acidos nucleicos cepre

Download Acidos Nucleicos cepre

Post on 11-Oct-2015

17 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • CIDOS NUCLEICOSBIOMOLCULAS ORGNCIAS

  • I. DEFINICIN:Biomolculas orgnicas pentarias formados por C,H,O,N,P.Constituidos por una pentosa, bases nitrogenadas y grupos fosfatos

    Constituidas por cientos o miles de unidades estructurales: Nucletidos.

  • II. COMPOSICIN O ESTRUCTURA MOLECULARFormada por una o dos cadenas de miles de nucletidos

  • NUCLETIDOSMonmero de los cidos nuclicos compuestos por: cido fosfricoPentosaBase nitrogenadaNucletido

  • CIDO FOSFRICO (H3PO4)Responsable del carcter cido de los cidos nuclicos.Posee tres grupos OH.Sirve para unir los nucletidos entre s.

  • GLCIDO: PENTOSAAzcar de 5 carbonos que puede ser: Ribosa en el ARNDesoxirribosa en el ADNConstituye el esqueleto principal (central) de los cidos nucleicos.DesoxirribosaRibosa

  • BASES NITROGENADAS Componentes cclicos de Nitrgeno y Carbono en sus anillos.Pueden ser purinas o pirimidinas

  • PURINASMoleculas organicasSon la Adenina (A) y la Guanina (G)99

  • PIRIMIDINAS

    Son la Timina (T) citosina (C) y Uracilo (U).1TiminaCitosinaUraciloADNARN

  • UN PITUCDOS PUAGUn anilloDos anillosPIRIMIDINASPURINASTIMINAURACILOCITOSINAADENINAGUANINAMNEMOTECNIA:

  • NUCLESIDOSEs la unin de una base nitrogenada (purina o pirimidina) con un azcar (pentosa). Es decir, el nuclesido fosforilado es un nucletido.

    NUCLESIDO = Base nitrogenada + Pentosa

    NUCLETIDO = NUCLESIDO + Ac. Fosfrico

  • NUCLEOSIDOS DEL ADNDesoxiadenosina . adenosina - desoxirribosaDesoxiguanosina. Guanina - desoxirribosaDesoxicitidina : citosina - desoxirribosaDesoxitimidina : Timina desoxirribosa

    NUCLEOSIDOS DEL ARNAdenosina: Adenina + ribosaGuanosina: Guanina + ribosaCitidina : Citosina + ribosaUridina : uracilo + ribosa

  • FORMACIN DE UN NUCLETIDO(Unin nuclesido cido fosfrico)El cido fosfrico se une con la pentosa en el C5.

  • ENLACE FOSFODISTERResulta de la reaccin entre el OH de la pentosa de un nucletido (C3) y el grupo OH de un fosfato de otro nucletido (C5), liberndose una molcula de agua.

  • La unin de varias cadenas de nucletidos mediante enlace fosfodister forman: POLINUCLETIDOS.

  • IV. CLASIFICACIN DE LOS CIDOS NUCLICOS- ADN- ARN

  • En 1953, James Watson y Francis Crick combinaron los datos qumicos y fsicos del DNA, y propusieron un modelo estructural del DNA: la doble hlice

  • 1. CARACTERSTICAS: Constituido por: purinas A,Gpirimidinas T,C

  • Dos cadenas de polidesoxirribonucletidos antiparalelas, complementarias y helicoidales.

    Polidesoxi rribonucletidos porque poseen desoxirribosa.

    2. ESTRUCTURA

  • Antiparalelas porque ambas cadenas viajan en direccin opuesta: una en 53 y otra en 35 35

  • Sus cadenas son complementarias. Las parejas de bases que se unen se llaman complementariasadeninatiminacitosinaguaninanucletidostimina

  • Cumple la Ley de Chargaff: Suma de purinas = suma de pirimidinas A+G =T+CErwin Chargaff,1949 [A]=[T][G]=[C] ATCGGTACCGTTACCGTTGACCTGGTTAAAGCCCGTGCTAGCCATGGCAATGGCAACTGGACCAATTTCGGGCACG5533Cadena complementaria

  • Las bases nitrogenadas se unen a travs de puentes de hidrgeno.

  • Sus cadenas son helicoidales brindando una estructura de doble hlice que asemeja a una escalera de caracol

  • ESTRUCTURA DEL ADNEl ADN presenta varios niveles estructurales.1. Estructura primaria: Una sola hebra.2. Estructura secundaria: Doble hlice.3. Estructura terciaria: Empaquetado con histonas, formando un collar de perlas.4. Estructura cuaternaria fibra de 300 A.

  • ARNEs el AN ms abundante en la clula. Una clula tpica contiene 10 veces ms RNA que DNA. Segn las modernas teoras sobre el origen de la vida, el RNA fue el primer biopolmero que apareci en la corteza terrestre.

  • 1. CARACTERSTICAS: Constituido por purinas (A,G) y pirimidinas (U,C).Es una molcula unicatenaria, formada por una cadena de polirribonucletidos.

  • 2. CLASES:

    En procariotas existe 3 tipos: ARN mensajero (ARNm)ARN de transferencia (ARNt) y ARN ribosmico (ARNr) En eucariotas existen 4 tipos: Los tres anteriores y adems El ARN heterogneo nuclear (ARNhn)

  • ARN hnen el ncleo.Es el precursor del ARNm, ARNt y ARN r.

  • ARNmSale del ncleo hacia los ribosomas con la informacin para la sntesis de protenas.Est formado por CODONES (secuencia de triples de nucletidos).

  • ARNtreconoce los codones del ARNmTransporta y adapta a los aminocidos durante la sntesis proteica.

  • ARNrForma el 65% del volumen del ribosoma. Algunos poseen actividad cataltica (ribozimas).

    **********************************

Recommended

View more >