Actin Stress Fiber Pre-extension in HumanAortic Endothelial Cells

Lan Lu,1 Yunfeng Feng,2 William J. Hucker,1 Sara J. Oswald,1

Gregory D. Longmore,2,3 and Frank C-P Yin1,2*

1Department of Biomedical Engineering, Washington University,St. Louis, Missouri

2Department of Medicine, Washington University, St. Louis, Missouri3Department of Cell Biology and Physiology, Washington University,

St. Louis, Missouri

Actin stress fibers (SFs) enable cells to sense and respond to mechanical stimuliand affect adhesion, motility and apoptosis. We and others have demonstratedthat cultured human aortic endothelial cells (HAECs) are internally stressed sothat SFs are pre-extended beyond their unloaded lengths. The present studyexplores factors affecting SF pre-extension. In HAECs cultured overnight thebaseline pre-extension was 1.10 and independent of the amount of cell shortening.Decreasing contractility with 30 mM BDM or 10 lM blebbistatin decreased pre-extension to 1.05 whereas increasing contractility with 2 nM calyculin Aincreased pre-extension to 1.26. Knockdown of a-actinin-1 with an interferingRNA increased pre-extension to 1.28. None of these affected the wavelength ofthe buckled SFs. Pre-extension was the same in unperturbed cells as in those inwhich the actin cytoskeleton was disrupted by both chemical and mechanicalmeans and then allowed to reassemble. Finally, disrupting MTs or IFs did notaffect pre-extension but increased the wavelength. Taken together, these resultssuggest that pre-extension of SFs is determined primarily by intrinsic factors, i.e.the level of actin-myosin interaction. This intrinsic control of pre-extension is suf-ficiently robust that pre-extension is the same even after the actin cytoskeleton hasbeen disrupted and reorganized. Unlike pre-extension, the morphology of thecompressed SFs is partially determined by MTs and IFs which appear to supportthe SFs along their lengths. Cell Motil. Cytoskeleton 65: 281–294, 2008. ' 2008

Wiley-Liss, Inc.

Key words: contractility; cytoskeletal organization; a-actinin-1; gene silencing technology

INTRODUCTION

Actin stress fibers (SFs) are collections of actin fila-ments formed by the contractile interaction of actin andmyosin and bundled by proteins such as a-actinin. Largeventral SFs are anchored at both ends by focal adhesions[Burridge et al., 1988; Otey and Carpen, 2004; Petersonet al., 2005; Hotulainen and Lappalainen, 2006]. Thisarrangement allows intracellular forces to be transmittedto the extracellular matrix (ECM) and vice versa [Janmey,1998] and is one mechanism by which cells sense theirenvironment and respond to mechanical stimuli. Hence,SFs are responsible for many cellular functions includingmorphology, adhesion, motility and apoptosis.

Recent studies have clearly demonstrated thatwell-spread cells exert tension on their surroundings

[Dembo et al., 1999]. If the substrate is sufficiently flexi-ble, it will deform in response to this internal tension.Otherwise, this tension will cause the SFs to be pre-extended, that is, to be longer than they would be in theabsence of internal tension.

*Correspondence to: Frank C-P Yin, PhD, MD, Washington Univer-

sity, Campus Box 1097, One Brookings Drive, St. Louis, MO 63130,

USA. E-mail: yin@biomed.wustl.edu

Received 14 July 2007; Revised 27 November 2007; Accepted 10

December 2007

Published online 15 January 2008 in Wiley InterScience (www.

interscience.wiley.com).

DOI: 10.1002/cm.20260

' 2008 Wiley-Liss, Inc.

Cell Motility and the Cytoskeleton 65: 281–294 (2008)

Pre-extension has been demonstrated both indi-rectly [Pourati et al., 1998; Wang et al., 2001c] anddirectly [Wang et al., 2001b; Costa et al., 2002; Kumaret al., 2006] in isolated cells and their constituents. Forexample, directly removing the tension on SFs by sever-ing them with a laser caused the cut ends to retract[Kumar et al., 2006]. Although the methodology did notenable estimation of the amount, it is clear that pre-extension was present. By compressing cells sufficientlyto relieve the tension on the SFs and causing them tobecome crimped, we were able to estimate the amount ofpre-extension [Costa et al., 2002]. Therefore, it is clearthat well-spread cultured cells are under internal loadingand that their SFs are pre-extended.

There is also accumulating evidence that alteringSF pre-extension affects cell function. For example,recent studies using substrates with varying stiffnessesshowed that cell stiffness, morphology, locomotion andadhesion are all affected by pre-extension [Pelham andWang, 1997; Polte et al., 2004]. Increasing pre-extensionincreases overall cell stiffness [Pourati et al., 1998;Wang et al., 2001b,c]. Stretching cells beyond a certainamount, thereby increasing pre-extension, causes rapiddisruption and reorganization of SFs. This is associatedwith altered cell morphology and orientation, generallyperpendicular to the stretching direction [Banes et al.,1990; Takemasa et al., 1997, 1998; Wang et al., 2000a,2001a; Hayakawa et al., 2001; Wille et al., 2004]. On theother hand, pre-extension appears to be critical to SF sta-bility. Completely unloading cells causes disruption ofthe SFs, cell rounding, loss of adhesion and subsequentdysfunction [Tomasek et al., 1992; Grinnell et al., 1999].In our previous study we demonstrated that once tensionwas rapidly removed from the horizontally-oriented SFs,the entire actin cytoskeleton disassembled and then reor-ganized [Costa et al., 2002]. On the other hand, morelocalized release of tension on a single SF caused local-ized disassembly [Sato et al., 2005].

Even though cell culture conditions differ dramati-cally from in vivo ones, there is a striking similaritybetween some responses under these conditions. Forexample, we have recently shown that axially-orientedSFs in endothelial cells in intact rat renal arteries becameoriented primarily circumferentially after a few hours ofaxially stretching [Sipkema et al., 2003]. Not only wasthis reorientation similar to the responses in culturedcells described above, but there were also concomitantalterations in endothelial-dependent vasodilatation. Wepreviously showed that antioxidants prevented the cytos-keletal disruption caused by cyclic stretching [Wanget al., 2000b]. Similarly, there is strong evidence that is-chemia, partly via free radical production, causes disrup-tion of actin organization in renal failure [Molitoris,2004]. These considerations and the ability to precisely

control and measure various parameters in cultured cellsargue for the utility of such studies. To our knowledge,however, there are no detailed studies of the factorsaffecting the amount of SF pre-extension.

The dependence of cell and vessel function on SFpre-extension underscores the need to better understandthe factor(s) affecting it. Because SFs depend upon theinteractions between actin and myosin, [Polte et al.,2004], modulating contractile level should affect pre-extension. Similarly, affecting the bundling of actin fila-ments by, e.g., eliminating a-actinin might also affectpre-extension. Factors extrinsic to SFs could also affecttheir pre-extension. As discussed above, SFs aredynamic structures that can rapidly disassemble and thenreorganize in response to certain stimuli. Since SF orga-nization is largely driven by the interactions of actin andmyosin, it is reasonable to assume that SF pre-extensionis determined primarily by the level of contractility pres-ent at the time the SFs are assembled and not by the pasthistory of what has happened to the actin cytoskeleton.To test this idea, we globally disrupted SFs both chemi-cally and mechanically. After each type of interventionthe SFs spontaneously reassembled. We then measuredthe pre-extension of these reorganized SFs. Finally, thereis some evidence for mechanical interactions betweenactin and microtubules (MTs) and intermediate filaments(IFs) [Wang, 1998; Wiche, 1998]. Hence, altering the in-tegrity of these other structural proteins may also affectSFs. The present study was performed to examine theeffects of these intrinsic and extrinsic factors on SFpre-extension.

