adrenergic regulation of adipose tissue ......more specifically i need to thank vanessa michelizzi...
TRANSCRIPT
![Page 1: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/1.jpg)
ADRENERGIC REGULATION OF ADIPOSE TISSUE LIPOLYSIS IN
TRANSITION DAIRY CATTLE BASED ON GENETIC MERIT AND ENERGY
INTAKE
By
SHAWNESE MARIE ROCCO
A thesis submitted in partial fulfillment of the requirements for the degree of
MASTER OF ANIMAL SCIENCE NUTRITION
Washington State University Department of Animal Sciences
AUGUST 2010
![Page 2: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/2.jpg)
ii
To the Faculty of Washington State University:
The members of the Committee appointed to examine the thesis of Shawnese
Marie Rocco find it satisfactory and recommend that it be accepted.
John P. McNamara, Ph.D., Chair Derek McLean, Ph.D. Joseph H. Harrison, Ph.D.
![Page 3: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/3.jpg)
iii
ACKNOWLEDGMENT
I would like to thank the faculty and staff of the Department of Animal
Sciences for providing the facilities and supportive environment that made this
thesis possible. This department has been nothing but supportive.
I would also like to acknowledge and thank Dr. McNamara for being a
supportive and effective advisor. I am truly grateful for your dedication to my
success and for inspiring me to do better.
Thank you, as well, to Dr. Derek McLean and Dr. Joe Harrison for serving on
my committee. You were a great resource to turn to and I very much appreciate you
taking the time to help me finish this great project.
I would like to extend my deepest gratitude to my parents, my sister, my
boyfriend, and my closest friends for providing me the strength to finish this
accomplishment. Thank you for your unwavering support, advice, and love because
without it I would never have made it this far.
More specifically I need to thank Vanessa Michelizzi for never failing to help
me get through every rough patch I’ve encountered in college from the first day I
met her as my roommate freshman year, until today as a fellow graduate student
and neighbor. I would never have made it through if you hadn’t been there.
![Page 4: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/4.jpg)
iv
ADRENERGIC REGULATION OF ADIPOSE TISSUE LIPOLYSIS IN
TRANSITION DAIRY CATTLE BASED ON GENETIC MERIT AND ENERGY
INTAKE
Abstract
by Shawnese Marie Rocco, M.S. Washington State University
August 2010 Chair: John P. McNamara
In lactating dairy cattle the adipose tissue stores energy as triacylglycerol
(TAG) that can be used during early lactation. Breakdown of TAG (lipolysis) is
regulated by stimulation of the beta-2 adrenergic receptors (β2
Cows were selected for genetic merit (high merit, HM; low merit, LM) based
on sire predicted transmitting ability of milk (PTAM) and fed to requirements (NE)
or to 90% of energy requirements (LE). We took adipose tissue biopsies at 21 and 7
days prepartum; and 7, 28, and 56 DIM to determine rates of lipogenesis and
lipolysis; and to measure gene expression of key lipolytic genes (β
AR) leading to
activation of hormone-sensitive lipase (HSL). It is not known whether control of
lipolysis is also a function of increased expression of mRNA for the ß2-adrenergic
receptor, HSL, and perilipin (PLIN). A decrease in rates of lipogenesis (fatty acid
synthesis) also occurs in early lactation. Therefore, objectives of this project were to
help define adipocyte responses to lactation and energy deficit, including changes in
expression of proteins known to control lipid metabolism.
2, HSL, and
![Page 5: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/5.jpg)
v
PLIN). The cows on the LE diet consumed 12% less feed prepartum and 16% less
feed postpartum. Dietary energy restriction decreased milk production overall but
HM, LE fed animals produced more milk (P < 0.03).
Serum glucose was relatively unchanged and serum NEFA were highest at 7
DIM (P < 0.02). The slowest rates of lipogenesis occurred at 7 and 28 DIM (P <
0.001). HM cows had faster rates than LM cows (P < 0.04) and dietary restriction
further decreased (P < 0.05) lipogenesis in early lactation. Lipolysis increased (P <
0.03) in early lactation in a pattern consistent with differences in milk production.
The expression of β2
AR, HSL, and PLIN did not change expression in NE cows due
to lactation, but expression was decreased in early lactation by dietary restriction (P
< 0.05). Data from this experiment support the hypothesis that regulation of
adipose tissue metabolism in lactation is a function of diet and genetic merit and is
controlled by multiple mechanisms including gene transcription and post-
translational protein modifications.
![Page 6: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/6.jpg)
vi
TABLE OF CONTENTS Page
ACKNOWLEDGMENT ..................................................................................... iii
ABSTRACT ....................................................................................................... iv
LIST OF FIGURES ......................................................................................... viii
LIST OF TABLES .............................................................................................. xi
CHAPTER
1. INTRODUCTION..................................................................................1
2. EXPRESSION OF GENES CONTROLLING LIPOLYSIS IN
TRANSITION DAIRY CATTLE ...........................................................2
Review of Pertinent Literature .....................................................2
Materials and Methods ................................................................ 17
Results and Discussion ................................................................ 25
Feed Intake .............................................................................. 25
Milk Yield ................................................................................29
Body Weight, Body Condition Score, and
Empty Body Fat...................................................................... 33
Blood Nutrients .......................................................................37
Glucose ............................................................................... 37
Non-esterified Fatty Acids, and Energy Balance ............. 39
Rates of Lipogenesis in Adipose Tissue in vitro ..................... 43
Rates of Lipolysis in Adipose Tissue in vitro ......................... 50
![Page 7: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/7.jpg)
vii
Gene Expression ...................................................................... 57
Beta-2 Adrenergic Receptor ......................................................... 58
Hormone Sensitive Lipase ........................................................... 62
Perilipin ....................................................................................... 65
3. ANALYSIS AND CONCLUSIONS ............................................... 69
REFERENCES .................................................................................................. 71
![Page 8: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/8.jpg)
viii
LIST OF FIGURES
1a. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake over time ................................. 27 1b. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit over time ............................................... 28 2a. Milk yield (kg/DM) of cows varying genetic merit fed normally or an energy restricted diet, effect of energy intake ............................................. 31 2b. Milk yield (kg/DM) of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit .............................................. 32 3. Rate of lipogenesis in cows of varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake and genetic merit ...................................................................................................... 48 4. Rate of lipogenesis in cows of varying genetic merit fed normally or an energy restricted diet, effect of dietary energy intake and genetic merit ...................................................................................................... 49
![Page 9: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/9.jpg)
ix
LIST OF TABLES
1. Dietary Ingredients and Chemical Composition .......................................... 22 2. RT-PCR Primers Used for Determining Gene Expression in Bovine Adipose Tissue ................................................................................................... 24 3. Feed intake of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit, energy intake, and parity prepartum and Postpartum ................................................................................................. 26 4. Milk yield (kg/d) of cows varying genetic merit fed normally or an energy restricted diet, effect of genetic merit, energy intake, and parity ... ....................................................................................................... 30 5. Body weight (BW), body condition score (BCS), and empty body fat (EBF) of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit ....................................................... 35 6. Serum glucose (mg/dL) of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit across target days in Milk ................................................................................. 38 7. Serum NEFA (µM) concentration of cows varying genetic merit fed normally or an energy restricted diet, interaction effect of diet and genetic merit across target days in milk........................................................... 41 8. Estimated energy balance (Mcal/d) of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit interaction across target days in milk .............................................................. 42 9. Rates of lipogenesis of cows varying genetic merit fed normally or an energy restricted diet, overall diets and genetic merit; effect of parity .......... 44 10. Rates of lipogenesis of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit .................................... 46
![Page 10: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/10.jpg)
x
11. Rates of lipolysis of cows varying genetic merit fed normally or an energy restricted diet, effect of parity ............................................................... 52 12. Rates of lipolysis of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit .................................... 55 13. Beta-2 adrenergic receptor gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ...................................................................................................... 60
14. Hormone sensitive lipase gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ...................................................................................................... 63 15. Perilipin gene expression of cows varying genetic merit fed normally or an energy restricted diet, effect of diet and genetic merit ........................... 67
![Page 11: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/11.jpg)
1
Introduction
The transition period around parturition in dairy cattle is a time of increased
metabolic stress. Many cows, though not all, experience a negative energy balance
during this period that impacts metabolic efficiency. Ideally, cows need to not only
produce many pounds of milk but also maintain body condition and body fat
reserves to supply the demand of milk production and maintain health status.
Dairy managers can lose around $30,000 per 100 head (“Metritis: A Foul Disease
With Financial Costs”, 2010) annually because of metabolic disorders such as
metritis, displaced abomasum, milk fever, mastitis, and ketosis resulting from a
poor plane of nutrition during the transition period. Sumner and McNamara (2007)
and others have shown that in addition to parity and dietary energy intake, genetic
merit plays a tremendous role in metabolic status and thus efficiency during the
transition period.
Present research is integrating knowledge regarding the interaction of
genetics and nutritional status, commonly referred to as nutrigenetics or
nutrigenomics. The emerging field of nutrigenomics aims to study how diet affects
specific genes and nutrigenetics aims to determine how expression of genes affect
how individuals respond to specific nutrients (Mutch et al., 2005). Research is
needed to elucidate more specific integrated knowledge of metabolism, gene
expression, and overall production. One application of this systems approach could
be to select for higher genetic merit cows that will produce the same amount or
more milk by minimizing a negative energy balance and resulting loss of efficiency.
![Page 12: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/12.jpg)
2
The overall hypothesis was that animals that vary in genetic merit for milk
production and in energy intake will have a different pattern of lipid metabolism in
the adipose tissue, including expression of key regulatory genes.
Thus, the objective of this experiment was to investigate the mechanisms
involved in lipid mobilization and utilization in adipose tissue as these mechanisms
relate to the interaction of genetics and diet. The experiment was designed to
determine whether or not specific genes known to control lipid metabolism are
altered in expression in adipose tissue of dairy cattle with varied genetic merit and
energy intake.
Lipolysis and Lipogenesis in Adipose Tissue
Review of Pertinent Literature
Lactation is considered one of the most versatile and important developments
in the evolution of mammals. Mammals are adapted to carry a food-producing
organ for their young that provides for greater efficiency and adaptability to
seasonal, predatory, or climatic changes to increase survival rates. Wild-type
mammals tend to produce just enough milk to nourish their offspring; however,
humans have domesticated animals and selected them for increased milk
production to provide milk for human consumption.
Even though we have selected for rapid rates of milk production and
extended lactation periods in dairy cattle, the underlying common patterns of
regulation of nutrient use are still present. All mammals generally undergo a
period of transient reduction in food intake near parturition, followed by a rapid
![Page 13: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/13.jpg)
3
increase in mammary growth, milk secretion, and concomitant demand for
nutrients. In first lactation animals the mammary gland undergoes extensive
growth and development in addition to the demand for milk secretion. The female
often responds by quickly increasing feed intake. In mammals as diverse as the
order rodentia; and the families of canidae, felidae, bovidae, and suidae, feed intake
can double in one or two days and increase three to five times the normal level in
one to several weeks (Verstegen et al., 1985; Munday and Earle, 1991; Case, 1999;
Tyler and Ensminger, 2006; Peterson and Baumgardt, 1971).
A correlate of the evolution of lactation has been the evolution of adipose
tissue. In mammals, adipose has become a highly active and adaptable organ. In
wild-type mammals, adipose tissue stores energy dense triacylglycerols in periods of
nutritional abundance (as in spring, summer, and early fall) to provide energy when
nutrient supply is limited in winter. Interestingly, many thousands of years of
domestication have not altered the circadian nature of body fat storage and use; as
domesticated animals still demonstrate a seasonal cyclicity of body fat reserves
(Vernon et al., 1997; McNamara et al., 1986).
In addition to the seasonal cyclicity, mammals in their reproductive years
have an additional pattern superimposed on the functions and amounts of adipose
tissue. In early pregnancy, mammals store an increased amount of body fat even
when energy intake is moderately limited. Later in pregnancy this energy can be
used to support rapid fetal growth, and then at the initiation of lactation, the body
fat can be used to provide fatty acids and glycerol for milk fat and lactose synthesis
![Page 14: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/14.jpg)
4
as well as for energy use in other organs. This pattern of adipose tissue use is
present in all mammals but has been finely manipulated and developed through
selection in domesticated mammals, especially the dairy cow.
Selection for rapid rates of milk production has resulted in a large proportion
of dairy cattle that do not increase their rate of nutrient intakes quickly enough to
avoid a period of nutrient deficit. For many years this period of nutritional
deficiency resulted in an increased incidence of metabolic diseases and reproductive
problems. In the population of lactating dairy cattle, regardless of parity, genetic
merit, and management intensity; there is wide variation in milk production,
increase in feed intake in response to higher demand for milk production, and an
increase in metabolic diseases due to the negative energy balance that high
producing dairy cows incur during lactation. The U.S. Holstein population is not a
genetically or environmentally homogenous population; so during the peri-
parturient period the herd and individual cows within the herd vary in how much
energy they need to support milk production and maintain normal body function.
During the late 20th century there was an increasing trend in dairy cattle to
develop metabolic diseases such as ketosis, milk fever, displaced abomasum,
retained placenta, bloat, acidosis, and fatty liver as a function of being in an intense
or constant negative energy balance (Drackley, 1999; Tyler and Ensminger, 2006).
