a unique rna structure formed by a long-distance ... singh.pdf · natalia singh and ravindra singh...

24
Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA [email protected] A unique RNA structure formed by a long-distance interaction uncovers the therapeutic potential of a deep intronic sequence July 5, 2014, Salzburg, Austria

Upload: others

Post on 27-Jun-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Natalia Singh and Ravindra Singh Department of Biomedical Sciences

Iowa State University, USA [email protected]

A unique RNA structure formed by a long-distance interaction uncovers the therapeutic potential of a deep

intronic sequence

July 5, 2014, Salzburg, Austria

Page 2: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Organization of SMN protein

Howell et al., Future Med Chemistry, 6 (9), 1081-1099, 2014

Page 3: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Two SMN Genes as inverted repeats on 5q11-q13!

NAIP SMN2

AG-1 C212 NAIP SMN1

AG-1 C212

1 2a 2b 3 4 5 6 7 8

G C C

A A

1 2a 2b 3 4 5 6 7 8

A T T

C C

500 Kb 500 Kb

282 aa! 294 aa!

Spinal Muscular Atrophy (SMA)!!SMN1

!"#$%

!"#&%

'()*%+%,%*-.)%/%01233*4%

5% /% 6%5% 6%

$% &%5% 67%

Page 4: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Regulatory elements of SMN pre-mRNA

Master checkpoint

Howell et al., Future Med Chemistry, 6 (9), 1081-1099, 2014

Page 5: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

8!!9#$%

:-5% :-/% :-6%8);<.)%/%

GUAAGUCUGCCAGCAUUAUGAAAGUGAAUCUUACUUUUGUAAAACUUUAUGGUUUGUGG!#$!$=9$>%?@()*%>A%#$!$B9$C%?@()*%BA%

#$!$=9$C%?@()*%CA%

#$!&=9&>%?@()*%5A%

#$!$B9&>%?@()*%$=A%

#$!&B9&C%?@()*%/A%#$!7=97>%?@()*%6A%

#$!&=9&C%?@()*%$$%#$!&B97>%?@()*%$&A%

#$!$B9&C%?@()*%$>A%#$!&=97>%?@()*%$BA%#$!&B97C%?@()*%$5A%

#$!$=97>%?@()*%$6A%#$!$=9&C%?@()*%$/A%

!"#&%?@()*%7A%

ISS-N1 is a strong intronic splicing silencer

$% &% 7% /%5%B%>%

5% /% 6%5% 6%

'()*%+%,%*-.)%/%01233*4%

$$% $&% $7%6% C% $=% $>% $B%#D% >% 6$% />%$C%6C%>$% /% 7% 6&%6C% B>% &C% B% B%

!"#$%

!"#&%

#$!

$=9$>%

#$!

$B9$C%

#$!

$=9$C%

#$!

&=9&>%

#$!

$B9&>%

#$!

&B9&C%

#$!

7=97>%

#$!

&=9&C%

#$!

&B97>%

#$!

$=9&>%

#$!

$B9&C%

#$!

&=97>%

#$!

&B97C%

#$!

$=9&C%

#$!

$=97>%

E*F;.<%

$5% $/% $6%&/%7C%6$%

#$!$=9&>%?@()*%$7A%

5´SS !

Singh et al. Mol. Cell. Biol. 26, 1333-1346, 2006!

Page 6: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

ISS-N1 is a target for an antisense oligonucleotide (ASO)-mediated correction of SMN2 exon 7 splicing

#.)

*%

".F1%

D)G9#$%

D)G9#$H$=%

D)G9#$H&=%

D)G9#$H7=%

5% /% 6%5% 6%

'()*%+%

,%*-.)%/%01233*4%$% &% 7% 5%B%>%/% 6$% 66%5/%/$%>%

GUAAGUCUGCCAGCAUUAUGAAAGUGAAUCUUACUUUUGUAAAACUUUAUGGUUUGUGG!

D)G9#$% D)G9#$H$=% D)G9#$H&=% D)G9#$H7=%

8!!9#$%

:-5% :-/% :-6%8);<.)%/%

:-B% :->% :-7% :-&I% :-&(% :-$%

!"D%J(G*);%K2I<.I@(0;% H%9% H% H% H% H%#.<L(@%K2I<.I@(0;% 9%H% 9% 9% 9% 9%

5´SS !

Singh et al. Mol. Cell. Biol. 26, 1333-1346, 2006!US Patent # US 2007/0292408 !

Mutation!

3´SS !

Page 7: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Studies with ISS-N1-targeting ASOs

Sivanesan et al., Transl. Neurosci., 4, 1-7, 2013!

Page 8: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Relative efficacy of drug candidates in !7SMA mice!

Seo et al., Biochim. Biophys Acta, 1126, 271-83 2013!

ISS-N1 targeting ASO

ISS-N1 targeting ASO

Gene Therapy

days

Page 9: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Singh et al., RNA 16, 1167-1181, 2010

Antagonistic response of two ASOs that bind to targets differing in a single nucleotide

Page 10: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

RNA 16, 1167-1181, 2010

ASO-based approach reveals a long-distance interaction (LDI)

Page 11: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Primary site of LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 12: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Smallest motif for LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 13: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of point mutations within the smallest motif for LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 14: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of structure-associated mutations on LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 15: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of compensatory mutations on LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 16: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of negative regulators on LDI

Nucleic Acids Research 41, 8144-8165, 2013!

Page 17: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Structure of SMN2 intron 7 (Probed by SHAPE)

ISS-N2!

Nucleic Acids Research 41, 8144-8165, 2013!

Page 18: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Validation of the 5" strand of ISTL1

NAR 41, 8144-8165, 2013

Page 19: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Validation of the 3" strand of ISTL1 formation

Nucleic Acids Research 41, 8144-8165, 2013!

Page 20: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of L14 and F14 on RNA secondary structure of SMN2 intron 7

Nucleic Acids Research 41, 8144-8165, 2013!

Page 21: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Structural basis of the effect of ASOs F14 pathway ! Exon 7 inclusion

L14 pathway ! Exon 7 exclusion

Nucleic Acids Research 41, 8144-8165, 2013!

Page 22: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Is ISS-N2 a new antisense target ?

ISS-N2

Nucleic Acids Research 41, 8144-8165, 2013!

Page 23: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Effect of ISS-N2-targeting ASOs on SMN2 exon 7 splicing

:-5% :-/% :-6%8);<.)%/%

:-B% :->% :-7% :-&I% :-&(% :-$%5´SS !

Mutation!

Nucleic Acids Research 41, 8144-8165, 2013!

Page 24: A unique RNA structure formed by a long-distance ... Singh.pdf · Natalia Singh and Ravindra Singh Department of Biomedical Sciences Iowa State University, USA singhr@iastate.edu

Mechanism of splicing correction by a deep intronic target

Nucleic Acids Research 41, 8144-8165, 2013!