bacterial treatments (control -> NCFM, p = 0.0089; control -> Gr-1, p = 0.0058; control ->
Gr12 = 0.0011; control -> NCFM/Gr12, p = 0.0008; control -> Gr-1/Gr12, p = 0.0041; n = 3;
** p < 0.01, *** p < 0.001)
Figure 3 Changes to mRNA expression of DICER1: Data is shown as mean±s.d. All
significance indicated is relative to control. C = control, TNF = TNFα, N = Lactobacillus
acidophilus NCFM, Gr1 = Lactobacillus rhamnosus GR-1, and Gr12 = heat-killed
Escherichia coli GR-12 A. In HT29 cells we found a significant decrease in mRNA
expression of DICER1 only after treatment with heat-killed E. coli GR-12 (control -> Gr12, p
![Page 27: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/27.jpg)
Bacterial modulation of RNAi machinery
26
= 0.0478; n = 3; * p < 0.05) B. In VK2/E6E7 cells we found a significant decrease in mRNA
expression of DICER1 after all bacterial treatments (control -> NCFM, p = 0.0039; control ->
Gr-1, p = 0.0203; control -> Gr12, p = 0.0002; control -> NCFM/Gr12, p = 0.0014; control ->
Gr-1/Gr12, p = 0.0048; n = 3; * p < 0.05, ** p < 0.01, *** p < 0.001)
Figure 4 Changes to mRNA expression of DROSHA: Data is shown as mean±s.d. All
significance indicated is relative to control. C = control, TNF = TNFα, N = Lactobacillus
acidophilus NCFM, Gr1 = Lactobacillus rhamnosus GR-1, and Gr12 = heat-killed
Escherichia coli GR-12 A. In HT29 cells we found a significant decrease in mRNA
expression of DROSHA only after all bacterial treatments, except L. acidophilus NCFM. We
also noted a significant decrease in DROSHA mRNA after treatment with TNFα (control ->
TNF, p = 0.0172; control -> Gr-1, p = 0.0038; control -> Gr12, p = 0.0388; control ->
NCFM/Gr12, p = 0.0077; control -> Gr-1/Gr12, p = 0.0047; n = 3; * p < 0.05. ** p < 0.01) B.
In VK2/E6E7 cells we found a significant decrease in mRNA expression of DICER1 after all
bacterial treatments except L. rhamnosus GR-1 (control -> NCFM, p = 0.0232; control ->
Gr12, p = 0.0044; control -> NCFM/Gr12, p = 0.0065; control -> Gr-1/Gr12, p = 0.0294; n =
3; * p < 0.05. ** p < 0.01)
![Page 28: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/28.jpg)
Bacterial modulation of RNAi machinery
27
Figure 1 A. HT29
B. VK2
C. HT29 vs VK2
0 2 4 6 8 10 12
PGK1
DICER
PPIA
RPLP0
POLR2A
GAPDH DROSHA
MVK
TMEM222
ACTB
DEFB1
All
NCFM
Gr-‐1
0 2 4 6 8 10 12
PGK1
DICER
PPIA
RPLP0
POLR2A
GAPDH DROSHA
MVK
TMEM222
ACTB
DEFB1
All
NCFM
Gr-‐1
0 2 4 6 8 10 12
PGK1
DICER
PPIA
RPLP0
POLR2A
GAPDH DROSHA
MVK
TMEM222
ACTB
DEFB1
HT29
VK2
![Page 29: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/29.jpg)
Bacterial modulation of RNAi machinery
28
Figure 2 A. HT29
B. VK2/E6E7
0 0.2 0.4 0.6 0.8 1
1.2 1.4 1.6 1.8 2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ AGO
2
Treatment
**
0 0.2 0.4 0.6 0.8 1
1.2 1.4 1.6 1.8 2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ AGO
2
Treatment
** ** ** ***
**
*
*
![Page 30: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/30.jpg)
Bacterial modulation of RNAi machinery
29
Figure 3 A. HT29
B. VK2/E6E7
0 0.2 0.4 0.6 0.8 1
1.2 1.4 1.6 1.8 2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ DICER1
Treatment
*
0 0.2 0.4 0.6 0.8 1
1.2 1.4 1.6 1.8 2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ DICER1
Treatment
** *
*** ** **
![Page 31: Advanced(Project(Thesis(in(Biology( 30hp( VT2013(675844/FULLTEXT01.pdf · 2013. 12. 4. · Advanced(Project(Thesis(in(Biology(30hp(VT2013(! ((((Lactobacilli(suppressgeneexpressionofkey(proteinsinvolvedinmiRNA(biogenesisin](https://reader035.vdocuments.mx/reader035/viewer/2022071510/612e27671ecc51586942a21e/html5/thumbnails/31.jpg)
Bacterial modulation of RNAi machinery
30
Figure 4 A. HT29
B. VK2/E6E7
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ DRO
SHA
Treatment
* **
* ** **
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
C TNF N Gr1 Gr12 N/Gr12 Gr1/Gr12
Fold Change -‐ DRO
SHA
Treatment
* ** ** *