However, with increased emphasis on nutritional and environmental management,
nutritionists now do a much better job of formulating and feeding rations balanced
for proper nutrient content which are prepared and fed to maximize intake. As a
![Page 15: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/15.jpg)
5
result of better management practices the incidence of most metabolic diseases has
declined dramatically. Nevertheless, there remains a wide variation not only in
milk production but in voluntary feed intake regardless of milk production level in
cows in the same herd on the same rations. There are continued presences of
subclinical metabolic deficiencies in energy and other nutrients that diminish
overall efficiency (Mulligan and Doherty, 2008). One aspect of the control of feed
intake and therefore clinical diseases, subclinical diseases, and milk production is
the metabolism of lipid in the adipose tissue.
Cows mobilize fat reserves to support milk production and without adequate
fat reserves the cow is unable to meet her genetic potential for milk production
because they are in a negative energy balance. However, there are usually high
producing cows in a herd that eat substantially more than their herd mates and, at
the same productive level, have less or even no negative energy balance
(Schactshneider et al., 2009). While many cows will go into that negative energy
balance, there are some cows—that even on a restricted energy diet—will not go
into as negative of an energy balance and can still maintain high milk production
(McNamara and Valdez, 2005; Schactshneider et al., 2009; Sumner and McNamara,
2007). Thus, adipose tissue can be a limiting factor in milk production.
These high producing and feed efficient cows are those that producers need.
Improvement of selection criteria to increase the overall milk production yield, feed
efficiency, and economic return of the herd would be beneficial. Theoretically, if
producers can select for a cow that meets her milk production potential with
![Page 16: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/16.jpg)
6
minimal negative energy balance and loss of body fat to produce a high milk yield,
we can produce more milk with fewer cows and the cost of feeding would decrease.
McNamara (1989) demonstrated that cows with an introduced energy
restriction of around 13%, due to increased forage content, showed a decrease in
milk production of about 7%. The cows that showed the highest weight gain were,
interestingly, low genetic merit cows fed a high energy diet, suggesting that lower
genetic merit cows will partition more energy toward weight gain on a diet
optimally formulated for energy. The cows that showed lower gains in weight
illustrate that, during lactation, nutrients are prioritized to the mammary gland for
milk synthesis before rebuilding body fat reserves (McNamara, 1989). What we
ideally want are animals that partition energy to both milk yield and body
maintenance or growth. By looking at genetic merit and energy intake we can
determine which cows express key genes indicative of high milk yield, high feed
efficiency, and a milder negative energy balance during the periparturient period.
A period of negative energy balance can lead to a decrease in pregnancy rates
(Tyler and Ensminger, 2006). Many cows will decrease feed intake around
parturition which increases fat mobilization and the risk of metabolic disorders; as
well as possibly decrease milk production in both the short term and long term
reproductive life of the cow (Roche, 2006). A loss in reproductive efficiency is also a
loss in productivity which ultimately causes a loss in profit. This presents the
problem of ensuring that cows achieve a positive energy balance more quickly to
maintain efficient fertility and decrease the susceptibility to metabolic disorders.
![Page 17: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/17.jpg)
7
In general, high producing cows tend to be more susceptible to metabolic
disorders than low producing cows (Guo et al., 2007, Guo et al., 2008), which implies
that higher producing cows that do not consume enough energy will be forced into a
more negative energy balance than the lower producing cows. Guo et al. (2008)
have developed a model based on NEFA and insulin concentrations in peri-
parturient cows and heifers to assess and perhaps predict the occurrence or relative
risk of a cow or heifer developing ketosis. However, the metabolic pathways and
their regulation underlying the model need to be understood completely to define
the variation and reasons why these animals may develop a metabolic disorder.
The major pathways of lipid metabolism in white adipose tissue include
lipogenesis, lipolysis, and ß-oxidation. During the peri-parturient period, lipolysis
increases and stays elevated throughout lactation whereas lipogenesis (or fat
synthesis) decreases greatly during early lactation and increases during mid-
lactation (McNamara et al., 1986; Doris et al., 1996). Lipogenesis is the process of
free fatty acid conversion to triacylglyerol (TAG). During nutrient deprivation there
is an increase in lipolysis and ß-oxidation to utilize fat stores for energy. Lipolysis
is the breakdown of triglycerides into free fatty acids and glycerol to be used for
energy. The free fatty acids are then oxidized to CO2 in ß -oxidation for energy and
glycerol is recycled to form more triglycerides or is used in the synthesis of
phospholipids to maintain the lipid membrane. The primary purpose of lipolysis is
to provide fatty acids for milk fat synthesis as well as energy. However, it is often
overlooked that in the dairy cow the glycerol released from adipose tissue can
![Page 18: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/18.jpg)
8
provide glucose for milk lactose synthesis, possibly as much as 15% of the total
(Hanigan et al., 2007).
Rates of adipose tissue lipolysis and lipogenesis differ in animals depending
on age, physiological state, and energy intake (McNamara, 1994). In the transition
period there is often a substantial increase in lipolysis. There is already a fairly
developed knowledge base on the control of lipid metabolism; therefore current
research is concentrating on the details of the multi-faceted mechanisms regulating
lipolysis, including the mechanisms of genetic and transcriptome regulation.
Regulation of Lipolysis
Adrenergic Stimulation
Due to its key role in energy balance, the regulation of lipolysis was studied
in great detail during the 1960s and 1970s, at which time researchers such as Metz
and Van den Bergh (1971), Yang and Baldwin (1973), and Guidicelli et al. (1974)
were able to begin to elucidate the metabolic control of lipolysis. Scientists observed
that in a starved state certain metabolic pathways such as the G-coupled protein
receptor pathway of ß-agonist receptors which, once activated, converts adenyl
cyclase to cyclic AMP, (Gorman et al., 1972 and 1973) signal the cascade of events
that lead to the breakdown of triglycerides. The early work on lipolysis led to
development of the ‘fight or flight response’. This response, activated by the binding
of the catecholamines (epinephrine or norepinephrine) to a ß-adrenergic receptor,
signals the cascade of events that lead to the release and breakdown of
triacylglycerols from the adipocyte for immediate energy (Burns et al., 1981;
![Page 19: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/19.jpg)
9
Lefkowitz, 1974). Evolutionarily, this response allows an animal to escape a
dangerous situation or predator with a quick burst of energy for either fighting or
running away to enhance the chances of survival. In dairy cows, this catecholamine
mediated response is a survival mechanism to provide energy in times of nutrient
deprivation to be partitioned to milk production. Humans, by genetically selecting
for higher producing cows, have capitalized on this adrenaline response to increase
milk yield.
Adipocytes are in a constant flux of lipolysis and lipogenesis. During
lactation, the rate of lipolysis increases in response to the negative energy balance
(Bauman and Vernon, 1993). Hormonally, lipolysis is signaled by the
catecholamines epinephrine and norepinephrine that bind to the beta-adrenergic
receptor and activate a G-protein coupled receptor to convert adenyl cyclase to cyclic
AMP. Cyclic AMP activates protein kinase A (PKA) to phosphorylate hormone
sensitive lipase (HSL) to its active state. In addition, PKA phosphorylates the co-
factor protein perilipin (PLIN), which allows HSL to access the hydrophobic
triacylglycerol (TAG) droplet. Hormone sensitive lipase activates the breakdown of
TAGs into free fatty acids. Free fatty acids are then oxidized through ß-oxidation in
the mitochondria of various organs to CO2
The actions of catecholamines also inactivate acetyl CoA carboxylase to
decrease lipogenesis. Insulin elicits the opposite response of the catecholamines by
inactivating cyclic AMP and activating acetyl CoA carboxylase to increase
lipogenesis (Salway, 2004). The role of transcription in control of lipogenesis has
for energy.
![Page 20: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/20.jpg)
10
been fairly well established. In lactating dairy cattle, lipolysis may be controlled by
increased expression of mRNA for the ß2-adrenergic receptor, HSL, and PLIN
during the transition period (Sumner and McNamara, 2007). However, the body of
knowledge on this process is limited and we need to determine more specifically the
quantitative complex of control of lipolysis.
Hormone Sensitive Lipase
Hormone sensitive lipase in the adipose tissue is an 86 kDa cytoplasmic
protein (Shen et al., 1999). Holm et al. (1988) showed that hormone sensitive lipase
responds negatively to insulin, positively to catecholamines, and has no sequence
homology to other lipases. There are both a long form and short form codes for a
protein isoform of hormone sensitive lipase that is involved in lipolysis while the
long form is important for steroidogenesis in the testes (Kraemer, 2002).
Perilipin
Perilipin A is a 57 kDa protein that coats lipid droplets to prevent them from
being hydrolyzed by lipases such as hormone sensitive lipases (Kern et al., 2004).
Perilipin A is the primary perilipin involved in adipocyte metabolism. During
lipolysis, perilipin is phosphorylated by protein kinase A (PKA) that causes a
conformational change in the protein coating to allow lipases access to the lipid
droplet contents (Kern et al., 2004). The triacylglcerols in the lipid droplet can then
be hydrolyzed to non-esterified fatty acids (NEFAs). Sumner and McNamara (2007)
showed that PLIN mRNA levels were very highly expressed in bovine adipocytes
and was increased in adipose tissue at 90 DIM. There was a much smaller increase
![Page 21: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/21.jpg)
11
in PLIN mRNA levels during early lactation when there is greatly increased
lipolysis. It may be that by 90 DIM, when milk production is at maximal rates,
increased expression of PLIN is needed to make more of this protein to maintain
fast rates of lipolysis. It is as yet unclear if perilipin has any regulatory role in
control of lipolysis, or a constitutive permissive role.
ß -adrenergic receptors
There are three ß-adrenergic receptor subtypes known with a possible fourth
involved in cardiac muscle function (Galitsky et al., 1997; Chruscinski et al., 1999;
Kaumann et al., 1998; Grujic et al., 1997; Cao et al., 1998; McNeel and Mersmann,
1999; Pietri-Rouzel et al., 1995; Sillence and Matthews, 1994; Forrest and Hickford,
2000; Liang and Mills, 2002). Beta-adrenergic receptors are found in many cells
and are old proteins found in simple invertebrates as part of a rudimentary neural
response system (Stiles et al., 1984). In general, the expression of the ß-adrenergic
receptor subtypes is involved in adipose metabolism in rodents, pigs, and cattle
(Castiella et al., 1994; Galitsky et al., 1997; Cao et al., 1998; Chruscinski et al.,
1999; Kaumann et al., 1998; Grujic et al., 1997; McNeel and Mersmann, 1999;
Mersmann 1996; Mersmann et al., 1997). The ß2-adrenergic receptor subtype is
most involved in lipolysis in cattle, if not all ruminants (Sumner and McNamara,
2007; Chruscinski et al., 1999) whereas the ß3-adrenergic receptor subtype is the
primary adrenergic receptor for lipolysis in humans, rodents, and other non-
ruminant mammals (Chruscinski et al., 1999; Grujic et al., 1997; McNeel and
Mersmann, 1999; Mersmann, 1996; Mersmann et al., 1997). The ß1-adrenergic
![Page 22: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/22.jpg)
12
receptor subtype, in dairy cattle, is the least expressed of the three known ß-
adrenergic receptor subtypes (Sumner and McNamara, 2007) while the ß-
adrenergic receptor subtype that induces lipolysis strongest is the ß2-adrenergic
receptor subtype.
Receptor Desensitization
Receptor activity and responsiveness can be decreased if exposed to chronic
stimulation over time, also tending to decrease the affinity for receptor agonists to
bind (Portillo et al., 1995). This desensitization is either a decrease in affinity for
receptor agonists or down regulation of receptor synthesis (Carpéné, 1992).
Beta adrenergic receptors are found within the G-coupled protein receptor
family and are characterized within the seven transmembrane g-coupled protein
receptor (7TMR) superfamily. A ligand binds to the 7TMR which causes a
conformational change in the receptor at the carboxyl group intracellularly. This
conformational change either promotes the activation of a second messenger
system, such as cyclic AMP (cAMP), or an inhibitory system through
phosphorylation of a G protein-coupled receptor kinase (GRK) that promotes the β-
arrestin adaptor protein to inhibit the second messenger activity (Rajagopal et al.,
2010). The β-arrestins desensitize the receptor by recruiting enzymes to degrade
the second messenger cAMP (Rajagopal et al., 2010). While desensitizing the
adrenergic receptors will reduce second messenger systems such as the cAMP
pathway that leads to lipolysis, the desensitization does not completely shut down
the entire system (Vicario et al., 1997). While this experiment did not focus on the
![Page 23: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/23.jpg)
13
endocrinology of the 7-transmembrane receptor superfamily it is important to note
that current research in this area is finding that 7TMR and the ligands that bind
them have the ability to selectively recruit β-arrestins and or GRKs for regulating
the pathways activated by the ligands. For example, Β2AR ligands bind the
receptor, causing a conformational change that can allow the receptor to selectively
recruit β-arrestins (Rajagopal et al., 2010, Drake et al., 2008). These β-arrestins
recruit a signaling scaffold to recruit proteins that can internalize and essentially
desensitize the β2ARs (Drake et al., 2008, Willoughby et al., 2007). β-arrestins have
been shown to reduce the amplitude of cAMP signals by possibly recruiting
phosphodiesterase-4D to degrade cAMP, which leads to the attenuating β2AR
signals observed during β-arrestin recruitment (Willoughby et al., 2007).