We measured the pre-extension and morphology ofSFs by rapidly shortening flexible membranes on whichthe cells were cultured. The shortening was sufficient tocompletely unload the fibers and cause them to becomecrimped. Decreasing actin-myosin contractility with ei-ther non-specific (BDM) or specific (blebbistatin) inhibi-tors or increasing contractility with a serine/threoninephosphatase inhibitor calyculin A, respectively de-creased or increased pre-extension. Markedly decreasingthe influence of a-actinin-1 by gene silencing technologyincreased pre-extension, but did not affect the wave-length of the crimping. Pre-extension was the same inunperturbed cells as in those in which the actin cytoskel-eton was disrupted by both chemical and mechanicalmeans and then allowed to reassemble. Finally, disrupt-ing MTs or IFs did not affect pre-extension but increasedthe wavelength of the compressed SFs. Taken together,these results suggest that pre-extension of SFs is deter-mined primarily by intrinsic factors, i.e., the level ofactin-myosin interaction. This intrinsic control of pre-extension is sufficiently robust that pre-extension is thesame even after the actin cytoskeleton has been disruptedand reorganized. Unlike pre-extension, the morphology

282 Lu et al.

of the compressed SFs is partially determined by MTsand IFs which appear to support the SFs along theirlengths.

MATERIALS AND METHODS

Cell Culture

Human aortic endothelial cells (HAECs), passage9–15 (Cambrex Walkersville, MD), were cultured in en-dothelial cell basal medium plus 2% fetal bovine serumand other supplements (human epidermal growth factor,hydrocortisone, bovine brain extract and gentamicin sul-fate). The cells were grown to sub-confluence in plasticculture dishes at 378C in a humidified 5% carbon dioxideatmosphere. The central 15 3 15 mm2 region of a precut40 3 40 mm2 silicone membrane (Specialty Manufactur-ing, Saginaw, MI) was coated with 1 ml of 10 lg/mlengineered fibronectin-like protein polymer (Sigma-Aldrich, St. Louis, MO) for 20 min and then washedtwice with phosphate buffered saline (PBS). Cells wereplated sparsely on this area at a density of �800 cells/cm2 in order to avoid cell-cell contacts. They were incu-bated overnight to allow firm attachment to the mem-brane before testing.

For Western blotting, we trypsinized and centri-fuged the cells and extracted the cell pellet with cell lysisbuffer (20 mM Hepes pH 7.5, 120 mM NaCl, 5% glyc-erol, 0.5% NP-40 with 1 mM DTT and a freshly-addedprotease inhibitor). Protein concentration was measuredusing a Bio-Rad assay solution. For SDS-PAGE, 20 lgof cell lysate per lane was loaded to 5% polyacrylamidegel. Proteins were then transferred to PVDF membranes.Immunoblotting was performed using mouse anti-a-acti-nin-1 primary antibodies.

Immunofluorescent Staining

After each intervention, we rapidly fixed the cellswith 3.7% formaldehyde, permeabilized them with 0.2%triton X-100 in PBS for 10 min, treated them with 10%FBS in 0.1% tritonX-100 for 15 min to block nonspecificstaining and stained the desired cytoskeletal proteins.Briefly, cells were incubated with either mouse monoclo-nal anti-a-actinin (Sigma-Aldrich) or mouse monoclonalanti-MLC (Sigma-Aldrich, St. Louis, MO), and thenwith an anti-mouse FITC labeled secondary antibody(Sigma-Aldrich). Actin SFs were stained with rhodaminephalloidin (Molecular Probes, Eugene, OR). For rescuedcells, the green fluorescent protein (GFP) tag localizedtogether with a- actinin-1 so only SFs were stained.Cells were then washed in PBS three times, coveredin Fluoromount-G (Southern Biotechnical Associates,Birmingham, AL), sealed under a coverslip and photo-graphed with a digital camera on a Zeiss Axioskop

fluorescence microscope interfaced with Zeiss KS300software.

Compressing SFs

We used our previously described method to com-press cells and hence the SFs aligned in the deformeddirection [Costa et al., 2002]. Briefly, we pre-punched40 3 40 mm2 square silicone membranes and mountedthem on arrays of pins on four sliding carriages arrangedin a square pattern. One carriage was fixed and the otherthree could slide freely on tracks. The membrane wascompletely unloaded with the carriages at their startingpositions. The membrane was then stretched uniaxiallyto the desired amount by inserting a calibrated block tohold the three sliding carriages. To produce pure uniaxialdeformation, the membrane needed to be stretched, notonly along its primary direction, but also a small amountin the orthogonal direction. Before conducting studiesin cells, using test membranes we first imaged a gridof fine ink marks and analyzed their displacementsoff-line to verify that the deformations within the central15 3 15 mm2 region of the membrane were homogene-ous and uniaxial for each of the calibrated blocks. Alongthe stretched direction of the membrane, the ratio ofstretched to unloaded length is the stretch ratio used toquantify the deformation.

We pre-stretched the membrane, coated it with pro-tein and plated cells as described above. After inducingthe desired experimental intervention, we rapidly (lessthan 1 s) removed the block to return the membrane toits unloaded state. This compressed the cells and theSFs. We then immediately submerged the membrane in3.7% formaldehyde to fix the cells for visualization.

Experimental Interventions

We examined the effect of the following interven-tions on SF pre-extension: (1) varying the amount of cellcompression; (2) modulating SF contractility and a-acti-nin-1 expression; (3) disrupting the actin cytoskeleton,and (4) disrupting the MTs or IFs. We used at least threedifferent membranes for each intervention and examinedmultiple cells on each membrane.

Varying Cell Compression. Our method for quan-tifying SF pre-extension assumes that a SF does notshorten, once tension within it is removed, no matterhow much more it is compressed. To test this assump-tion, we examined SF pre-extension in cells compressedby differing amounts by using membranes pre-stretchedto three different stretch ratios (km 5 1.15, 1.25 and1.40).

Modulating SF Contractility and a-Actinin-1Expression.We tested the effects of decreasing cell con-tractility with both a nonspecific inhibitor of contractil-

Actin Stress Fiber Pre-extension 283

ity, 2,3-butanedione monoxime (BDM) (Sigma-Aldrich)and a more specific inhibitor blebbistatin (Calbiochem,La Jolla, CA). For both drugs, we examined the effectsat two membrane stretch ratios (km 5 1.15 and 1.25).

We also tested the effects of increasing contractil-ity with calyculin A (Sigma-Aldrich). For each drug, tocircumvent diffusion-limited delivery, we changed themedium completely with fresh medium at the desiredconcentration and treated the cells with BDM/blebbista-tin for 30 min or with calyculin A for 15 min beforeshortening the membrane.

