A Systems Approach to A Systems Approach to Measuring the Binding Measuring the Binding Energy Landscapes of Energy Landscapes of Transcription FactorsTranscription Factors

ByBy

Sebastian J. MaerklSebastian J. Maerkl

Stephen R. QuakeStephen R. Quake

BackgroundBackground

Measuring affinities was a difficult task:Measuring affinities was a difficult task: The traditional method cannot be used to The traditional method cannot be used to

measure interactions with small affinities.measure interactions with small affinities. Results were often “1 or 0”.Results were often “1 or 0”.

The new method provides solution by comThe new method provides solution by combining the microarray and microfluidic techbining the microarray and microfluidic technologynology

BackgroundBackground

How is a specific protein How is a specific protein produced inside a produced inside a cell?cell?

DNA

RNA PolymeraseRNA

Transcription FactorTranscription Factor

Where should I bind to?

RNA Polymerase

Transcription Factor

DNA

Transcription FactorTranscription Factor

A protein that mediates the binding of RNA A protein that mediates the binding of RNA polymerase and the initiation of transcription. polymerase and the initiation of transcription. (Wiki)(Wiki)

Without transcription factor, RNA synthesis cannot occur, thus protein production.

A transcription factor can actually bind to a number of different initialization zone of gene—how does it know where to go for a specific RNA/protein synthesis?

Revisit Revisit

With the traditional methods, we were unable to With the traditional methods, we were unable to produce…produce… ThisThis

With the ability to quantify the absolute affinities of interactions, we are given the ability to produce a detailed graph such as the one above.

This provides a lot more useful information.

What can we achieve?What can we achieve?

Predict in vivo function for 2 yeast TFs.Predict in vivo function for 2 yeast TFs.

Make a comprehensive test of the base Make a comprehensive test of the base additivity assumption.additivity assumption.

Test the hypothesis that the base region Test the hypothesis that the base region alone determines binding specificity of alone determines binding specificity of bHLH TFs. bHLH TFs.

MITOMIMITOMI

The new method, mechanically induced trThe new method, mechanically induced trapping of molecular interactions, provides apping of molecular interactions, provides solution by fusing the microarray and micrsolution by fusing the microarray and microfluidic technology together.ofluidic technology together.

MITOMIMITOMI

1. The DNA Chamber, connecting with the channels which will be filled with other components.

2. The valves controlling flow of the channels.

3. The “button” which creates a circular area when pressure is applied; able to stretch to the bottom of the slide.

The enclosed cell will be used for TF binding energy topography to measure/quantify the affinities.

ProcessProcess

1. Button was pressed to protect the area.

2. The surface other than the protected area is filled by biotinylated bovine serum albumin.

3. The button is released, leaving the protected area ready to be connected to antibodies.

Process ContinuedProcess Continued

4. The channel is filled with DNA, transcription factors, as well as antibodies.

5. The button is again pressed to trap the DNA bound on the bottom of the slides.

ouch

No pocket; zero dead volume.

The ResultsThe ResultsThe results showed that optimal binding sequence is CACGTG. Similar forms also proven to be relatively effective, such as CATGTG, CTCGTG, CAGGTG.

The structures were found in low-affinity range, which couldn’t be detected with traditional methods before.

Additivity Assumption Additivity Assumption

States that each base inside a codon States that each base inside a codon behaves independently, without having to behaves independently, without having to work with its neighbor bases to perform a work with its neighbor bases to perform a task.task.

That is to say, if you substitute bases That is to say, if you substitute bases around, you will get results which shall be around, you will get results which shall be different from the original, but will not be different from the original, but will not be completely off. completely off.

Additivity Assumption Ctd…Additivity Assumption Ctd…

2.5

Substituting 1 base seems to be perfectly fine as the data in blue boxes lies perfectly on the prediction line. Substitution of 2 bases seems to be ok, but then about half of the data points lie distinctively far away from the line.

Additivity Assumption Ctd…Additivity Assumption Ctd…

So…is the data for or against the argument So…is the data for or against the argument that additivity assumption is true? We don’t that additivity assumption is true? We don’t know!know!

PWM fails to predict properly for everything PWM fails to predict properly for everything above 2.5 kcal/mol, because of non-specific above 2.5 kcal/mol, because of non-specific interactions.interactions.

Basic Region is Enough?Basic Region is Enough?

First looking at Pho4p and Cbf1p, which First looking at Pho4p and Cbf1p, which seem to have the same motifs with seem to have the same motifs with CACGTG. CACGTG.

By adding flanking bases at the beginning By adding flanking bases at the beginning or end of the sequence.or end of the sequence.

Pho4p Pho4p CCCCCACGTGCACGTGGGGG

Cbf1p Cbf1p [A/G]GT[A/G]GTCACGTGCACGTGAC[T/C]AC[T/C]

Basic Region is Enough.Basic Region is Enough.

The reason they The reason they couldn’t do it before: couldn’t do it before: could not detect low-could not detect low-affinities. affinities. By cloning the basic By cloning the basic regions of Pho4p and regions of Pho4p and Cbflp into the MAX Cbflp into the MAX isoform B backbone, isoform B backbone, it was shown that the it was shown that the basic region alone is basic region alone is enough for enough for recognition.recognition.

Comparing with other MethodsComparing with other Methods

Trying to list the Trying to list the number of genes number of genes regulated by Pho4p regulated by Pho4p and Cbf1p.and Cbf1p.Pho4p was Pho4p was assumed to work assumed to work on Phosphate on Phosphate metabolism.metabolism.Cbf1p on Cbf1p on Chromosome Chromosome Segregation and Segregation and Methionine Methionine Metabolism.Metabolism.

Comparing with other MethodsComparing with other Methods

-The data seems to be fairly consistent for Pho4p, as for all three different methods, there’s a considerable large region of overlap.

-Data seems to be way off for Cbf1p.

-Where did Microarray go??

No Funding

Comparing with other MethodsComparing with other Methods

Does this mean the MITOMI approach is Does this mean the MITOMI approach is not practical not practical answer is no. answer is no.

The data collected through different The data collected through different approach can be used as reference to approach can be used as reference to each other for possible final confidential each other for possible final confidential result. result.

CritiqueCritique

Clear and distinctive graphical representatiClear and distinctive graphical representations. ons.

Number of experiments provided hereNumber of experiments provided here

The MITOMI method is clearly presented The MITOMI method is clearly presented with details (no hiding techi details)with details (no hiding techi details)

Shadow area for Additivity Assumption Shadow area for Additivity Assumption

Some more reference needed, e.g. for ITTSome more reference needed, e.g. for ITT

ChIP-ChipChIP-Chip

ChIP-ChipChIP-Chip

ChIP-on-chip, also known as genome-widChIP-on-chip, also known as genome-wide location analysis, is a technique for isolate location analysis, is a technique for isolation and identification of the DNA sequenceion and identification of the DNA sequences occupied by specific DNA binding proteins occupied by specific DNA binding proteins in cells. These binding sites may indicate s in cells. These binding sites may indicate functions of various transcriptional regulatfunctions of various transcriptional regulators and help identify their target genes duriors and help identify their target genes during animal development and disease progrng animal development and disease progression. ession.