Lipogenesis
Lipogenesis is the process of synthesizing triacylglycerol via esterification of
fatty acids and glycerol. Mature adipocytes in the adipose tissue are made up of a
lipid droplet containing primarily triacylglycerol. During homeostasis lipogenesis is
in simultaneous flux with lipolysis so that the animal generally is constantly
breaking down and rebuilding adipose stores. However, during lactation the
demand for energy increases and as a result lipogenesis is typically reduced to an
altered state of flux known as homeorhesis (Bauman and Currie, 1980). For
example, Tepperman and Tepperman (1970) discussed how animals in a starved
state will decrease rates of lipogenesis to mobilize body energy stores, typically in
the form of adipose. In contrast, when animals are refed, rates of lipogenesis
![Page 24: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/24.jpg)
14
increased and surpassed rates of lipolysis to rebuild the energy stores lost to
starvation.
Glucose supply is the major driver of lipogenesis. Lipogenesis is a major
component of adipose tissue metabolism during the transition period in dairy cattle.
Rates of lipogenesis in relation to rates of lipolysis indicate the effect of negative
energy balance in a cow and perhaps how quickly the cow can reach a positive
energy balance. Research done in this laboratory demonstrated that lipogenesis is
highly sensitive to energy intake, falling quickly to zero as energy balances reduces
to zero (McNamara and Hillers, 1986). In addition, animals of higher genetic merit
for milk production have lower rates of lipogenesis even at the same energy intake.
However, it is clear that lipogenesis is much more responsive to diet than is
lipolysis; whereas lipolysis is a function of genetic differences. Herein is the crux of
nutrigenomics and nutrigenetics in the control of efficiency in dairy cattle: what is
the totality of the mechanisms that control lipid metabolism.
Acetyl Co A
Acetyl CoA Carboxylase is an enzyme responsible for regulating lipid
mobilization and malonyl coA synthesis—which is the substrate for fatty acid
synthesis (Wakil, 2008). Insulin upregulates Acetyl CoA Carboxylase in times of
exogenous energy availability to store excess energy as glycerol and triglycerides.
Acetyl CoA Carboxylase helps regulate lipid mobilization by acting as a product and
intermediate for β-oxidation.
Control of Lipolysis and Lipogenesis During Lactation
![Page 25: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/25.jpg)
15
The mechanisms of control of lipogenesis by endogenous energy availability
and physiological state are well defined. The control of lipolysis is not as fully
understood. It is well known that lipolysis is controlled by the sympathetic nervous
system through binding of the β-adrenergic receptor and subsequent 2nd
In dairy cattle, genetic merit plays a role in determining or controlling rates
of lipogenesis and lipolysis, especially during lactation. For example, higher genetic
merit cows are able to more efficiently balance rates of lipolysis and lipogenesis to
respond to a decrease in energy balance.
messenger
cascade as defined above. However, it is not clear whether or to what extent control
of transcription affects lipolysis. In most situations lipogenesis and lipolysis are
controlled in a concerted balance to prevent the mobilization of excess energy or
unnecessary storage.
Milk production and feed efficiency are both a function of the rates of lipolysis
and lipogenesis. The cow tends to protect milk production by mobilizing body stores,
which is a function of both increased lipolysis and decreased rates of lipogenesis.
During physiological states of increased productivity the maintenance rates of
lipolysis and lipogenesis are altered to function in a different pattern, known as
homeorhesis. Usually during lactation lipogenesis decreases and lipolysis increases
to mobilize body fat to supply energy for milk production.
For example, during the transition period dairy cows will typically reduce
their feed intake around parturition which puts them at a decreased energy balance
that often becomes negative around lactation. Once the cow starts lactating she
![Page 26: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/26.jpg)
16
will typically experience an increase in lipolysis and decrease in lipogenesis. The
cow will typically experience a decrease in empty body fat, serum glucose, insulin,
and acetyl coA carboxylase which attenuates the rate of lipogenesis; while
increasing transcription of HSL, PLIN, and β2-adrenergic receptors which enhances
lipolysis. This homeorhetic increase in lipolytic protein transcription is also closely
regulated by the sympathetic nervous system release of catecholamines and other
hormones that may enhance the rates of lipolysis.
Because of the complex nature of metabolic control, and the relative lack of
knowledge on mechanisms of control of lipolysis, we conducted an experiment to
attempt to define mechanisms of lipolysis by nutrigenomic and nutrigenetic
controls. How do animals of different genetic merit control lipolysis and lipogenesis
when faced with an energy restriction that is sufficient enough to alter energy
balance, but not severe enough to be out of a normal range for the average dairy
cow? Therefore, the overall hypothesis was that animals that vary in genetic merit
for milk production and in energy intake will have a different pattern of lipid
metabolism in the adipose tissue, including expression of key regulatory genes.
Thus, the objective of this experiment was to investigate the mechanisms
involved in lipid mobilization and utilization in adipose tissue as these mechanisms
relate to the interaction of genetics and diet. The experiment was designed to
determine whether or not specific genes known to control lipid metabolism are
altered in expression in adipose tissue of dairy cattle with varied genetic merit and
energy intake.
![Page 27: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/27.jpg)
17
Methods and Materials
Animals and Treatment Protocol
Forty-eight Holstein cows from the Knott Dairy Herd (Pullman, WA) were
selected, blocked by parity (1st or 2nd) and by sire genetic merit as predicted
transmitting ability for milk (PTAM). There were 24 1st lactation and 24 2nd
lactation animals. Genetic Merit sire PTAM average was 1913 (High Genetic Merit,
HM) or 832 kg (Low Genetic Merit, LM) (SD 686). For 1st lactation animals sire
PTAM was 2072 (HM) and 787 kg (LM) and for 2nd lactation animals sire PTAM
was 1691 (HM) and 907 (LM). The 305ME for HM 2nd
Animals were fed once a day through Calan gates (American Calan, 1997;
Northwood, NH) between 10:00am and 11:00am. Animals were adapted to the
gates approximately 3 to 7 days prior to beginning dietary treatments which began
21 days prepartum and continued through 56 DIM. Normally fed (NE) animals
were fed to achieve 5 % ORTS, and LE animals were fed to achieve 90% of that
lactation animals was 30,582
kg and for LM it was 27,997 (SD 3,893), which places these animals in the top 10 %
of production in US Holsteins. Dietary treatments were either fed at TMR to
requirements (NRC, 2001; NE); or fed a TMR at 90 % of the intake of the NE group
based on intake as a percent of BW (LE) (Table 1). The LE diet was fortified with
10 % more protein as well as vitamin and mineral mixes so that was consistent
across groups, however other dietary compositions were not altered so that the
experimental model was a difference in overall energy intake regardless of energy
source.
![Page 28: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/28.jpg)
18
intake as a % of BW. Intake as a % of BW was calculated daily for adjustments.
Dietary ingredients were sampled with each new batch; the TMR and orts were
sampled weekly and composited monthly for analysis at Kuo Labs (Othello, WA)
using AOAC methods for DM, ADF, NDF, CP, fat, Ca, and P (AOAC, 2000).
Samples and Measurements
Cows were milked twice a day and yield was measured daily. Milk
composition was determined approximately monthly by DHIA sampling using
infrared spectrophotometry at the regional DHIA laboratory in Burlington, WA
(AOAC, 2000). Body weight (BW) and body condition score (BCS) (Bernabucci et al.,
2005; Waltner et al., 1994) were assessed weekly. Body weight and BCS were used
to calculate body fat (Waltner et al., 1993). Blood was collected weekly via
venipuncture of the coxygeal vessel at 28, 21, 14, 11, 7, and 4 days prepartum and
then postpartum at days 1, 3, 7, and then weekly until week 8.
Subcutaneous adipose tissue biopsies were collected at 21 and 7 days
prepartum and at 7, 28, and 56 days postpartum, from the tail head region under
spinal anesthesia (Sumner and McNamara, 2007). Part of the sample was
immediately placed in Krebs/HEPES buffer (Sumner and McNamara, 2007) at 37°
C for tissue incubations to estimate rates of lipogenesis and lipolysis and part was
immediately homogenized in Qiazol reagent (Qiagen 75842, Valencia, CA; 91355)
and the homogenate frozen until extracted for RNA.
Analytical Methods Blood serum was collected and analyzed for non-esterified fatty acids (NEFA-
![Page 29: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/29.jpg)
19
C kit; Wako Chemicals, Richmond, VA) with the modifications published previously
(McNamara and Hillers, 1986) and for glucose (Glucose (HK) Kit, Sigma-Aldrich;
St. Louis, MO).
Rates of lipogenesis were measured in vitro using adipose tissue incubated in
medium containing KREBS/HEPES buffer, 2% bovine serum albumin (fatty acid
free); 5 mM glucose and 0.5, 1, 2, 4, 8 mM acetate at 0.1 µCi/mM 2-C14
Incubations of adipose tissue were used to measure basal and stimulated
rates of lipolysis. Adipose tissue was sliced and pre-incubated in 2 ml of Krebs-
Hepes media containing 2 % bovine serum albumin (fatty acid free) for 20 min to
remove the effects of handling and slicing (McNamara and Hillers, 1986b;
McNamara and Valdez, 2005). The media was then removed and replaced with
fresh media and the tissue was incubated another 2 hours. Basal media had no
added stimulators. The response curve to beta-adrenergic receptor binding was
conducted using isoproterenol at 10
acetate, at
pH of 7.4 and 37º C for 2 hours in triplicate. The tissue was sliced to a thickness of
approximately 500 µm on a calibrated microtome (Etherton et al., 1977) and was
measured into approximately 80-100 mg slices for the triplicate incubations. After
incubation, samples were placed in DOLE’s reagent (Smith and Crouse, 1984) to be
extracted for total fatty acid synthesis. Rates were reported as mM acetate
converted to fatty acids per 2h/g tissue.
-8, 10-7, 10-6, 10-5, and 10-4 M. Adenosine
deaminase (6.6 U/ml; Calbiochem, #116880) and theophylline (1mM; Sigma-Aldrich
no. 200-305-7) were included to maximize response to isoproterenol. Rates of
![Page 30: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/30.jpg)
20
lipolysis were expressed as glycerol release in nm/g tissue per 2h.
Gene Expression
Adipose tissue was saved for mRNA extraction in duplicate, each duplicate
was placed in 5 ml of Qiazol and RNA was immediately homogenized and chilled to
-20°C until extraction; then extracted using the RNA-easy midi-kit (Qiagen 75842,
Valencia, CA; 91355). The quality of the mRNA, once extracted, was determined by
re-suspending the RNA in RNAse free water and using the NanoDrop1000 (Thermo
Fischer Scientific; Wilmington, DE) spectrophotometer to estimate RNA purity via
the ratio of A260/A280. The absorbance for pure RNA should have an A260/A280
(RNA to Protein) ratio of between 1.9 and 2.1. For most samples purity was also
assessed on a 1.2% agarose gel to visualize quality of the RNA.
First strand cDNA synthesis was performed once quality and purity of RNA
was assessed and confirmed. A reverse transcriptase (RT) and a no RT control were
made from each set of cDNA to be run on the ICycler real time PCR machine
(BioRad, Hercules, CA). The primers in Table 2 were used to determine gene
expression. Reverse transcriptase, real-time polymerase chain reaction (RT-rtPCR)
analysis was done to determine gene expression of the biopsied bovine adipose
tissue. IQ SYBR Green PCR (Bio-Rad, Hercules, CA) was the dye used to visualize
fluorescence of amplified gene products for real-time rtPCR run on the thermal
iCycler from Bio-Rad (Hercules, CA). The system software is designed to generate
and plot the data based on cycle threshold and Δ-Rn fluorescence over a given
number of cycles. A ribosomal S2 (bRPS2) protein reference gene was used against
![Page 31: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/31.jpg)
21
the primers to calculate relative gene expression (Table 2).
Experimental Design and Statistical Analysis
The experiment was designed and conducted as a randomized complete block
with repeated measures, with sire genetic merit (PTAM) and parity as blocks and
time around parturition as the repeated measure. The model for analysis was:
Yijklmn = μ + GMi + Pj+ Dk + (GM X P)ij + (GM X D)ik + (P X D)jk + (GM X P X D)ijk +
C(ijk)l + γm + αγjl + εijkl. In this model, μ is the overall mean, GMi describes the
effect of genetic merit (either high or low), Pj describes the effect of parity (either 1st
lactation or 2nd lactation), and Dk describes the effect of dietary energy (either
normal or low). The random error, C(ijk)l, is associated with the fixed effects, γm
describes the repeated measure effect of the month, day, or week; and εijkl
describes
the residual error. Data were analyzed using PROC GLM of SAS (SAS Institute,
Cary, NC), depending on the data structure.
![Page 32: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/32.jpg)
22
Table 1. Dietary Ingredients and Chemical Composition
NE NE LE LE
__________________
Item1
Feedstuff, % DM
Dry Lact. Dry Lact.