BDM is a dose-dependent nonspecific inhibitor ofactin-myosin contractility [Higuchi and Takemori, 1989;Herrmann et al., 1992; McKillop et al., 1994] that can in-hibit SF remodeling and block the motility and orienta-tion response of endothelial cells subjected to cyclicstretching [Wang et al., 2000a; Ostap, 2002; Yarrowet al., 2003; Forer and Fabian, 2005]. In preliminarystudies we found that a concentration of 50 mM causeddramatic alterations in cell shape and a concentration of20 mM produced no discernible effects. Therefore, weexamined the effects of 30 mM BDM.

Blebbistatin is a selective inhibitor of actin-myosininteractions with a high affinity for myosin II. Concen-trations of 10, 20 and 50 lM reduced Mg-ATPase activ-ity of the non-muscle isoforms of myosin by 70%, 80%and nearly 100%, respectively [Straight et al., 2003;Limouze et al., 2004]. Blebbistatin inhibits both myosinATPase and gliding motility activities of human plateletnonmuscle myosin II without perturbing myosin lightchain kinase (MLCK) [Straight et al., 2003; Limouzeet al., 2004]. To verify that this more specific myosin in-hibitor also affected SF pre-extension in a similar man-ner as BDM, we examined the effect of a concentrationof 10 lM.

Calyculin A, a serine/threonine phosphatase inhibi-tor, blocks the dephosphorylation of MLC, and thereforeelevates the level of phosphorylated myosin light chainin the cells [Chartier et al., 1991]. Other studies demon-strated that, after the treatment with calyculin A, SFs incells had enhanced cell contraction [Peterson et al.,2005]. In preliminary studies we found that phosphoryla-tion of MLC was clearly evident by 5 min, reached apeak at 15 min and declined by 30 min after exposingcells to 2 nM calyculin A (data not shown). Hence, weexamined the effects of this concentration applied for15 min before we compressed the cells. Additionally, wealso found that a much greater degree of cell compres-sion than for the control cells was required to produceclear crimping of SFs. Hence, for this intervention weonly examined the effect on cells cultured on membranesfor km of 1.47.

To modulate a-actinin-1 expression we utilizedgene silencing technology. With the synthetic small

interfering RNA (siRNA) oligo-mediated gene silencingtechnology it is difficult to efficiently transfect some celllines, particularly primary cells like HAECs. Addition-ally, it is difficult to avoid potential off-target effects[Lin et al., 2005; Birmingham et al., 2006; Ma et al.,2006]. In contrast to siRNA, using a lentiviral vector todeliver a small hairpin RNA (shRNA) expression cas-sette has proved capable of infecting a broad spectrum ofcell types, including non-dividing mammalian primarycells allowing for sustained expression [Brummelkampet al., 2002; Qin et al., 2003]. Hence we used a lentiviruscontaining a shRNA cassette to knock down expressionof the endogenous a-actinin-1 gene. To control forpotential off-target effects of RNAi and confirm that anyphenotypic change following a-actinin-1 knockdownwas specific to loss of a-actinin-1 expression, we devel-oped lentiviral vectors that allowed concurrent expres-sion of a-actinin-1 shRNA and an RNAi resistant iso-form of human a-actinin-1 (rr-a-actinin-1) in the samecell. Fusing GFP with the rescue gene allows assessmentof the transduction efficiency, a comparison of the levelof rescue gene relative to endogenous gene expressionand ability to confirm proper subcellular localization ofthe rescue gene. In addition, because the GFP retardsmigration, the endogenous and rescued gene can be dis-tinguished on Western blots.

The plasmid construction for the expression cas-sette for human a-actinin-1 shRNA [Qin et al., 2003]

was constructed by joint PCR using predicted human a-actinin-1 sequence GGGACACAGATCGAGAACATCGAAGAG. We obtained the hU6 promoter (f1) byamplifying pBS-hU6-1 template with PCR primersACAGAATTCTAGAACCCCAGTGGAAAGACGCGCAG (forward), GGTGTTTCGTCCTTTCCACAAG(reverse), and the shRNA (small hairpin containing)

fragment (f2) with primers GTGGAAAGGACGAAACACCGGGACACAGATCGAGAACATCGAAGAG

TTCAAGAGACTCTTC (forward), TCCAGCTCGAGAAAAAGGGACACAGATCGAGAACATCGAAG

AGTCTCTTGAACTCTTC (reverse). Nucleotides initalics are the hairpin sequence while those in bold face

are target RNAi sequence. The f1 was purified from a1% TAE-agrose gel with gel purification kit (Invi-trogen, Carlsbad, CA) while f2 was purified from a12% TAE-polyacrylamide gel. Joint PCR was carriedout by using the hU6 forward primer, shRNA reverseprimer and mixed template (of f1 and f2). The PCRproducts were purified, cut with XbaI/XhoI and subcl-

oned into a multifunctional lentiviral vector pFLRuwhich was derived from pFG12.

To generate the rr-a-actinin-1, we designed fourpoint mutations in the shRNA target region of a-actinin-1 cDNA based upon wobble base pairing rules without

284 Lu et al.

changing the peptide encoding. We used the followingfour primers:

1. 50-AGAGAATTCCATGGACCATTATGATTCTCAGCAAAC

2. 50-CCTCTTCAATATTTTCAATCTGTGTCCCCGCCTTCCGGAG

3. 50-CACAGATTGAAAATATTGAAGAGGACTTCCGGGATGGCCTG

4. 50-CTCGGTACCGGTAGGTCACTCTCGCCGTACAGGCGCGTG

The N-terminal (N-ter) and C-terminal (C-ter) frag-ment of rr-a-actinin-1 were obtained by PCR usingprimer pairs 1 and 2, or 3 and 4, respectively. The fulllength of rr-a-actinin-1 was obtained by joint PCR usingpurified N-ter and C-ter mixed template and primers 1and 4, followed by subcloning the fragment into EcoRI/AgeI sites of pFLRu. The HAECs were transfected bymixing viruses passed through a 0.45 lm filter with anequal volume of fresh medium and protamine sulfate(final 10 lg/ml, Sigma) and then incubating overnight.Cells were then fed with fresh medium containing puro-mycin. The puromycin dose, ranging from 0.4–2 lg/ml,was determined from the killing curve from differentdonors.

Disrupting the Actin Cytoskeleton. We disruptedSFs by incubating cells with 5 lM cytochalasin B for 30min. We then replaced the medium containing the drugwith fresh medium without drug and allowed the cells torecover for 10 h prior to assessing pre-extension. We dis-rupted SFs mechanically by two different means. In oneset of studies we imposed a single, sustained uniaxialstretch of 25% to the adhered cells on the silicone mem-branes and measured the amount of SF pre-extension af-ter 5 h of recovery from this intervention. We subjectedanother group of cells to 25% cyclic uniaxial stretch for5 min, then held the membrane at its stretched positionand let them recover for 5 h before assessing pre-exten-sion.

Disrupting MTs or IFs. To assess if MTs or IFshave significant mechanical interactions with SFs, weexamined SF pre-extension and the wavelength ofcrimped SFs before and after disrupting either MTs orIFs. In separate experiments we incubated cells for 1 hwith either 0.33 mM nocodazole (ICN Biomedicals, Au-rora, OH) or 40 mM acrylamide (Sigma) prior to meas-uring SF pre-extension and the wavelength of thecrimped SFs.

Data Analysis

We have previously described how to estimate SFpre-extension [Costa et al., 2002]. Briefly, for any elasticstructure pre-extension in a given direction is defined as

its length under loading divided by its unloaded slacklength, that is, kp 5 Ls/Lo, where Ls is the length underthe load and Lo is the unloaded slack length. We assumethat a SF is able to sustain tension but is unable toshorten. Thus, when the tension is removed and the SF iscompressed further, it will crimp or buckle without fur-ther changing its unloaded length. Therefore, the pathlength along the entire contour of the crimped SF (Lc) isits unloaded length (Lo). The end-to-end length along thelong axis of the fiber is designated as Le. The tortuosityof the SF is simply T 5 Lc/Le 5 Lo/Le and does notdepend upon the orientation of the fiber with respect tothe shortening direction. Ls cannot be measured directlybut can be inferred from the stretch ratio of the mem-brane. The stretch ratio of the pre-stretched membrane iskm 5 Ls/Le. Assuming that the cell deformation is thesame as that of the membrane, for SFs oriented at anyangle a relative to the shortening direction, the stretchratio is kmcos(a). Hence, the pre-extension can be sim-ply calculated as kp 5 kmcos(a)/T.

In addition to measuring pre-extension, we meas-ured the wavelength of the crimped SFs which wedefined to be the distance between two adjacent nadirs ofthe buckled wave (one wave is demarcated by a pair ofarrows in Fig. 3).

Digital images of stained SFs were analyzed offlineusing the public domain NIH Image program. Only SFswhose angles with respect to the shortening directionwere within 6308 of the shortening direction and whoseends could be clearly distinguished were analyzed. Weaccounted for the fiber angle, as described above, in thecalculations and used the tracking tool in NIH Image tomeasure the various lengths needed to quantify pre-extension and the wavelength for all SFs that fulfilledthe above criteria.

Statistical Analysis

We assessed the effects of interventions using mul-tiple cells from at least three different membranes foreach condition and examined several suitable SFs foreach cell. We first tested for normality of the distribu-tions. For normal distributions we used one-way ANOVAand for non-normal distributions we used the Kruskal-Wallis analysis of ranks to test for statistically significantdifferences among the experimental groups. If significantdifferences were found, we then used Dunn’s methodfor multiple pairwise comparisons. We applied theBonferroni correction whenever making more than onepair of comparisons. To assess intracellular versus inter-cellular variability, we analyzed all suitable SFs in fivecells, calculated the coefficient of variability for eachcell and compared those to the overall coefficient of vari-ability for all cells for the membrane stretch ratio of

Actin Stress Fiber Pre-extension 285

1.25. Statistical significance was inferred for P valuesless than 0.05.

RESULTS

For each intervention we examined between 14 to72 cells from at least three different membranes andexamined an average 6 SD of 17 6 5 SFs per cell.Before reporting results of the interventions, we firstassess the variability of the measurements. Table I sum-marizes the intracellular variability for the membranestretch ratio of 1.25. Among the five arbitrarily selectedcells, neither the coefficient of variability nor the rangeof the pre-extension differs significantly. Moreover, thevariability for this subset is essentially the same as for allthe data for this particular membrane stretch ratio. Thisindicates that the data for individual cells are representa-tive of the entire population of cells.

Varying Cell Compression

Figures 1a–d show representative fluorescentmicrographs of rhodamine-stained SFs in unshortenedcontrol HAECs and cells fixed immediately after instan-

taneous shortening for different membrane stretch ratios.For the control cells (km 5 1.0) as well as for km 51.15,all the SFs are straight. However, for km 51.25 and 1.4crimping of many SFs aligned along the shorteningdirection is clearly evident, with the crimping beingmore pronounced for greater shortening. The pre-exten-sions for several different amounts of shortening aresummarized in Table II and demonstrate no statisticallysignificant differences.

Table III summarizes the data on the wavelengthsof the crimped SFs for several conditions. The wave-lengths of untreated cells for km 5 1.25 and 1.47 are notsignificantly different from each other.

Modulating Contractilityand a-Actinin-1 Expression

Table II also summarizes the results of BDM andblebbistatin treatment on SF pre-extension. For km ofboth 1.15 and 1.25, BDM significantly decreases pre-extension from control values with the two values notstatistically different from each other. Similarly, forthese same shortenings, blebbistatin also significantlydecreases pre-extension. Again the values after treatment

Fig. 1. SF pre-extension for vari-

ous cell compressions. Fluorescent

micrographs of actin SFs in repre-

sentative unshortened control

HAECs (a) and cells fixed imme-

diately after instantaneous shorten-

ing from a membrane stretch ratio

(km) of 1.15 (b), 1.25 (c) and 1.40

(d).

TABLE I. Summary of SF Pre-Extensions From Five Different Cells

Cell

no.

Number

of SFs

Average

value

Confidence

interval (95%)

Coefficient of

variation (%)

1 16 1.086 1.066–1.106 2.5

2 34 1.103 1.090–1.116 2.5

3 22 1.102 1.085–1.119 3.5

4 14 1.098 1.085–1.111 2.3

5 20 1.088 1.054–1.121 3.6

All fibers 716 1.095 1.092–1.098 3.4

286 Lu et al.

do not differ from each other. Hence, decreasing contrac-tility decreases SF pre-extension and, as for control cells,the amount of decrease does not depend upon the amountof compression imposed on the SFs.

The results of Calyculin A for km of 1.47 are alsosummarized in Table II and indicate that this concentra-tion of drug significantly increases SF pre-extensionfrom control values.

As shown in Fig. 2a, shRNA transfection markedlyreduces a-actinin-1 protein levels compared to the levelsin untransduced (mock) cells or in those transfected withnonspecific shRNA. The results in the far right laneshow that the rescue construct restores a-actinin-1expression to levels comparable to endogenous ones.

Figures 2b–d illustrate representative SFs in amock cell, a cell with a-actinin-1 knocked down and arescued cell – all subjected to the same amount of com-pression. Depletion of a-actinin-1 markedly decreasesthe number of SFs as well as the apparent extent ofcrimping (compare Figs. 2b and 2c). More importantly,there is no clear difference between the rescued and thecontrol cell (compare Figs. 2b and 2d), suggesting this

phenotype is indeed derived from a-actinin-1 depletion,not off-target effects. The pre-extension data are sum-marized in Table II. The pre-extension of mock cells orthose treated with control shRNA do not differ fromeach other. The pre-extension increases dramatically inthe knock-down cells but is restored back to values notsignificantly different from those in the mock or nonspe-cific shRNA treated cells. Hence, these results substanti-ate a specific role of a-actinin-1 in determining pre-extension.

Table III also summarizes the a-actinin-1 wave-length data. The average wavelengths for the four groupsare all close to 2 lm with no statistically significant dif-ference among the groups. The distribution of a-actinin-1 along the crimped SF is shown in Fig. 3a. It is distrib-uted not only at the ends of wave, but also along itscurved portion. Figure 3b shows the distribution of MLCdemonstrating a distribution similar to that of a-actinin-1.