Alfalfa Hay 0 23.57 0 23.57
Alfalfa Haylage 24 25.57 24 25.57
Grass Hay 60 0 60 0
Whole Cottonseed 0 7 0 7
DGS 0 5.26 0 5.26
Concentrate Mix 16 38.6 16 38.6
Concentrate Composition
Corn 76 93 86 73
Soybean Meal 11 0 0 12.2
Peas 8 0 0 8.9
Limestone 1 1 2 1.1
Salt (TM w/ Selenium) 1 1 2 0.8
Yeast 1 1.4 3 0.67
Ammonium Oxide 0 2.5 5 0
Magnesium Oxide2
Vitamin D Premix 0.4 0.1 0 0.06
0.1 0.6 1 0.44
Vitamin A Premix 0.1 0.05 0 0.03
![Page 33: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/33.jpg)
23
(Table 1. Cont’d. )
Vitamin E Premix 0 0.1 0 0.01
4-Plex3
Sodium Bicarbonate 2 0 0 2.2
0.1 0.2 0 0.11
Seleno Yeast 0 0 0 0.02
Chemical Analysis, % DM NE Dry NE Lact LE dry LE Lact CP, % 12.4 18.5 12.7 19.0
CF, % 2.3 3.8 2.3 3.4
Cfib, % 24.5 18.5 24.4 18.2
NFE, % 50.6 50.0 49.9 51.1
ADF, % 26.3 19.6 26.3 19.8
NDF, % 37.1 24.2 37.1 24.1
Lignin, % 6.9 7.8 7.2 7.6
Ca, % 0.99 0.87 1.03 1.12
P, % 0.26 0.37 0.26 0.35
Ash, % 10.3 9.2 10.6 9.0
NEl, Mcal/kg 1.25 1.42 1.25 1.42 ____________________________________________________________________________
1. Chemical composition from analysis of individual components (AOAC, 2000)
2. Premier Chemicals, LLC, W. Conshohocken, PA
3. Zinpro Corp., Eden Prairie, MN
![Page 34: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/34.jpg)
24
Table 2. RT-PCR Primers1
Gene
Used for Determining Gene Expression in Bovine
Adipose Tissue
Genbank Access. No. Sequence, (3’-5’)
Β2 AR
NM_194266
CCCCAGGCACCGAAAACT
TCCCTTGTGAATCAATGCTATCA
HSL
NM_001080220
GAGTTTGAGCGGATCATTCA
TGAGGCCATGTTTGCTAGAG
Perilipin
NM_001083699
AGACACTGCCGAGTATGCTG
TGGAGGGAGGAGGAACTCTA
bRP S2
NM_001033613
GGAGCATCCCTGAAGGATGA
TCCCCGATAGCAACAAACG
1
Primers were designed using Primer Express 2.0 (Applied Biosystems, Foster City,
CA) and were ordered from IDT Technologies (Coralville, IA)
![Page 35: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/35.jpg)
25
Results and Discussion
Feed Intake
In this experiment the purpose of measuring feed intake, milk production,
and body fat was to provide a framework to interpret metabolic adaptations to
genetic merit and energy intake, not to re-test the well-known effects of genetics
and diet on production.
When provided with feed ad libitum (Normal) cows ate to meet their energy
demands from 21 days prepartum up to 56 DIM, as indicated by the increasing DMI
(Table 2, Figure 1a, 1b). As expected, 2nd parity cows ate more than 1st
Cows of higher genetic merit (HM) did not eat more than lower merit (LM)
animals when fed ad libitum, for all time periods. However, between 1 and 10 days
postpartum HM cows ate more than LM cows (Figure 1a); (P < 0.05). Primiparous
LM cows had the lowest feed intake (Table 3). When energy was restricted, animals
of higher genetic merit consumed more food than LM cows. This may indicate that
cows of lower genetic merit may not have as high a drive for feed intake so when
challenged the cows reduced energy utilization and subsequent feed intake.
parity cows
(P < 0.01). The cows on the LE diet consumed 12% less feed prepartum and 16%
less feed postpartum, regardless of genetic merit or parity (Table 3, Figure 1b).
![Page 36: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/36.jpg)
26
Table 3. Feed intake (kg/DM) of cows varying genetic merit fed normally or an
energy restricted diet, effect of genetic merit, energy intake, and parity prepartum
and postpartum
Treatment Interactions
Item
High Merit
Normal Diet
High Merit
Low Diet
Low Merit
Normal Diet
Low Merit
Low Diet SEM
1st Lactation
Prepartum 12.4 A. 12.6 13.0 9.0 0.5
Postpartum 18.8 B. 17.7 19.3 14.8 0.5
2nd Lactation
Prepartum 15.1 A. 15.5 14.4 13.0 0.8
Postpartum 23.9 B. 20.4 25.0 20.2 0.9
A. Effect of genetic merit (P < 0.05), parity (P < 0.001), genetic merit by diet (P <
0.03)
B.
Effect of parity (P < 0.001), diet ( P < 0.001 ); trend of genetic merit by diet (P <
0.09)
![Page 37: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/37.jpg)
27
Figure 1a. Feed intake of cows varying genetic merit fed normally or an energy
restricted diet, effect of dietary energy intake1
.
1Diamonds represent NE animals and open triangles represent LE animals.
Normally fed intake line is represented by the equation: y=4.79 ln (x) + 1.39 with an
R2 of 0.87. Lower energy intake line is represented by the equation: y=4.25 ln (x) +
0.82 with an R2
of 0.85. Postpartum effect of diet (P < 0.0001).
![Page 38: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/38.jpg)
28
Figure 1b. Feed intake of cows varying genetic merit fed normally or an energy
restricted diet, effect of genetic merit over time1.
1Diamonds represent HM animals and open triangles represent LM animals. High
genetic merit line is represented by the equation: y=4.54 ln (x) + 0.89 with an R2 of
0.89. Lower genetic merit line is represented by the equation: y=4.61 ln (x) + 0.84
with an R2
of 0.83. Prepartum effect of genetic merit (P < 0.05).
![Page 39: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/39.jpg)
29
Milk Production
As expected, cows fed ad libitum generally produced more milk than those fed
a restricted energy diet, though the main effect of diet was not statistically
significant. However, the interaction of merit and diet was quite interesting. When
fed ad libitum higher genetic merit cows did not produce more milk than cows of LM
at 28 and 56 DIM. But when feed restricted, HM cows produced 6 kg/d more in
primiparous cows and 4 kg/d more in 2nd
It may be that the HM animals can better adapt to an energy deficit to
prioritize milk production. The LM animals, however, reacted by eating even less
and producing less milk. Such an adaptation has been noted previously
(McNamara and Hillers, 1986) and will be discussed further when the data on
metabolic flux is presented.
lactation than LM cows (P < 0.03; effect of
genetic merit by diet) (Table 4). Second lactation cow produced more milk than
primiparous cows, as expected (P < 0.0001).
![Page 40: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/40.jpg)
30
Table 4. Milk yield (kg/d) of cows varying genetic merit fed normally or an energy
restricted diet, effect of genetic merit, energy intake, and parity
Treatment Interactions
Item
High Merit
Normal Diet
High Merit
Low Diet
Low Merit
Normal Diet
Low Merit
Low Diet SEM
1st Lactation
Overall 26.7 A 29.7 26.7 23.7 1.2
Days 1-28 23.0 B. 26.6 24.3 20.8 1.1
Days 29-56 31.2 C. 33.3 29.5 27.4 1.4
2nd Lactation
Overall 35.3 A 40.9 43.1 35.0 1.8
Days 1-28 31.0 B. 39.8 38.6 31.9 1.7
Days 29-56 39.5 C. 43.1 47.1 38.3 2.0
A. Effect of parity (P < 0.0001), genetic merit by diet interaction (P < 0.03)
B. Effect of parity (P < 0.0001), genetic merit by diet (P < 0.006)
C.
Effect of parity (P < 0.0001); trend of genetic merit by diet (P = 0.12)
![Page 41: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/41.jpg)
31
Figure 2a. Milk yield (kg/DM) of cows varying genetic merit fed normally or an
energy restricted diet, effect of energy intake1
.
1Diamonds represent NE animals and open triangles represent LE animals.
Normally fed intake line is represented by the equation: y=6.19 ln (x) + 12.07 with
an R2 of 0.96. Lower energy intake line is represented by the equation: y=5.40 ln (x)
+ 13.32 with an R2
of 0.94. Overall effect of genetic merit and diet (P < 0.0001).
![Page 42: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/42.jpg)
32
Figure 2b. Milk yield (kg/DM) of cows varying genetic merit fed normally or an
energy restricted diet, effect of genetic merit1.
1Diamonds represent HM animals and open triangles represent LM animals.
Higher genetic merit line is represented by the equation: y=6.30 ln (x) + 12.30 with
an R2 of 0.95. Lower genetic merit line is represented by the equation: y=5.44 ln (x)
+ 13.09 with an R2
of 0.94. Overall effect of genetic merit and diet (P < 0.0001).
![Page 43: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/43.jpg)
33
Body Weight, Body Condition Score, and Body Fat
When animals are challenged with a reduction in energy intake they must
use stored body reserves, primarily fat, to make up the deficit. In general, dairy
cows will lose a significant amount of body fat in early lactation, but this is highly
dependent on milk yield and energy intake. In this study we are interested in
changes in body fat as we probe mechanisms of dairy efficiency with both genetic
merit and dietary energy differences.
Body condition score (BCS) is an external, subjective estimate of body fat.
The scores were assigned on a scale of 1 to 5 with 1 being emaciated and 5 being
obese. Body fat itself (EBF) was also estimated directly from body weight (BW) and
BCS using the equation -122.1 + 0.21*BW + 36*BCS (Waltner et al., 1994).
Cows in their 2nd lactation tended to be slightly heavier and retained body
weight better than primiparous cows (P < 0.0001; effect of body weight, BCS, and
EBF). The cows, regardless of parity, lost weight from 7 days prepartum to 28 days
postpartum (P < 0.0001; effect of BW, BCS, and EBF). This weight and loss makes
sense because the cows are pulling from their fat depots and energy reserved to
produce normal amounts of milk. From 7 days prepartum to 7, 28, or 56 DIM, HM
cows lost more weight on the LE diet than the other groups (Table 5, P < 0.06), as
expected. Cows across all genetic merit and diet interaction groups decreased in
body weight and EBF until 28 DIM with slight recovery occurring around 56 DIM.
Body condition score followed a similar trend or continued to decrease as seen in
cows on the LE diet (P < 0.02; quadratic effect of DIM); (Table 5). From 28 to 56
![Page 44: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/44.jpg)
34
DIM most animals regained some body fat, however HM animals fed the LE diet did
not (Table 5). These subtle differences are consistent with the feed intake and milk
production.
In brief summary of the production data, HM first parity animals ate a
similar amount of feed and gave slightly more milk when fed ad libitum, but 2nd
parity HM animals actually produced less milk than 2nd
parity LM animals. When
feed restricted, all groups tended to give less milk, but in fact the LM animals of
both parities were much more depressed in milk production than were HM animals.
Changes in BW, BCS and EBF were in general consistent with the differences in
energy intake and milk production.
![Page 45: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/45.jpg)
35
Table 5. Body weight (BW), body condition score (BCS), and empty body fat (EBF) of
cows varying genetic merit fed normally or an energy restricted diet, interaction
effect of diet and genetic merit
DIM
Treatment -21 -7 7 28 56
BWA
High Merit Normal Diet
, kg
666.9 691.2 618.6 600.5 635.4
High Merit Low Diet 694.1 705.8 614.8 585.8 602.8
Low Merit Normal Diet 679.5 668.6 615.2 586.8 606.2
Low Merit Low Diet 676.8 677.5 631.6 582.0 631.5
SEM 11.2 1 12.4 14.8 10.9 12.7
BCS
B
High Merit Normal Diet 3.4 3.4 3.1 3.0 3.2
High Merit Low Diet 3.4 3.5 3.3 3.3 3.0
Low Merit Normal Diet 3.4 3.4 3.3 3.2 3.3
Low Merit Low Diet 3.4 3.5 3.3 3.2 3.2
SEM 0.0 2 0.0 0.1 0.1 0.1
EBF3,C
, kg
High Merit Normal Diet 141.4 145.0 120.3 112.0 127.3
High Merit Low Diet 146.0 152.1 124.0 117.9 112.5
Low Merit Normal Diet 144.0 140.7 125.1 115.7 123.0
Low Merit Low Diet 144.0 144.4 127.6 114.7 126.2
![Page 46: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/46.jpg)
36
(Table 5 Cont’d.)
SEM 2.6 4 3.4 3.8 3.0 3.2
1 Overall SEM of BW is 7.5
3 Calculated according to Waltner et al. (1994)
2 Overall SEM of BCS is 0.5
4 Overall SEM of EBF is 4.2
A Effect of parity (P <0.0001), DIM (P < 0.0001), genetic merit by diet (P < 0.06), and
quadratic effect of DIM (P = 0.0001); trend of parity by gene by diet (P = 0.12), and
genetic merit (P = 0.12)
B Effect of DIM (P < 0.0001), DIM by parity (P < 0.02), and the quadratic effect of
DIM (P < 0.02); trend of parity (P = 0.08) and quadratic effect of DIM by diet (P =
0.09)
C
Effect of parity (P <0.0001), DIM (P < 0.0001), DIM by parity (P < 0.06), and the
quadratic effect of DIM (P < 0.0002)
![Page 47: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/47.jpg)
37
Glucose
Blood Nutrients
Serum glucose concentration can be an important indicator of homeostasis
and energy availability in an animal. Many factors of glucose uptake and use are at
work in early lactation; and blood glucose concentrations are highly regulated.