Disrupting the Actin Cytoskeleton

Figure 4a illustrates the representative effects of asingle 25% stretch on the actin cytoskeleton. Immedi-

TABLE III. Summary of the Wavelengths of Randomly Selected Buckled SFs Under

Different Conditions

km 1.25 1.47

Control 1.90 6 0.38 (N 5 50) 2.056 0.43 (N 5 174)

Nocodazole 2.33 6 0.79* (N 5 100)

Acrylamide with colocalized SFs 1.93 6 0.46 (N 5 41)

Acrylamide without colocalized SFs 2.89 6 0.89* (N 5 29)

Control shRNA 2.116 0.18 (N 5 179)

a-Actinin-1 shRNA 2.036 0.22 (N 5 195)

Rescued a-actinin-1 1.906 0.20 (N 5 171)

N denotes the number of waves examined for each condition.

*Denotes significant difference (P < 0.05) from the control value.

TABLE II. Summary of SF Pre-Extensions for All the Interventions

km 1.15 1.25 1.4 1.47

Control 1.0946 0.015 (N 5 26) 1.095 6 0.013 (N 5 38) 1.0996 0.016 (N 5 27) 1.099 6 0.031 (N 5 35)

BDM 1.045 6 0.024* (N 5 36) 1.0506 0.021* (N 5 34)

Blebbistatin 1.044 6 0.022* (N 5 72) 1.0496 0.022* (N 5 52)

Calyculin A 1.2626 0.036* (N 5 50)

Mechanical disruption–

single stretch

1.092 6 0.023 (N 5 44)

Mechanical–cyclic stretch 1.100 6 0.029 (N 5 28)

Chemical disruption 1.100 6 0.023 (N 5 48)

Acrylamide 1.094 6 0.034 (N 5 14)

Nocodazole 1.104 6 0.035 (N 5 15)

a-Actinin-1

Control shRNA 1.096 6 0.046 (N 5 49)

Knockdown 1.2826 0.050*# (N 5 64)

Rescue 1.136 6 0.025 (N 5 47)

N denotes the number of cells examined for each condition. Values are averages 6 standard deviations from at least three independent experi-

ments. For each cell, an average of 176 5 stress fibers were examined.

*Denotes significant difference (P < 0.05) from the control value for that km.#Denotes significant difference (P < 0.05) from the rescued a-actinin-1 value.

Actin Stress Fiber Pre-extension 287

ately after the stretch there is clear evidence of fragmen-tation of most of the horizontally-oriented SFs. In many,but not all cells, this fragmentation was followed bynearly complete disruption of all of the SFs (data notshown). After 5 h of recovery, the SFs reorganized andappeared indistinguishable from unperturbed cells (datanot shown). Figure 4b shows SFs in a representative cellwhich had been allowed to recover for 5 h after the largesingle stretch and then was shortened from a km of 1.25.There is clear evidence of crimped SFs. Similarly, after5 min of 25% cyclic stretching, the SFs are completelydisrupted (Fig. 4c). After 5 h of recovery the SFs of cells

shortened at km of 1.25 are not discernibly differentfrom those in the undisrupted cells (Fig. 4d). The pre-extension data for the mechanically-disrupted and thenrecovered SFs are summarized in Table II. After eithertype of mechanical disruption and recovery, the pre-extensions do not differ significantly from those in con-trol cells.

A representative cell in Fig. 4e shows that SFs aretotally disrupted after 30 min treatment with 5 lM cyto-chalasin B. The appearance of the actin cytoskeletonafter 10 h of recovery did not differ from that incontrol cells (data not shown). Figure 4f shows the SFs

Fig. 2. Effect of modulating a-

actinin-1. (a) Anti-a-actinin-1 West-

ern blot of untransduced, mock

cells (lane 1), and those transduced

with control shRNA lentivirus

(lane 2), a-actinin-1 shRNA lenti-

virus (lane 3), and a-actinin-1/rr-

a-actinin-1-GFP (lane 4). Lower

panels are anti-vinculin loading

control blots. Fluorescent micro-

graphs of SFs in a representative

cell treated with control shRNA

(b), an a-actinin-1 knockdown cell

(c) and an a-actinin-1 rescued cell

(d). [Color figure can be viewed in

the online issue, which is available

at www.interscience.wiley.com.]

288 Lu et al.

in a representative cell shortened from a km of 1.47 after10 h of recovery from cytochalasin B treatment. Theappearance of these SFs is similar to those of untreated,shortened cells. Summary data are shown in Table II.The pre-extensions in the chemically disrupted and thenrecovered cells do not differ from those of control cells.

Disrupting MTs or IFs

Figures 5a and 5b illustrate the effect of 0.33 lMnocodazole treatment on MTs in a representativeuntreated cell and in a treated cell. Compared to theintact MTs in the untreated cell, the MTs are essentiallycompletely disrupted after Nocodazole treatment. Fig-ure 5c shows representative SFs in cells shortened fromkm of 1.47 after their MTs were disrupted with Nocoda-zole. The appearance is similar to that of untreated cells(Fig. 1d).

A representative cell showing the effect of 40 mMacrylamide treatment on IFs compared to a control cell isshown in Figs. 5d and 5e. Unlike the widespread effectof Nocodazole on MTs, the effect of acrylamide ispatchy. That is, within the same cell IFs are disrupted insome regions but not others. Figure 5f illustrates theeffects of cell compression from km of 1.47 on SFs inregions with intact as well as disrupted IFs. There is noclear difference in the appearance of the crimped SFsregardless of whether or not IFs were intact. There is nosignificant difference in the value of SF pre-extensionfrom regions with and without intact IFs (data notshown). The effects of both Nocodazole and acrylamideon SF pre-extension are summarized in Table II. Thepre-extension values after either MTs or IFs being dis-rupted do not differ significantly from each other norfrom those of untreated control cells.

Table III lists the effect of disrupting MTs or IFson the wavelengths of the crimped SFs. Disruption ofMTs significantly increases wavelengths. The effects ofacrylamide depend on whether or not the IFs were intact.In the regions of cells with intact IFs the wavelengths arenot different from control values. In contrast, in regionswhere IFs are disrupted, the wavelengths are increasedsignificantly.

DISCUSSION

The findings of this study have some importantimplications for our understanding of cell mechanics,particularly related to the contribution of actin stressfibers. As discussed earlier, there is other evidence forSF pre-extension. A recent study with C2C12 skeletalmyocytes found that, after one end was detached fromthe underlying substrate, the cells shortened to 90% oftheir original lengths [Griffin et al., 2004]. While onecannot extrapolate directly from entire cells to individual

Fig. 3. Distribution of a-actinin-1 and MLC of buckled SFs. (a) Flu-

orescent individual and merged micrographs of SFs and rr-a-actinin-1

showing the colocalization of SF with a-actinin-1 for a km of 1.47 in a

cell after knockdown and rescue of a-actinin-1. The arrowheads point

to the ends of one representative SF wave. a-Actinin-1 was located

both on the peak and at the ends of this wave. (b) Fluorescent individ-

ual and merged micrographs of SFs and MLC showing their colocali-

zation for a km of 1.47 in a cell whose a-actinin-1 was not perturbed.