Often there is little change in blood glucose, even in times of severe glucose deficit.
For this experiment serum glucose was analyzed to study and interpret metabolic
adaptations to genetic merit and energy intake. Serum glucose may also help
predict rates of lipogenesis.
For the most part primiparous cows had increased serum glucose than 2nd
lactation cows on either diet (Table 6). HM cows had decreased serum glucose
compared to LM cows. Cows of HM also had steady blood glucose pre- and
postpartum for both primiparous and 2nd
Overall the serum glucose data suggests that because concentration between
parity, genetic merit, and dietary energy intake are not markedly different the cows
were able to maintain homeostasis of blood glucose concentrations. Likely the flux
of glucose was different as a factor of diet and milk production.
lactation cows. However, cows of LM had
at least 6 mg/dL decrease to increase from pre- to postpartum across both parities
(P < 0.03; effect of both DIM and quadratic effect of DIM); (Table 6).
![Page 48: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/48.jpg)
38
Table 6. Serum glucose (mg/dL) A
of cows varying genetic merit fed normally or an
energy restricted diet, interaction effect of diet and genetic merit across target days
in milk
Treatment Interactions
Item
High Merit
Normal Diet
High Merit
Low Diet
Low Merit
Normal Diet
Low Merit
Low Diet
SEM1
1st Lactation
-21 DIM 56.5 51.6 63.1 56.3 2.2
-7 DIM 52.3 60.3 57.3 60.9 1.5
7 DIM 53.7 57.5 56.3 36.7 3.6
28 DIM 58.3 58.3 50.8 57.7 2.8
56 DIM 40.1 58.1 2 58.7 60.6 3.0
2nd Lactation
-21 DIM 58.9 62.2 59.7 51.6 6.3
-7 DIM 51.6 60.5 61.0 53.8 3.2
7 DIM 49.4 58.4 53.7 42.6 2.5
28 DIM 51.5 43.1 48.4 41.8 4.8
56 DIM 54.9 65.8 54.1 60.7 2.0
1 Overall SEM is 3.6
2 HM NE group had an n=3
A
(P < 0.03); trend of parity (P = 0.1034)
Effect of DIM (P < 0.03), gene by diet (P < 0.02), and quadratic effect of DIM
![Page 49: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/49.jpg)
39
Non-Esterified Fatty Acids
Serum non-esterified fatty acid (NEFA) concentrations can be an important
indicator of homeostasis and energy status of an animal. During the transition
period cows may go into a negative energy balance due to the high demand of
energy being utilized for milk production. Energy balance can be estimated during
part of lactation using serum NEFA concentrations and was calculated using the
equation: equation is EB= -3.14 - 0.009 * NEFA (µM) + (0.341*DIM) - 0.002 * DIM ^
2) (McGuire, 2006) for postpartum measurements only.
The NEFA of all groups generally trended down from 7 days prepartum to 56
DIM. Normally fed cows had higher serum concentrations than LE cows (Table 7).
Cows in their 2nd
Lower genetic merit cows in their 2
lactation on the restricted energy diet had the highest serum
NEFA concentrations in early lactation (7 DIM) as well as the lowest energy
balance, however there was not a statistical effect of diet.
nd
Cows in all groups were in a negative energy balance at 7 DIM and from 28-
56 DIM the cows tended to become more positive (P < 0.02); (Table 8). Statistically
there were no diet effects on serum NEFA concentrations and energy balance.
Serum NEFA concentrations are a good indicator of fat mobilization.
lactation had the largest spike in serum
NEFA concentration at 7 DIM as compared to primiparous cows (P < 0.02; effect of
parity by DIM).
![Page 50: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/50.jpg)
40
Table 7. Serum NEFA (µM) A
concentration of cows varying genetic merit fed
normally or an energy restricted diet, interaction effect of diet and genetic merit
across target days in milk
Days in Milk
Treatment -21 -7 7 28 56
1st
Lactation
High Merit Normal Diet 273.6 123.3 692.2 125.1 383.5
High Merit Low Diet 643.2 295.2 662.1 345.6 177.6
Low Merit Normal Diet 534.2 290.7 385.1 166.2 206.4
Low Merit Low Diet 368.7 286.7 287.8 159.6 558.0
SEM 78.1 46.8 128.1 35.4 107.4
2nd Lactation
High Merit Normal Diet 521.0 103.6 298.8 168.2 111.7
High Merit Low Diet 139.1 150.6 254.1 461.6 146.4
Low Merit Normal Diet 102.3 296.5 895.5 637.6 355.1
Low Merit Low Diet 142.8 228.3 870.1 386.3 161.0
SEM 68.3 1 47.1 205.1 104.5 63.9
1 Overall SEM is 20.3
A
Effect of DIM by parity (P < 0.02), quadratic effect of parity (P < 0.02), and parity
by gene (P < 0.04); trend of quadratic effect of DIM (P < 0.07)
![Page 51: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/51.jpg)
41
Table 8. Estimated energy balance (Mcal/d) A
of cows varying genetic merit fed
normally or an energy restricted diet, effect of diet and genetic merit interaction
across target days in milk
Days in Milk
Treatment 7 28 56
1st
Lactation
High Merit Normal Diet -7.1 3.7 6.2
High Merit Low Diet -6.8 1.7 8.1
Low Merit Normal Diet -4.3 3.3 7.8
Low Merit Low Diet -3.4 3.4 4.7
SEM 1.2 0.3 1.0
2nd Lactation
High Merit Normal Diet -3.5 3.3 8.7
High Merit Low Diet -3.1 0.7 8.4
Low Merit Normal Diet -8.9 -0.9 6.5
Low Merit Low Diet -8.7 1.4 8.2
SEM 1.8 1 0.9 0.6
1 Overall SEM is 2.1
A
Effect of DIM (P < 0.0001), parity by gene (P < 0.04), DIM by parity (P < 0.02),
quadratic effect of DIM (P < 0.02), and the quadratic effect of parity (P < 0.02)
![Page 52: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/52.jpg)
42
Lipogenesis is highly affected by the energy available in an animal to build
fat reserves so the rates of lipogenesis reflect energy availability. Overall, cows
tended to have the fastest rates of lipogenesis at 7 days prepartum and the lowest
at 21 days prepartum (Table 9, Figure 3). It was unusual that there were lower
rates at 21 vs. 7 days prepartum; however, at day 21 many cows were still adapting
to eating from the Calan gates so it is likely that this data is not representative of
cows 3 weeks prepartum. In several studies on the Knott Dairy Herd lipogenesis,
was measured at much faster rates than in this study (McNamara and Hill, 1986;
McNamara and Valdez, 2005).
Adipose Lipogenesis
Primiparous cows had slower rates of lipogenesis prepartum as compared to
2nd lactation cows, but had faster rates of lipogenesis than 2nd lactation cows at 28
and 56 DIM (Table 9). The 2nd
lactation cows produce more milk and thus reduce
rates of lipogenesis more than prepartum cows. Primiparous cows most likely have
faster rates of lipogenesis postpartum because they are making less milk and still
have a higher priority for growth.
![Page 53: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/53.jpg)
43
Table 9. Rates of lipogenesis of cows varying genetic merit fed normally or an
energy restricted diet, overall diets and genetic merit; effect of parity
Concentration of Acetic Acid mM Overall 2
[Acetate] Item 0.5 1 2 3 4 8
1st
Lactation
-21 Prepartum 35.3 87.4 196.8 283.3 377.2 785.7 294.3
-7 Prepartum 130.3 305.5 496.6 716.2 921.2 1398.2 650.0
7 DIM 84.9 184.2 371.1 532.4 582.2 1792.8 603.8
28 DIM 105.7 159.7 361.5 854.8 1315.7 846.8 607.4
SEM 17.7 40.3 70.1 110.0 155.9 252.1 61.3
2nd
Lactation
-21 Prepartum 118.9 281.3 623.3 833.1 1127.1 2138.5 860.0
-7 Prepartum 208.4 443.4 716.6 927.9 1833.4 2046.0 1037.3
7 DIM 86.0 154.7 331.7 553.7 742.3 474.8 390.5
28 DIM 28.0 65.5 156.0 109.0 260.5 821.0 251.9
SEM 34.6 1 71.7 154.2 179.6 319.5 434.3 108.4
1 There was insufficient adipose tissue at 56 DIM in 2nd lactation animals to collect
sample for lipogenesis assay
2
There was no statistical significance of parity for overall concentrations of acetate
![Page 54: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/54.jpg)
44
Cows on the normal diet had faster rates of lipogenesis than cows on the LE
diet, regardless of genetic merit (Table 10, Figure 3). This result was expected, that
cows on the NE diet at 7 and 28 DIM had faster rates of lipogenesis than cows on
the LE diet at 7 and 28 DIM (Figure 4), because cows on the normal diet had more
dietary energy available.
There was no consistent effect of genetic merit on lipogenesis when compared
within dietary groups (Table 10). The data suggest that genetic merit alone is not
a good predictor of rates of lipogenesis; however cows of higher genetic merit on
either diet tended to have slightly faster rates of lipogenesis than cows of lower
genetic merit on either diet (P < 0.04). Diet in general plays a greater role in
determining the rates of lipogenesis, as has been noted several times earlier
(McNamara and Hillers, 1986; McNamara et al., 1993; McNamara and Valdez,
2005).
It was a notable result in Table 10 that at 56 DIM, especially in 2nd
(P < 0.0001; effect of diet and DIM). This is consistent with the more rapid rate of
fat loss in these animals. Second lactation animals had slower rates of lipogenesis,
consistent with their greater priority for milk production over primiparous animals.
lactation
animals, most cows had insufficient adipose tissue to run metabolic flux assays
![Page 55: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/55.jpg)
45
Table 10. Rates of lipogenesis of cows varying genetic merit fed normally or an
energy restricted diet, effect of diet and genetic merit across target days in milk,
regardless of parity
1
Concentration of Acetic Acid (mM) Overall A
[Acetate] Treatments 0.5 1 2 3 4 8
High Merit Normal Diet
-21 Prepartum 43.6 87.8 117.3 190.3 324.6 729.8 255.7
-7 Prepartum 175.2 409.0 428.8 529.8 1599.5 1245.3 746.1
7 DIM 218.2 463.3 874.5 1221.2 1392.1 4774.0 1490.5
28 DIM 66.0 96.0 253.0 455.0 612.5 653.5 347.0
SEM 36.8 90.0 132.9 184.9 325.0 484.0 130.9
High Merit Low Diet
-21 Prepartum 101.8 252.0 661.6 796.4 1162.6 2206.2 863.4
-7 Prepartum 151.3 379.7 900.3 1315.7 1483.3 3013.5 1101.1
7 DIM 46.3 95.0 205.8 323.3 442.3 812.5 320.8
28 DIM 36.0 51.0 168.0 322.0 321.0 688.0 264.3
SEM 31.1 76.5 213.6 259.7 357.0 599.1 136.0
Low Merit Normal Diet
-21 Prepartum 24.8 64.6 119.0 205.4 314.2 476.8 200.8
-7 Prepartum 141.0 335.7 432.5 803.3 775.7 439.2 487.9
7 DIM 67.9 123.5 283.8 519.6 596.8 457.6 333.8
![Page 56: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/56.jpg)
46
(Table 10 Cont’d.)
28 DIM 139.7 172.7 460.0 1152.0 2035.3 1117.7 846.2
SEM 30.6 65.3 99.5 199.0 289.8 80.6 65.5
Low Merit Low Diet
-21 Prepartum 101.1 249.0 432.5 656.9 852.3 1833.4 687.5
-7 Prepartum 191.6 349.0 751.2 777.0 1586.6 3252.4 1151.3
7 DIM 34.2 69.8 140.6 187.0 220.8 480.0 188.7
28 DIM 51.5 164.0 213.5 502.5 381.5 687.5 333.4
SEM 35.4 58.8 141.2 119.0 282.5 557.2 119.6
1 There was insufficient adipose tissue at 56 DIM in some cows for lipogenesis assay
A
Effect of Diet and DIM (P < 0.001), genetic merit (P < 0.04); Quadratic trend of
DIM ( P = 0.07)
![Page 57: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/57.jpg)
47
Figure 3. Rate of lipogenesis in cows of varying genetic merit fed normally or an
energy restricted diet1
1
Solid line with round cap represents 21 days prepartum (y = 511 ln (x) – 113; R² =
0.70); solid line with arrow cap represents 7 days prepartum(y = 846 ln (x) – 62; R²
= 0.83); dashed line with round cap represents 7 days postpartum (y = 632 ln (x) –
122; R² = 0.68); dashed line with arrow cap represents 28 days postpartum (y = 543
ln (x) – 66; R² = 0.79) ; and dotted line with diamond cap represents 56 days
postpartum (y = 656 ln (x) – 139; R² = 0.77). The interaction of acetate
concentration, DIM, and Diet was significant at P < 0.0001.
![Page 58: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/58.jpg)
48
Figure 4. Rate of lipogenesis in cows of varying genetic merit fed normally or an
energy restricted diet, effect of dietary energy intake1
1
Solid line with round cap represents LE, 7 DIM (y = 271 ln (x) – 50); solid line with
arrow cap represents LE, 28 DIM (y = 314 ln (x) – 34); dashed line with round cap
represents HE, 28 DIM (y = 686 ln (x) – 85); and dashed line with arrow cap
represents HE, 7 DIM (y = 857 ln (x) – 156)
![Page 59: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/59.jpg)
49
Lipolysis is the process of breaking down triglycerides into free fatty acids
and glycerol that are used as substrate to produce Acetyl Co A for the Krebs cycle to
produce ATP. For this experiment the rates of lipolysis were measured at basal and
stimulated levels using isoproterenol which is a general beta-2 receptor agonist
(Lefkowitz, 1974; Drake et al., 2008). Isoproterenol was used to observe response of
adipose tissue to beta-adrenergic stimulation, which is known to be a part of control
of lipolysis.
Adipose Lipolysis
Primiparous cows had an overall increase in rates of lipolysis postpartum
while 2nd lactation cows increased at 7 DIM, decreased at 28 DIM and increased
again at 56 DIM (P < 0.03); (Table 11) indicating that 2nd
Regardless of genetic merit, cows on the lower energy diet had about 12-18%
increased rates of lipolysis as compared to normally fed cows, which is consistent
with the 10% reduction in energy intake. The cows on the LE diet were
compensating for a decreased dietary energy intake by increasing their rates of
lioplysis. This oppositely-directed metabolic flux of lipolysis and lipogenesis is
lactation animals did not
need as much energy from adipose tissue release as primiparous cows. Cows at 56
DIM had the fastest rates of lipolysis regardless of dietary treatment or genetic
merit. At 56 DIM the cow is nearing peak lactation and demand for fatty acid
release for energy is higher. The number of lipolysis assays at 56 DIM was fewer,
as few samples were collected at 56 DIM due to the fat depletion from increased
lipolysis.
![Page 60: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/60.jpg)
50
directed by the coordinated regulation of enzymes controlling lipolysis and
lipogenesis (Tepperman and Tepperman, 1970; Bauman and Currie, 1980).
![Page 61: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/61.jpg)
51
Table 11. Rates of lipolysis of cows varying genetic merit fed normally or an energy
restricted diet, effect of parity regardless of diet or genetic merit1
.
Isoproterenol Concentration Avg
Stim A Item Basal 10 -8 10 10-7 10-6 10-5 -4
1st Lactation
-21 DIM 598.4 2728.1 2656.4 2726.4 2481.9 2397.2 2573.8
-7 DIM 1003.8 3352.1 3387.6 3071.1 3035.2 3030.6 3175.3
7 DIM 959.4 2367.5 2875.9 2859.7 2783.9 2427.3 2662.8
28 DIM 1362.8 2958.8 3200.1 3465.4 3473.2 3180.0 3255.5
56 DIM 1938.0 4273.3 4055.0 3711.4 3684.5 3375.3 3897.9
SEM 121.6 163.4 173.1 144.6 153.2 131.6 139.6
2nd Lactation
-21 DIM 973.1 3847.5 3740.2 3838.3 3616.7 3355.9 3679.7
-7 DIM 915.1 2490.1 2630.4 2297.8 2473.9 2206.2 2419.7
7 DIM 1207.3 2571.4 2523.0 2793.1 2817.3 2501.7 2641.3
28 DIM 888.0 2061.5 2197.5 2843.8 2351.3 2368.8 2364.6
56 DIM 1559.0 3698.0 2644.0 3519.0 4001.5 4602.3 4555.2
SEM 115.0 254.2 254.1 254.4 251.7 235.3 245.2
1 The data are the release of glycerol (nM) per 2 hours per gram of tissue.
A
Average Stimulation of Lipolysis: Effect of DIM by Parity (P < 0.03), Quadratic
effect of DIM (P < 0.01), and DIM by parity (P < 0.02)
![Page 62: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/62.jpg)
52
At basal levels the rates of lipolysis in cows of LM trended up postpartum
while cows of HM trended down postpartum, regardless of diet. Overall, the cows of
higher genetic merit did not markedly fluctuate in rates of lipolysis except at 7 DIM
with increased rates of lipolysis and 56 DIM with decreased rates of lipolysis as
compared to LM cows, regardless of diet (P = 0.12; trend of the effect of DIM on
genetic merit during basal lipolysis).
Normally fed cows of higher genetic merit had slower rates of lipolysis at 28
and 56 DIM than cows of either high or low genetic merit on the restricted energy
diet (Table 12). This indicates that the availability of exogenous energy and genetic
merit can help the cow lessen or prevent a negative energy balance by more
efficiently maintaining lipogenesis.
Overall, the data supports the concept previously developed in this lab
(McNamara and Hillers, 1989) that energy intake plays a larger role in determining
the rates of lipolysis and lipogenesis than genetic merit. Genetic merit or actual
milk production rates are more directly related to changes in lipolysis. These
differences are consistent with the separate mechanisms of control of lipogenesis
and lipolysis that have been established previously. Lipogenesis generally responds
to decreased energy intake with a coordinated decrease in enzyme activity and gene
expression for anabolic enzymes. Rates of lipolysis are much more responsive to
immediate needs of the animal (‘flight or fight’, or in this case, milk production) and
are therefore controlled by very rapid post-translational mechanism (activation by
protein phosphorylation). All of the measures above provide a framework for
![Page 63: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/63.jpg)
53
interpretation of the gene expression data to be discussed next.
Table 12. Rates of lipolysis of cows varying genetic merit fed normally or an energy
![Page 64: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/64.jpg)
54
restricted diet, effect of diet and genetic merit across target days in milk, regardless
of parity1
.
Isoproterenol Concentration Avg
Stim B Treatment Basal 10A 10-8 10-7 10-6 10-5 -4
High Merit Normal Diet
-7 Prepartum
2
1179.4 2566.3 2984.8 2686.1 2801.4 2376.3 2683.0
7 DIM 1704.2 2853.7 3968.9 3372.3 3275.3 2553.1 3204.7
28 DIM 1061.0 2191.4 2657.1 3005.3 2961.1 2786.0 2720.2
56 DIM 974.3 4012.5 3534.0 4221.5 2917.0 4509.7 4646.3
SEM 230.7 284.4 343.8 259.1 289.7 290.2 288.3
High Merit Low Diet
-21 Prepartum 740.5 3088.6 2776.6 2992.1 3050.5 2720.4 2925.6
-7 Prepartum 952.6 3071.8 2599.4 2847.0 3572.0 3138.4 3045.7
7 DIM 970.0 2781.8 2798.6 2772.0 2761.2 2885.8 2799.9
28 DIM 1357.7 3942.3 4187.3 3979.0 4438.7 3874.0 4084.3
56 DIM 1874.0 3587.0 3436.0 3352.0 3347.0 3671.5 3278.7
SEM 145.4 257.0 247.4 238.6 249.4 228.5 228.2
![Page 65: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/65.jpg)
55
(Table 12 Cont’d.)
Low Merit Normal Diet
-21 Prepartum 821.1 2736.6 2688.3 2961.5 2730.0 2790.5 2781.4
-7 Prepartum 615.9 3352.9 3340.4 2650.4 2447.1 2655.1 2889.2
7 DIM 766.3 2023.0 1794.4 2701.9 2638.0 2398.0 2311.1
28 DIM 1102.7 2822.7 2335.8 2994.0 2931.5 2668.5 2750.5
56 DIM 2522.0 3784.0 3152.0 3482.7 3815.7 3275.7 3502.0
SEM 150.1 264.5 247.1 226.6 226.4 184.3 210.5
Low Merit Low Diet
-21 Prepartum 530.5 3741.2 3776.8 3646.2 2715.7 2716.5 3319.3
-7 Prepartum 1181.8 2819.8 3078.8 2728.4 2466.4 2592.0 2737.1
7 DIM 959.3 2146.8 2428.8 2238.0 2319.3 1859.8 2198.5
28 DIM 1810.0 2870.8 3703.5 3971.0 3335.8 3305.0 3437.2
56 DIM 2068.0 6485.0 6222.0 6135.0 -----------3 5360.0 6050.5
SEM 202.4 302.1 315.8 354.0 323.5 278.0 300.8
1 The data are the release of glycerol (nM) per 2 hours per gram of tissue
2 21 days prepartum data not available
3 56 DIM data not available for 10-6, LM LE group (n=1)
A
0.12)
Trend of genetic merit (P = 0.06) and quadratic effect of DIM on genetic merit (P =
B
Average Stimulation of Lipolysis: Quadratic effect of DIM (P < 0.01)
![Page 66: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/66.jpg)
56
There are three key proteins that coordinate lipolysis in adipose tissue: beta-
2 adrenergic receptor (β
Expression of genes that control lipolysis in adipose tissue of dairy cattle
2AR); hormone sensitive lipase (HSL); and perilipin (PLIN).
The β2
The expression of the genes of interest were compared to the expression of
ribosomal subunit S2, generally referred to as delta Ct (cycle threshold in the RT-
PCR technique); (ΔCt = Gene of interest Ct – S2 Ct). This “normalization” provides
a comparison of differential control of expression of a gene compared to one that is
usually constitutively expressed. In adipose tissue, especially during the massive
adaptation occurring during transition to lactation, it is difficult to determine with
certainty any gene or set of genes that are constitutively expressed. However,
previous work in this lab with RT-PCR and gene arrays suggested that the
ribosomal S2 unit is relatively constantly expressed. Data discussed below from
this trial may indicate this may not always be the case.
AR responds to epinephrine and norepinephrine binding, initiates the
intracellular cascade resulting in phosphorylation and activation of HSL to break
down TAG to free fatty acids and glycerol. Phosphorylation of PLIN causes
translocation of this protein to the lipid droplet surface, allowing catalytic activity of
HSL. The quantitative role of transcription of these genes in control of adipose
tissue lipolysis in dairy cattle has not been fully defined; thus the transcription of
these three genes was analyzed for this experiment.
Then, the ΔCt measures postpartum were compared to that at 7 d prepartum
to determine the effects of lactation, merit and diet on gene expression. This
![Page 67: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/67.jpg)
57
measure has been referred to as the ‘delta delta Ct (ΔΔCt). Using this number, the
equation (2 raised to the negative power of ΔΔCt) equates to the fold change of
expression relative to the starting point (7 d prepartum). Seven days prepartum
was used because 21 days prepartum was considered an adaptation period and
there would not be representative gene expression at that time to determine the
effects of lactation. In the tables, thus there are 3 measures, the ΔCt of the gene of
interest to ribosomal S2; the ΔΔCt, referred to as ΔCt relative to d 7 prepartum, and
the fold change relative to d 7 prepartum.
β2
The expression of β
AR
2AR is described as ΔCt, which is defined by the difference
of β2AR to S2. The ΔCt of β2AR to S2 was related to 7 days prepartum and was used
to calculate fold change in ΔCt of β2
LE fed cows typically had higher ΔCt of β
AR to S2 related to 7 days prepartum.
2AR to S2 than NE cows prepartum
and at 56 DIM. Cows on the NE diet had a lower ΔCt of β2AR to S2 at 7 d
prepartum, and thus essentially started the experiment with more copies of the
β2
Overall, animals normally fed generally decreased expression of this gene in
early lactation regardless of GM. At 56 DIM, the HM animals had the lowest
relative expression of β
AR mRNA prepartum than cows on the LE diet.
2AR while the LM animals increased expression significantly
(P < 0.03). This result is difficult to explain, as previous work has suggested
expression of this gene is related to milk production. The result in this experiment
could well be due to the much smaller sample size at 56 DIM.
![Page 68: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/68.jpg)
58
The only consistent trend was that dietary restriction clearly resulted in an
increase in relative expression of the β2AR (diet effect, P < 0.05) postpartum,
regardless of genetic merit. Yet examination of all the data shows that the change
in relative expression was due to a decrease in expression of the S2 gene while the
absolute expression of the β2
Biologically, the presence of adequate dietary energy supported adequate
transcription of β
AR remained more constant. This actually can be
explained by the massive drop in all anabolic reactions in adipose tissue
postpartum. The finding of a decrease in expression of a ribosomal gene is a novel
finding, and suggests that control of anabolism is the major driver in adipose tissue
postpartum. Yet, control of transcription of genes regulating lipolysis relative to
anabolic genes is also an affect of dietary energy, while actual rates of lipolysis are
strongly related to milk production. This is consistent with post-translational
control of lipolysis being the major mechanism in response to increased milk
production.
2AR. However, the attenuation of gene copies from 28 to 56 DIM
(Table 13) suggest that the chronic stimulation of the β2AR may have led to
desensitization. Nevertheless, the data also suggest that HM animals may be
better prepared for lactation because of the presence of more β2
AR mRNA
prepartum to buffer or perhaps reduce the metabolic stress many cows endure
during the transition period.
![Page 69: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/69.jpg)
59
Table 13. Beta-2 adrenergic receptor gene expression of cows varying genetic merit
fed normally or an energy restricted diet, effect of diet and genetic merit1
.