The arrowheads and arrows denote the ends of two representative SF

waves, respectively. For one wave, MLC is located both on the curved

part and at the ends (arrowheads), while for the other wave, MLC is

located both on the peak and at the ends (arrows). Scale bar5 5 lm.

Actin Stress Fiber Pre-extension 289

SFs, this finding is consistent with the pre-extensionvalues we found. After the myocytes were treated with50 lM blebbistatin, the cell length only shortened to96%, which is also consistent with the decreased SF pre-extension we found after decreasing contractility. Theestimated values of pre-extension of 1.08 and 1.1 fromthe earlier study from our laboratory [Costa et al., 2002]are close to the values found in the present study.

Even though internal loading causes both SF pre-extension and residual strains in intact vessels [Chuongand Fung, 1986; Vaishnav and Vossoughi, 1986], the ori-gins of the loading differ. Residual strains are the result-ant of the internal stresses necessary to cause a vessel todeform from its completely unloaded, opened conditionto its intact shape. In contrast, SF pre-extension arisesfrom the internal stresses caused by adherence of cells to

Fig. 4. Effect of cytoskeleton reorganization. (a) SFs from a cell

subjected to a single 25% stretch in the horizontal direction. (b) SFs in

a cell shortened back to the original length after a single 25% stretch

and then allowed to recover for five-hours. Insets are the magnified

images of the regions demarcated by the rectangles. (c) SFs from a

cell subjected to 5-min 25% cyclic stretch in the horizontal direction.

(d) SFs in a cell shortened back to the original length after 25% stretch

and then allowed to recover for five-hours. (e) SFs in a cell treated

with 5 lM cytochalasin B. (f) SFs in a cell shortened from a km of

1.47 after a 10-h recovery from 5 lM cytochalasin B treatment.

[Color figure can be viewed in the online issue, which is available at

www.interscience.wiley.com.]

290 Lu et al.

a substrate. Thus, endothelial cells in a full-thicknessportion of an opened vessel are still likely to be inter-nally stressed. Only when the cells are physically sepa-rated from their substrates will these stresses be com-pletely relieved. This is akin to the different unloadedreference states needed to describe the mechanics of var-ious layers of heart walls or blood vessels [Humphreyet al., 1990; Xie et al., 1995]. The finding in our previous

study [Sipkema et al., 2003] that endothelial cell SFsresponded to stretching of the entire vessel clearly indi-cates that they are adherent. Based on the above consid-erations, it is likely that the SFs in those cells were alsopre-extended.

Our present results document that SF pre-extensionis governed primarily by the level of contractile interac-tion between myosin and actin. After the actin cytoskele-

Fig. 5. Effect of disrupting MTs and IFs. Fluo-

rescent micrographs of MTs in a representative

unshortened control cell (a) and a cell treated

with 0.33 lM Nocodazole (b). SFs from a cell

treated with 0.33 lM Nocodazole and shortened

from a km of 1.47 (c). Fluorescent micrographs

of IFs in an unshortened control cell (d) and a

cell treated with 40 mM acrylamide (e). Double

staining of SFs (green) and IFs (red) from a cell

treated with 40 mM acrylamide and shortened

from km of 1.47 (f).

Actin Stress Fiber Pre-extension 291

ton is largely disrupted and recovers, the pre-extension isthe same as in unperturbed cells. This is not altogethersurprising since the contractile level should not havebeen affected by the disruption and recovery. This isanother example of the tightly regulated conditionswithin cells. The increased pre-extension in cells inwhich a-actinin-1 is knocked down can also beexplained by increased contractility. Studies in other celltypes have shown that the kinetics of a-actinin interac-tions with actin filaments are faster than those of MLCwith actin [Hotulainen and Lappalainen, 2006]. Sincemyosin and a-actinin binding to actin are mutuallyexclusive, knockdown of a-actinin should allow rela-tively more myosin interactions with actin. This could bemanifested as increased contractility and hence anincrease in pre-extension.

A recent elegant study provides a reasonable expla-nation of the origin of SF pre-extension [Hotulainen andLappalainen, 2006]. Ventral SFs appear to be formed bythe interaction of dorsal actin SFs and transverse actinarcs. Dorsal SFs elongate from a single focal adhesionby an mDia1/DRF-1 regulated mechanism whereastransverse arcs, which are not attached to focal adhe-sions, elongate by end-to-end annealing. After two dorsalSFs attach to a portion of a transverse arc the freeregions of the arc disconnect and disassemble. Theremaining SF then contracts against the focal adhesionsadhered to the substrate resulting in a pre-extended ven-tral SF. This only occurs, however, if the focal adhesionsare connected to a suitably stiff substrate which is able toresist the internal tension.

For any discrete structure that has elements in ten-sion, there must be some other elements that are undercompression to provide the necessary force balance forstability. In a cell it is not clear what structure(s) is (are)under compression. The so-called tensegrity model[Ingber, 1993] proposes that MTs support the compres-sive forces. However, our finding that the pre-extensionis unchanged after the MTs are disrupted strongly arguesagainst these being the major compression-bearing struc-tures. That MTs play some role, however, was shown insmooth muscle cells by a small transfer of traction forcesto the substrate after MTs were disrupted with Nocoda-zole [Stamenovic et al., 2002]. Similarly, although thepatchy nature of intermediate filament disruption pro-duced by acrylamide makes interpretation more difficultthan for MTs, our findings also suggest that IFs are notthe major structures that support compression. A morelikely candidate is the substrate. This contention is sub-stantiated by findings that SFs were observed only whenplated on substrates stiffer than about 3000 Pa [Yeunget al., 2005]. With softer substrates, the cells were viablebut did not have SFs. Although substrate stiffness is ofkey importance, there may be other factors within or out-

side the cell that also help to resist this tension. Forexample, when cells contact one another in culture, SFswere seen, even on very soft substrates [Yeung et al.,2005]. The stiffness of the neighboring cells could besufficient to provide the necessary support.

The pattern of multiple crimps or waves betweenthe focal adhesions can be explained by two differentmechanisms. First, there could be structures such as actinbinding protein(s) distributed with a spacing of about 2microns along the SF that serve as an external mechani-cal support. Compressing the SF at its ends in the pres-ence of these intermediate supports could result in whatappear to be multiple waves between the focal adhesions.The identity of this protein, or indeed, if it even exists, isnot known but it is unlikely to be a-actinin-1 sinceknocking it down did not affect the wavelength. More-over, its distribution, like that of MLC, is not only nearthe ends of a buckled wave but also in the curved por-tion. These findings are consistent with previouslyreported distances of a-actinin bands and between neigh-boring MLC along a SF to be 0.8 lm and 0.75 lm,respectively, for fibroblasts [Peterson et al., 2005] and0.8 lm and 0.66 lm, respectively for bovine aortic endo-thelial cells [Malek et al., 2006]. These distances are allsmaller than the wavelength of the buckled SFs.

Slender rods supported only at their ends wherecompressive forces are applied buckle into a single half-sine wave shape. Buckling with multiple waves is typi-cally observed in structures supported laterally alongtheir entire length, e.g. beams on elastic foundations[Timoshenko, 1961]. Thus, a second, and more likely,possibility for the multiple waves between focal adhe-sions is that the MTs or IFs in the cytoplasm serve aslateral support for the SFs. A recent study elegantlyshowed this phenomenon with the finding that the wave-length of buckled MTs in compressed cells increasedwhen actin SFs were disrupted chemically [Brangwynneet al., 2006]. This observation is likely due to the wave-length of such buckled structures being dependent on thefourth root of the ratio of bending stiffness to the stiff-ness of their surroundings. They further documented thevalidity of this notion by showing that a slender rodimmersed in gelatin buckled into multiple waves butbuckled into a half sine-wave when there was no sur-rounding material. Our finding of longer wavelengths incells with disrupted MTs or IFs – both of which shoulddecrease the stiffness of the cytoplasm – is entirely con-sistent with this possibility. Our finding that changingthe contractility of the SF did not affect the wavelengthcan be explained because it would take a very largechange in stiffness of the SF, i.e. its contractility, to bemanifested as a change in wavelength.

There are some potential limitations of our studythat should be kept in mind. First, the dimensions used

292 Lu et al.

for quantification of pre-extension are subject to someuncertainty. We have previously shown that about 80%of the membrane deformation is transmitted to the uppersurface of cells [Wang et al., 2001a]. A larger, butunknown fraction is likely transmitted to the ventral SFs.Since this incomplete transmission involves a scalingfactor applicable to all our measurements, only the actualvalues of the pre-extensions, not our mechanistic interpre-tations, are affected. Another issue is that the measure-ments of SF morphology are two-dimensional projectionsof a three-dimensional structure. Therefore, the dimen-sions are underestimations that depend upon how muchforeshortening occurs. The foreshortening likely differsslightly when the cell is well-spread compared to when itis compressed. Luckily the cells are thin, even whencompressed, and the buckled SFs are localized to themost ventral surface of the cells. These two factorslikely render the uncertainty in estimating Ls to be fairlysmall.

Second, the morphology of the SF crimping is notuniform along the length of the SF. This suggests thepossibility that the mechanical properties of the SF or itsexternal mechanical constraints, differ along its length.This possibility is supported by studies demonstratingsome heterogeneity to the spacing of a-actinin andMLC along SFs, particularly after contractility wasincreased [Peterson et al., 2005]. Further detailed studiesare needed, however, before we can more definitivelyaddress this possibility.

Third, after knockdown of a-actinin-1, the densityand diameters of SFs in the cells were less than those inthe control and rescued cells. We cannot exclude thepossibility that a lower density contributed to theincrease in pre-extension after this intervention. We can,however, exclude size of SFs as a factor because weimpose a desired amount of shortening rather than stress.Using this so-called displacement boundary conditionrenders the size of the SFs irrelevant because the widerange of stresses associated with different sized SFsinduced by this amount of displacement are likely fargreater than any intracellular structure can withstand.That is, we are effectively removing the influence of di-ameter, which otherwise would need to be accounted forif we imposed given stresses rather than displacements.

In summary, the finding that actin stress fibersbuckle or crimp when subjected to compression enablesus to quantify the amount of SF pre-extension. Weexplored several different interventions that affect SFpre-extension. Taken together our results suggest that theamount of pre-extension is governed primarily by thelevel of actin-myosin contractile interaction and not bythe integrity of microtubules or intermediate filaments.In contrast, the integrity of those proteins affects thewavelength of the buckled SFs.

REFERENCES

Banes AJ, Link GW, Jr., Gilbert JW, Tay RTS, Monbureau O. 1990.

Culturing cells in a mechanically active environment. Am Bio-

technol Lab 8:12–22.

Birmingham A, Anderson EM, Reynolds A, Ilsley-Tyree D, Leake D,

Federov Y, Baskerville S, Makisimova E, Robinson K, Karpi-

low J. 2006. 30 UTR seed matches, but not overall identity, are

associated with RNAi off-targets. Nature Methods 3:199–204.

Brangwynne CP, MacKintosh FC, Kumar S, Geisse NA, Talbot J,

Mahadevan L, Parker KK, Ingber DE, Weitz DA. 2006. Micro-

tubules can bear enhanced compressive loads in living cells

because of lateral reinforcement. J Cell Biol 173:733–741.

Brummelkamp CP, MacIntosh FC, Agami R. 2002. A system for sta-

ble expression of short interfering RNAs in mammalian cells.

Science 296:733–741.

Burridge K, Fath K, Kelly T, Nuckolls G, Turner C. 1988. Focal adhe-

sions: Transmembrane junctions between the extracellular ma-

trix and the cytoskeleton. Ann Rev Cell Biol 4:487–525.

Chartier L, Rankin S, Allen RE, Kato Y, Fusetani N, Karaki H,

Watabe S, Hartshorne DJ. 1991. Calyculin-A increases the

level of protein phosphorylation and changes the shape of 3T3

fibroblasts. Cell Motil Cytoskeleton 18:26–40.

Chuong CJ, Fung YC. 1986. On residual stress in arteries. J Biomech

Eng 108:189–192.

Costa K, Hucker WJ, Yin F. 2002. Buckling of actin stress fibers: A

new wrinkle in the cytoskeletal tapestry. Cell Motil Cytoskele-

ton 52:266–274.

Dembo M, Wang YL. 1999. Stresses at the cell-to-substrate interface

during locomotion of fibroblasts. Biophys J 76:2307–2316.

Forer A, Fabian L. 2005. Does 2,3-butanediome monoxime inhibit

monmuscle myosin? Protoplasma 225:1–4.

Griffin MA, Sen S, Sweeney HL, Discher DE. 2004. Adhesion-con-

tractile balance in myocyte differentiation. J Cell Science

117:5855–5863.

Grinnell F, Zhu M, Carlson MA, Abrams JM. 1999. Release of me-

chanical tension triggers apoptosis of human fibroblasts in a

model of regressing granulation tissue. Exp Cell Res 248:608–

619.

Hayakawa K, Sato N, Obinata T. 2001. Dynamic reorientation of cul-

tured cells and stress fibers under mechanical stress from peri-

odic stretching. Exp Cell Res 268:104–114.

Herrmann CWTJ, Travers F, Barman T. 1992. Effect of 2,3-butane-

dione monoxime on myosin and myofibrillar ATPases: An

example of an uncompetitive inhibitor. Biochemistry 31:

12227–12232.

Higuchi H, Takemori S. 1989. Butanedione monoxime suppresses

contraction and ATPase activity of rabbit skeletal muscle.

J Biochem (Tokyo) 105:638–643.

Hotulainen P, Lappalainen P. 2006. Stress fibers are generated by two

distinct actin assembly mechanisms in motile cells. J Cell Biol

173:383–394.

Humphrey JD, Strumpf RK, Yin FCP. 1990. Biaxial mechanical

behavior of excised ventricular epicardium. Am J Physiol

259:H101–H108.

Ingber DE. 1993. Cellular tensegrity: Defining new rules of biological

design that govern the cytoskeleton. J Cell Sci 104:613–627.

Janmey PA. 1998. The cytoskeleton and cell signaling: Component

localization and mechanical couplilng. Physiol Rev 78:763–

781.

Kumar S, Maxwell IZ, Heisterkamp A, Polte TR, Lele TP, Salanga M,

Mazur E, Ingber DE. 2006. Viscoelastic retraction of single

living stress fibers and its impact on cell shape, cytoskeletal

organization, and extracellular matrix mechanics. Biophys J

90:3762–3773.