Days around Parturition
Treatment -7 7 28 56 SEM2
High Merit Normal Diet A
ΔCt for β2 to S2 1.5 3.1 4.8 7 0.6
ΔCt relative to d -7 1.6 3.3 5.5
Fold Change in
Relative ΔCt to d -7
33% 10% 2%
High Merit Low Diet A
ΔCt for β2 to S2 3.5 3.9 3.6 3.5 0.4
ΔCt relative to d -7 0.4 0.1 0
Fold Change in
Relative ΔCt to d -7
76% 93% 100%
Low Merit Normal Diet A
ΔCt for β2 to S2 3.1 5.2 3.6 3 0.3
ΔCt relative to d -7 2.1 0.5 -0.1
Fold Change in
Relative ΔCt to d -7
23% 71% 107%
Low Merit Low Diet A
ΔCt for β2 to S2 4.7 3.4 4.5 5.8 0.6
![Page 70: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/70.jpg)
60
(Table 13 Cont’d.)
ΔCt relative to d -7 -1.3 -0.2 1.1
Fold Change in
Relative ΔCt to d -7
246% 115% 47%
SEM (ΔCt) 2 0.5 0.5 0.7 0.7
1 A decrease means an increase in mRNA while an increase indicates a decrease in
mRNA. The ΔCt for β2 to S2 is the difference in CT between β2 and S2 (β2Ct –
S2Ct).
2 Overall SEM is 1.4
A Effect of diet (P < 0.05), DIM by gene by diet (P < 0.03); Trend in gene (P = 0.07),
effect of DIM by diet (P = 0.09) on ΔCt for β2
to S2
![Page 71: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/71.jpg)
61
Hormone Sensitive Lipase
Hormone sensitive lipase (HSL) is an enzyme, which catalyzes lipolysis and
was analyzed to determine if there are any differences in the pattern of expression
based on the effects of dietary energy intake and genetic merit. The expression of
HSL is described as ΔCt which is defined by the difference of HSL to S2. The ΔCt of
HSL to S2 was related to 7 days prepartum and was used to calculate fold change in
ΔCt of HSL to S2 related to 7 days prepartum.
The changes in expression of HSL were closely consistent with those of the
B2AR, which was noted previously (Sumner and McNamara, 2007).
There was an overall statistical response of diet (P <0.04) and gene by diet (P
< 0.001) with a trend for an effect of DIM (P = 0.09) and the quadratic effects of both
gene (P = 0.20) and diet (P = 0.12) of ΔCt of HSL to S2. This effect was most notable
in HM cows on either diet.
Energy restricted cows had a much higher expression of HSL (lower ΔCt of
HSL to S2) as compared to normally fed cows from 7 days prepartum to 28 DIM.
This diet effect indicates that the animals on the LE diet are adapting to an energy
deficit by increasing HSL expression. The changes in HSL expression were similar
to those of the Β2AR pattern of expression.
![Page 72: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/72.jpg)
62
Table 14. Hormone sensitive lipase gene expression of cows varying genetic merit
fed normally or an energy restricted diet, effect of diet and genetic merit
1
Days around Parturition
Treatment -7 7 28 56 SEM2
High Gene Normal Diet A
ΔCt for HSL to S2 1.0 3.4 2.7 5.0 0.7
ΔCt relative to d -7 2.4 1.7 4.0
Fold Change in
Relative ΔCt to d -7
19% 31% 6.0%
High Gene Low Diet A
ΔCt for HSL to S2 2.5 2.5 2.1 7.5 0.9
ΔCt relative to d -7 0.0 -0.4 5.0
Fold Change in
Relative ΔCt to d -7
100% 132% 3.0%
Low Gene Normal Diet A
ΔCt for HSL to S2 2.6 6.5 5.6 2.6 0.7
ΔCt relative to d -7 3.9 3.0 0.0
Fold Change in
Relative ΔCt to d -7
7.0% 13% 100%
Low Gene Low Diet A
ΔCt for HSL to S2 0.7 0.8 3.3 3.8 0.6
![Page 73: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/73.jpg)
63
(Table 15 Cont’d.)
ΔCt relative to d -7 0.1 2.6 3.1
Fold Change in
Relative ΔCt to d -7
93% 16% 12%
SEM (ΔCt )2 0.7 0.8 0.6 1.4
1A decrease in ΔCt for HSL to S2 means in an increase in mRNA and an increase in
ΔCt for HSL to S2 indicates a decrease in mRNA. The ΔCt for is the difference in Ct
between HSL and S2 (HSLCt – S2Ct).
2 Overall SEM is 1.9
A
Effect of Diet (P <0.04), gene and diet (P < 0.001); Trend in DIM (P = 0.09),
quadratic effect of diet (P = 0.20) and quadratic effect of gene (P = 0.12) on ΔCt for
HSL to S2
![Page 74: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/74.jpg)
64
Perilipin
Perilipin (PLIN) is a protein associated with the lipolytic pathway, considered
the co-factor of HSL. Phosphorylation of perilipin allows for access of active
(phosphorylated) HSL to the TAG surface for hydrolysis. Expression of PLIN was
analyzed to determine if there are any differences in the pattern of expression based
on the effects of dietary energy intake and genetic merit. The expression of PLIN is
described as ΔCt, which is defined by the difference of PLIN to S2. The ΔCt of PLIN
to S2 was related to 7 days prepartum and was used to calculate fold change in ΔCt
of PLIN to S2 related to 7 days prepartum.
There was an overall statistically significant response of ΔCt of PLIN to S2 to
DIM (P < 0.04) and to the interaction of genetic merit and diet (P <0.03). Normally
fed cows trended up in ΔCt of PLIN to S2 and peaked at 28 DIM (Table 15). The
ΔCt of PLIN to S2 relative to 7 days prepartum of NE cows increased at 28 DIM and
then decreased at 56 DIM. LE fed cows trended up in ΔCt of PLIN to S2 from 7 DIM
to 28 DIM and either increased (HM) or remained constant (LM) depending on
genetic merit. Consequently, the ΔCt of PLIN to S2 relative to 7 days prepartum for
LE fed cows followed a similar trend as of PLIN to S2.
Generally the expression of PLIN decreased postpartum compared to 7 d
prepartum. The expression was generally highest (lowest ΔCt) at 7 DIM compared
to 28 and 56 DIM, Genetic merit differences in expression of PLIN were similar to
HSL but with greater expression of mRNA comparatively, as seen by the lower ΔCt
of PLIN to S2 compared to ΔCt of HSL to S2. Although there was a fair bit of
![Page 75: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/75.jpg)
65
variation in the data among DIM and merit and dietary groups, the only consistent
pattern was that, similar to the B2AR and HSL, animals on the restricted energy
diet increased expression relative to those normally fed (P < 0.03). This indicates a
coordinated change in relative expression of the three key proteins that regulate
lipolysis in cows faced with a dietary energy restriction. The data do not support
here a major effect of increased GM on increasing expression of these proteins.
![Page 76: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/76.jpg)
66
Table 15. Perilipin gene expression of cows varying genetic merit fed normally or
an energy restricted diet, effect of diet and genetic merit1
.
Days around Parturition
Treatment -7 7 28 56 SEM 2
High Gene Normal Diet A
ΔCt for PLIN to S2 0.6 1.1 5.0 2.4 0.7 3
ΔCt relative to d-7 0.5 4.4 1.8
Fold Change in
Relative ΔCt to d-7
71% 5.0% 29%
High Gene Low Diet A
ΔCt for PLIN to S2 2.7 2.4 2.6 4.4 0.6
ΔCt relative to d-7 -0.3 -0.1 1.7
Fold Change in
Relative ΔCt to d-7
123% 107% 31%
Low Gene Normal Diet A
ΔCt for PLIN to S2 -0.4 3.3 6.0 2.5 0.9
ΔCt relative to d-7 3.7 6.4 2.9
Fold Change in
Relative ΔCt to d-7
8.0% 1.0% 13%
Low Gene Low Diet A
ΔCt for PLIN to S2 0.3 0.7 2.1 2.1 0.7
ΔCt relative to d-7 0.4 1.8 1.8
![Page 77: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/77.jpg)
67
(Table 15 Cont’d.)
Fold Change in
Relative ΔCt to d-7
76% 29% 29%
SEM (ΔCt) 0.7 2 0.7 0.9 1.1
1A decrease in ΔCt of PLIN to S2 means in an increase in mRNA and an increase in
ΔCt of PLIN to S2 indicates a decrease in mRNA. ΔCt is the difference in Ct
between PLIN and S2 (PLINCt – S2Ct).
2 Overall SEM is 1.9
3 Data for HM, NE at 56 DIM has an n=2
A
Effect of DIM (P < 0.04) and Gene by Diet (P < 0.03) for ΔCt of PLIN to S2
![Page 78: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/78.jpg)
68
Summary and Conclusions
When interpreting the overall changes in feed intake, milk yield, body
weight, and estimated empty body fat in this study, the production level data were
consistent with the body of knowledge. Second parity animals gave more milk and
ate more feed. Dietary energy restriction decreased milk production and increased
loss of BW and fat and transiently increased NEFA concentrations. Animals of
higher GM apparently could respond to a dietary energy restriction better than
animals of lower merit.
At the metabolic level, changes in lipogenesis and lipolysis were consistent
with the differences in energy intake and milk production. Lipogenesis decreased
dramatically at 7 and 28 DIM and a dietary restriction decreased these rates even
more. Lipolysis increased in relation to milk production in early lactation, and
animals of higher merit had faster rates of stimulated lipolysis in early lactation.
However the effects of merit were not as striking as has previously been determined
in this herd (McNamara and Hillers, 1989; Sumner and McNamara, 2007). That
can be due to a number of factors including normal animal variation in feed intake
and milk production.
Genetic merit and diet did appear to play a role in mRNA expression for
genes controlling lipolysis. The major effect was actually due to diet, which was
somewhat unexpected. However, the primary effect was one of a decrease in the
‘stable’ gene expression of ribosomal S2 and maintenance of expression of β2AR,
HSL, and PLIN. This is consistent with the known effects of dietary energy
![Page 79: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/79.jpg)
69
restriction on control of anabolic pathways.
For future experiments it would be prudent to more deeply explore how
nutrigenomics effect gene expression to attempt to determine selection criteria of
higher genetic merit cows. Genetic merit has been selected for and improved in
herds for many years, but it will be interesting to see if on both the genomic and
metabolic level the cow will be able to be improved upon.
Overall it is apparent that genetic merit and the interaction between merit
and diet can play a role in the efficiency and productivity of a cow. The pattern of
feed intake, milk production, blood nutrients, metabolic rates and expression of key
lipolytic genes differs in cows of varying genetic merit, either challenged with a mild
energy deficit or not. We can use these data to improve our systems biology models
to more effectively research the mechanisms of metabolic control in dairy cattle.
Eventually, producers can utilize these findings to help improve selection criteria to
produce more efficient, higher producing cows.
![Page 80: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/80.jpg)
70
AOAC. 2000. AOAC. Official Methods of Analysis. Vol. 1 and 2. Gaithersburg, MD: AOAC International 2000.
References
Banting, F.G. 1937. Early work on insulin. Science. 85(2217):594-596. Bauman, D.E. and W.B. Currie. 1980. Partitioning of nutrients during pregnancy
and lactation: a review of mechanisms involving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-1529.
Bauman, D.E. and J.M. Elliot. 1983. Control of nutrient partitioning in lactating
ruminants. In Biology of Lactation, T.B. Mepham, ed. Pp. 437-486. Bauman, D.E. and R.G. Vernon. 1993. Effects of exogenous bovine somatotropin on
lactation. Ann Rev Nutr. 13:437-461. Bernabucci, U, B. Ronchi, N. Lacetera, A. Nardone. 2005. Influence of body
condition score on relationships between status and oxidative stress in periparturient cows. J. Dairy Sci. 88:2017-2026.
Burns, T.W., P.E. Langley, B.E. Terry, D.B. Bylund, B.B. Hoffman, M.D. Tharp,
R.J. Lefkowitz, J.A. Garcia-Saínz, and J.N. Fain. 1981. Pharmacological characterizations of adrenergic receptors in human adipocytes. J Clin Invest. 67(2):467-75.
Cao, H.C., A. Bidwell, S.K. Williams, W. Liang, and S.E. Mills. 1998. Nucleotide
Sequence of the porcine ß1-adrenergic receptor gene. J Anim Sci 76:1720-1721.
Carpene, C., J. Galitzky, P. Collon, F. Esclapez, M. Dauzats. and M. Lafontan. 1992.
Desensitization of Beta-1 and Beta-2, but not Beta-3, adrenoreceptor-mediated lipolytic responses of adipocytes after long-term norepinephrine infusion. J. Pharmacol. & Exp. Therapeutics. 265(1):237-247.
Case, L.P. 1999. The Dog: Its Behavior, Nutrition, and Health. 1st Ed. Iowa State
![Page 81: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/81.jpg)
71
University Press: Ames, IA. Pp. 318-320. Castiella, L., P. Muzzin, J.P. Revelli, D. Ricquier, and J.P. Giacobino. 1994.
Expression of ß1 and ß2 adrenergic receptor messages and adenylate cyclase ß-adrenergic response in bovine perrenal adipose tissue during its transformation from brown to white fat. Biochem J 297:93-97.
Chruscinski, A.J., D.K. Rohrer, E. Schauble, K.H. Desai, D. Bernstein, and B.K.
Kobilka. 1999. Targeted disruption of the ß2-adrenergic receptor gene. J Biol Chem 274:16694-16700.
Doris R.A., G.E. Thompson, E. Finley, E. Kilgour, M.D. Houslay, and R.G. Vernon.
1996. Chronic effects of somatotropin treatment on response of subcutaneous adipose tissue lipolysis to acutely acting factors in vivo and in vitro. J Anim Sci 74(3):562-8.