Actin Stress Fiber Pre-extension 293

Limouze J, Straight AF, Mitchison T, Sellers JR. 2004. Specificity of

blebbistatin, an inhibitor of myosin II. J Muscle Res Cell Motil

25:337–341.

Lin X, Ruan X, Anderson MG, McDowell JA, Kroeger PE, Fesik SW,

Shen Y. 2005. siRNA-mediated off-target gene silencing trig-

gered by a 7 nt complementation. Nucleic Acids Res 33:4527–

4535.

Ma Y, Creanga A, Lum L, Beachy PA. 2006. Prevalence of off-target

effects in Drosophila RNA interference screens. Nature

443:359–363.

Malek AM, Xu C, Kim ES, Alper SL. 2006. Hypertonicity triggers

Rho A-dependent assembly of myosin-containing striated po-

lygonal actin networks in endothelial cells. Am J Physiol Cell

Physiol 292:C1645–C1659.

McKillop DF, Fortune NS, Ranatunga KW, Geeves MA. 1994. The

influence of 2,3-butanediome monoxime (BDM) on the interac-

tion between actin and myosin in solution and in skinned mus-

cle fibres. J Muscle Res Cell Motil 15:309–318.

Molitoris BA. 2004. Actin cytoskeleton in ischemic acute renal fau-

lure. Kidney Int 66:871–883.

Ostap EM. 2002. 2,3-butanediome monoxime (BDM) as a myosin in-

hibitor. J Muscle Res Cell Motil 23:305–308.

Otey CA, Carpen O. 2004. Alpha-actinin revisited: A fresh look at an

old player. Exp Cell Res 58:104–111.

Pelham RJ, Wang YL. 1997. Cell locomotion and focal adhesions are

regulated by substrate flexibility. Proc Natl Acad Sci USA

94:13661–13665.

Peterson L, Rajfur Z, Maddox AS, Freel CD, Chen Y, Edlund M,

Otey C, Burridge K. 2005. Simultaneous stretching and

contraction of stress fibers in vivo. Mol Biol Cell 15:3497–

3508.

Polte TR, Eichler GS, Wang N, Ingber DE. 2004. Extracellular matrix

controls myosin light chain phosphorylation and cell contractil-

ity through modulaiton of cell shape and cytoskeletal prestress.

Am J Physiol 286:C518–C528.

Pourati J, Maniotis AJ, Spiegel D, Schaffer JL, Butler JP, Fredberg JJ,

Ingber DE, Stamenovic D, Wang N. 1998. Is cytoskeletal ten-

sion a major determinant of cell deformability in adherent en-

dothelial cells? Am J Physiol 274:C1283–C1289.

Qin XF, An DS, Chen IS, Baltimore D. 2003. Inhibiting HIV-1 infec-

tion in human T cells by lentiviral-mediated delivery of small

interfering RNA against CCR5. Proc Natl Acad Sci USA

100:183–188.

Sato K, Adachi T, Matsuo M, Tomita Y. 2005. Quantitative evaluation

of threshold fiber strain that induces reorganization of cytoske-

letal actin fiber architecture in osteoblastic cells. J Biomech

38:1895–1901.

Sipkema P, van der Linden PJW, Westerhof N, Yin F. 2003. Effect of

cyclic axial stretch of rat arteries on endothelial cytoskeletal

morphology and vascular reactivity. J Biomech 36:653–659.

Stamenovic D, Mijailovich SM, Tolic-Norrelykke IM, Chen J, Wang

N. 2002. Cell prestress. II. Contribution of microtubules. Am J

Physiol 282:C617–C624.

Straight AF, Cheung A, Limouze J, Chen I, Westwood NJ, Sellers JR,

Mitchison TJ. 2003. Dissecting temporal and spatial control

of cytokinesis with a myosin II inhibitor. Science 299:1743–

1747.

Takemasa T, Sugimoto K, Yamashita K. 1997. Amplitude-dependent

stress fiber reorientation in early response to cyclic strain. Exp

Cell Res 230:407–410.

Takemasa T, Yamaguchi T, Yamamoto Y, Sugimoto K, Yamashita K.

1998. Oblique alignment of stress fibers in cells reduces the

mechanical stress in cyclically deforming fields. Eur J Cell

Biol 77:91–99.

Timoshenko S. 1961. Theory of Elastic Stability. New York:

McGraw-Hill.

Tomasek JJ, Haaksma CJ, Eddy RJ, Vaughan MB. 1992. Fibroblast

contraction occurs on release of tension in attached collagen

lattices: Dependency on an organized actin cytoskeleton and

serum. Anat Rec 232:359–368.

Vaishnav RN, Vossoughi J. 1986. Residual stress and strain in aortic

segments. J Biomech 20:235–239.

Wang JH-C, Goldschmidt-Clermont P, Yin FCP. 2000a. Contractility

affects stress fiber remodeling and reorientation of endothelial

cells subjected to cyclic mechanical stretching. Ann Biomed

Eng 28:1165–1171.

Wang JH-C, Goldschmidt-Clermont P, Yin FCP. 2000b. Contractility

and reactive oxygen species affect actin cytoskeleton remodel-

ing of the endothelial cell to mechanical stretching. Ann

Biomed Eng 28:1165–1171.

Wang JH-C, Goldschmidt-Clermont P, Wille J, Yin FCP. 2001a.

Specificity of endothlial cell reorientation in response to cyclic

mechanical stretching. J Biomech 34:1563–1572.

Wang N. 1998. Mechanical interactions among cytoskeletal filaments.

Hypertension 32:162–165.

Wang N, Naruse K, Stamenovic D, Fredberg JJ, Mijailovich SM,

Tolic-Norrelykke IM, Polte T, Mannix R, Ingber DE. 2001b.

Mechanical behavior in living cells consistent with the tensegr-

ity model. Proc Natl Acad Sci 98:7765–7770.

Wang N, Tolic-Norrelykke IM, Chen J, Mijailovich SM, Butler JP,

Fredberg JJ, Stamenovic D. 2001c. Cell prestress. I. Stiffness

and prestress are closely associated in adherent contractile

cells. Am J Physiol 282:C606–C616.

Wiche G. 1998. Role of plectin in cytoskeletal organization and dy-

namics. J Cell Sci 111:2477–2486.

Wille JW, Ambrosi CM, Yin FCP. 2004. Comparison of the effects

of cyclic stretching and compression on endothelial cell

morphological responses. ASME J Biomech Eng 126:545–

551.

Xie J, Zhou J, Fung YC. 1995. Bending of blood vessel wall: Stress-

strain laws of the intima-media and adventitial layers. J Bio-

mech Eng 117:136–145.

Yarrow JC, Lechler T, Li R, Mitchison T. 2003. Rapid de-localization

of actin leading edge components with BDM treatment. BMC

Cell Biol 4:5.

Yeung T, Georges PC, Flanagan LA, Marg B, Ortiz M, Funaki M,

Zahir N, Ming W, Weaver V, Janmey PA. 2005. The effects of

substrate stiffness on cell morphology, cytoskeletal structure,

and adhesion. Cell Motil Cytoskeleton 60:24–34.

294 Lu et al.