Drackley, JK. 1999. ADSA Foundation Scholar Award. Biology of dairy cows during
the transition period: the final frontier? J Dairy Sci. Nov; 82(11):2259-73. Drake, M.T., J.D. Violin, E.J. Whalen, J.W. Wisler, S.K. Shenoy, and R.J. Lefkowitz.
2008. β-Arrestin biased agonism at the β2
-adrenergic receptor. J. Bio. Chem. 283(9):5669-5676.
Etherton, T.D., D.E. Bauman, J.R. Romans. 1977. Lipolysis in subcutaneous and perirenal adipose tissue from sheep and dairy steers. J. An. Sci. 44(6):1100-1106.
Forrest, R.H. and J.G.H. Hickford. 2000. Rapid Communication: nucleotide
sequences of bovine, caprine, and ovine ß3-adrenergic receptor genes. J Anim Sci 78:1397-1398.
Galitsky, J., D. Langin, P. Verwaerde, J.L. Montastruc, M. Lafontan, and M.
Berlan. 1997. Lipolytic effects of conventional ß3-adrenoreceptor agonist and of CGP12,177 in rat and human fat cells: Preliminary pharmacological evidence for a putative ß4-adrenoreceptor. Br J Parmacology 122:1244-1250.
![Page 82: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/82.jpg)
72
Gorman, R.R., H.M. Tepperman, and J. Tepperman. 1972. Effects of starvation, refeeding, and fat feeding on adipocyte ghost adenyl cyclase activity. J Lipid Res 13(2):276-280.
Gorman, R.R., H.M. Tepperman, and J. Tepperman. 1973. Epinephrine binding and
the selective restoration of adenylate cyclase activity in fat-fed rats. 14(3):279-285.
Grujic, D., V.S. Susulic, M. Harper, J. Himms-Jagen, B.A. Cunningham, B.E.
Corkey, and B.B. Lowell. 1997. ß3-adrenergic receptors on white and brown adipocytes mediate ß3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake. J Biol Chem 272:17686-17693.
Guidicelli, H., N. Combes-Pastre, J. Boyer. 1974. Lipolytic activity of adipose tissue.
IV. The diacylglycerol lipase activity of human adipose tissue. Biochim Biophys Acta 369:25-33.
Guo, J., R.R. Peters, and R.A. Kohn. 2008. Evaluation of a Mechanistic Model of
Glucose and Lipid Metabolism in Periparturient Cows. J Dairy Sci 91:4293-4300.
Guo, J., R.R. Peters, and R.A. Kohn. 2007. Effect of a Transition Diet on Production
Performance and Metabolism in Periparturient Dairy Cows. J. Dairy Sci 90:5247-5258.
Hanigan, MD, L.A. Crompton, B.J. Bequette, J.A. Mills, and J. France. 2002.
Modelling mammary metabolism in the dairy cow to predict milk constituent yield, with emphasis on amino acid metabolism and milk protein production: model evaluation. J Theor Biol 217(3):311-330.
Hausberger, F.X. and S. W. Milstein. 1954. Dietary Effects on Lipogenesis in
Adipose Tissue. J of Biol Chem 483-488. Holm, C., T.G. Kirchgessner, K.L. Svenson, G. Fredrikson, S. Nilsson, C.G. Miller,
J.E. Shively, C. Heinzmann, R.S. Sparkes, T. Mohandas, A.J. Lusis, P.
![Page 83: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/83.jpg)
73
Belfrage, M.C. Shotz. 1988. Hormone-Sensitive Lipase: Sequence, Expression, and Chromosomal Localization to 19 cent-q13.3. Science 241 (4872):1503-1506.
Hubbard, R. and W. Matthew. 1971. Growth and Lipolysis of Rat Adipose Tissue:
effect of age, body weight, and food intake. J Lipid Res 12:286-293. Kaumann, A.J., F. Preitner, D. Sarsero, P. Molenaar, J.P Revelli, and J.P
Giacobino. 1998. (-)-CGP12177 causes cardiostimulation and binds to cardiac putative ß4-adrenoreceptors in both wild-type and ß2-adrenoreceptor knockout mice. Molecular Pharmacology 53:670-675.
Kern, P.A., G. Di Gregorio, T. Lu, N. Rassouli, and G. Ranganathan. 2004. Perilipin
expression in human adipose tissue is elevated with obesity. 89(3):1352-1358. Kraemer, F.B., W.J. Shen. 2002. Hormone-sensitive lipase: control of intracellular
tri-(di-)acylglycerol and cholesteryl ester hydrolysis. J Lipid Res 43(10):1585-1594.
Lefkowitz, R.J. 1974. Selectivity in beta-adrenergic responses: clinical implications.
Circulation 49:783-786. Liang, W. and S.E. Mills. 2002. Quantitative analysis of beta-adrenergic receptor
subtypes in pig tissues. J Anim Sci. 80:963-970. McGuire, M. 2006. Personal Communication. McNamara, J.P. 1994. Lipid metabolism in adipose tissue during lactation: a model
of a metabolic control system. J. of Nutrition. Conference: Regulating Lipid Metabolism 1383S-1391S.
McNamara, J.P. 1989. Regulation of bovine adipose tissue metabolism during
lactation. 5. Relationships of lipid synthesis and lipolysis with energy intake and utilization. J. Dairy Sci 72:407-418.
McNamara, J.P. and J.K. Hillers. 1986. Regulation of Bovine Adipose Tissue
![Page 84: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/84.jpg)
74
Metabolism During Lactation. 1. Lipid Synthesis in Response to Increased Milk production and Decreased Energy Intake. J Dairy Sci 69 (12):3032-3041.
McNamara, J.P. and J.K. Hillers. 1986. Regulation of Bovine Adipose Tissue
Metabolism During Lactation. 2. Lipid Response to Milk Production and Energy Intake. J Dairy Sci 69 (12):3042-3050.
McNamara, J.P. and F. Valdez. 2005. Adipose tissue metabolism and production
responses to calcium propionate and chromium propionate. J. Dairy Sci 88:2498-2507.
McNeel, R.L. and H.J. Mersmann. 1999. Distribution and quantification of ß1, ß2,
and ß3-adrenergic receptor subtype transcripts in porcine tissues. J Anim Sci 77:611-621.
Menendez, J.A., A Vazquez-Martin, F.J. Ortega, and J.M. Fernandez-Real. 2009.
Fatty Acid Synthase: Association with Insulin Resistance, Type 2 Diabetes, and Cancer. Clinical Chemistry 55:425-438.
Mersmann, H.J. 1996. Evidence of classic ß3-adrenergic receptors in porcine
adipocytes. J Anim Sci 75:3161-3168. Mersmann, H.J., G.B. Carey, and E. O’Brian Smith. 1997. Adipose tissue α-
adrenergic and α1 adenosine receptors in suckling pigs. J Anim Sci 74:984-992.
“Metritis: A Foul Disease with Financial Costs.” Hoards Dairyman. 25 April 2010:
290-291. Print Metz, S.H.M., and S.G. van den Bergh. 1971. Regulation of fat mobilization in
adipose tissue of dairy cows in the period around parturition. Neth J Agric Sci 25:198-211.
Mulligan, F.J., and M.L. Doherty. 2008. Production diseases of the transition cow.
The Veterinary Journal 176:3-9.
![Page 85: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/85.jpg)
75
Munday, H.S. and K.E. Earle. 1991. Energy Requirements of the Queen During Lactation and Kittens from Birth to 12 Weeks. J Nutr 121:543-544.
Mutch, D.M., W. Wahli, and G. Williamson. 2005. Nutrigenomics and nutrigenetics:
the emerging faces of nutrition. FASEB Review. 19:1602-1616. National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th
revised ed. Natl. Acad. Sci., Washington, DC.
Peterson, A.D. and B.R. Baumgardt. 1971. Influence of Level of Energy Demand on
the Ability of Rats to Compensate for Diet Dilution. J Nutr 101:1069-1074. Pietri-Rouzel, F.G. Lenzen, A. Kappor, M.F. Drumare, P. Archimbault, A.D.
Strosber, and B.S.J. Manning. 1995. Molecular cloning and pharmacological characterization of the bovine ß3-adrenergic receptor. Eur J Biochem 230:350-358.
Portillo, M.P., A.S. Del Barrio, M.A. García-Calonge, and J.A. Martínez. 1995.
Desensitization effect of in vivo treatment with metaproterenol on β1, β2, and β3
-adrenergic responsiveness in rat adipocytes. Life Sciences. 58(5):405-414.
Rajagopal, S., K. Rajagopal, and R. Lefkowitz. 2010. Teaching old receptors new tricks: biasing seven-transmembrane receptors. Nature Reviews. 9:373-386.
Roche, J.F. 2006. The effect of nutritional management of the dairy cow on
reproductive efficiency. Animal Repro. Science 96:282-296. Rohre, D.K., K.H. Desai, J.R. Jasper, M.E. Stevens, D.P. Regula Jr., G.S. Barsh, D.
Bernstein, and B.K. Kobilka. 1996. Targeted disruption of the mouse ß1-adrenergic receptor gene: developmental and cardiovascular effects. Pharmacology 99:7375-7380.
Salway, J.G. 2004. Metabolism at a Glance. 3rd
Malden, MA. edition. Blackwell Publishing
SAS Institute. 2005. SAS 9.2. SAS Users Guide. Cary, NC.
![Page 86: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/86.jpg)
76
Schactschneider C. et al. 2009. Genetics of Feed Conversion Efficiency. Poster. Shen, W.J., K. Sridhar, D.A. Bernlohr, and F.B. Kraemer. 1999. Interaction of rat
hormone-sensitive lipase with adipocyte lipid-binding protein. Proc Natl Acad Sci 96:5528-5532.
Sillence, M.N. and M.L. Matthews. 1994. Classical and atypical binding sites for β-
adrenoceptor ligands and activation of adenylyl cylcase in bovine skeletal muscle and adipose tissue membranes. Br. J. Pharmacol. 111:866-872.
Smith, S.B. and J.D. Crouse. 1984. Relative contribution of acetate, lactate, and
glucose to lipogenesis in bovine intramuscular and subcutaneous adipose tissue. J. Nutr. 114(4):792-800.
Stiles, G.L., M.G. Caron, and R.J. Lefkowitz. 1984. β-adrenergic receptors:
biochemical mechanisms of physiological regulation. Phys. Rev. 64(2):661-743.
Sumner, J. and J.P McNamara. 2007. Expression of the Lipolytic Genes in the
Adipose Tissue of Pregnant and Lactating Holstein Dairy Cattle. J Dairy Sci 90 (11):5236-46.
Tepperman, J. and H.M. Tepperman. 1970. Gluconeogenesis, lipogenesis, and the
Sherringtonian metaphor. Fed. Proc. 29(3):1284-1293. Tyler, H.D., and M.E. Ensminger. 2006. Dairy Cattle Science. 4th
Education Columbus, OH. edition. Pearson
Vernon, R.G. and C.M. Pond. 1997. Adaptations of Maternal Adipose Tissue to
Lactation. J Mammary Gland Biol Neoplasia 2(3):231-241. Verstegen, M.W.A, J. Mesu, G.J.M. van Keempen, and C. Geerse. 1985. Energy
Balances of Lactating Sows in relation to Feeding Level and Stage of Lactation. J Nutr 60:731-740.
![Page 87: ADRENERGIC REGULATION OF ADIPOSE TISSUE ......More specifically I need to thank Vanessa Michelizzi for never failing to help me get through every rough patch I’ve encountered in](https://reader033.vdocuments.mx/reader033/viewer/2022060913/60a71097d7ace033dd6d23af/html5/thumbnails/87.jpg)
77
Vicario, P.P., M.R. Candelore, M.T. Schaeffer, L. Kelly, G.M. Thompson, E.J. Brady,
R. Saperstein, D.E. MacIntyre, L.M. Tota, and M.A. Cascieri. 1997. Desensitization of β3
-adrenergic receptor-stimulated adenylyl cyclase activity and lipolysis in rats. Life Sciences. 62(7):627-638.
Wakil, S.J., and L.A. Abu-Elheiga. 2008. Fatty acid metabolism: target for metabolic syndrome. J. Lipid Research 50:S138-S143.
Waltner, S.S., J.P. McNamara, and J.K. Hillers. 1994. Validation of indirect
measures of body fat in lactating cows. J. Dairy Sci. 77:2570-2579. Waltner, S.S., J.P. McNamara, and J.K. Hillers. 1993. Relationships of body
condition score to production variables in high producing Holstein dairy cattle. J. Dairy Sci. 76:3410-3419.
Willoughby, D., G.S. Baillie, M.J. Lynch, A. Ciruela, M.D. Houslay, and D.M.F.
Cooper. 2007. Dynamic Regulation, Desensitization, and Cross-talk in discrete subcellular microdomains during β2
-adrenoreceptor and prostanoid receptor cAMP signaling. J. Bio. Chem. 282(47):34235-34249.
Yang, Y. and R.L. Baldwin. 1973. Lipolysis in isolated cow adipose cells. J Dairy Sci 56:366-374.
Yeaman, S.J. 1990. Hormone-sensitive lipase-a multipurpose enzyme in lipid
metabolism. Biochem Biophys Acta 1052:128-132.