a synthetic calvin cycle enables autotrophic growth in yeast · 4 73. arabinose 5.an important step...

1

A synthetic Calvin cycle enables autotrophic growth in yeast 1

2

Thomas Gassler1,2, Michael Sauer1,2,3, Brigitte Gasser1,2, Diethard Mattanovich1,2*, Matthias 3

G. Steiger1,2 4

1) Department of Biotechnology, BOKU-VIBT, University of Natural Resources and 5

Life Sciences Vienna, Vienna, Austria 6

2) Austrian Centre of Industrial Biotechnology (ACIB), Vienna, Austria 7

3) CD-Laboratory for Biotechnology of Glycerol, Department of Biotechnology, 8

BOKU-VIBT, University of Natural Resources and Life Sciences Vienna, Austria 9

10

*Corresponding author 11

Prof. Dr. Diethard Mattanovich 12

Department of Biotechnology 13

University of Natural Resources and Life Sciences, Vienna 14

Muthgasse 18 15

1190 Vienna, Austria 16

[email protected] 17

18

Email addresses 19

D. Mattanovich [email protected] 20

T. Gassler [email protected] 21

M. Sauer [email protected] 22

B. Gasser [email protected] 23

M. G. Steiger [email protected] 24

25

26

27

28

29

30

.CC-BY-ND 4.0 International licensewas not certified by peer review) is the author/funder. It is made available under aThe copyright holder for this preprint (whichthis version posted December 3, 2019. . https://doi.org/10.1101/862599doi: bioRxiv preprint

mailto:[email protected]





https://doi.org/10.1101/862599

http://creativecommons.org/licenses/by-nd/4.0/

2

Graphical Abstract 31

32

Abstract 33

The methylotrophic yeast Pichia pastoris is frequently used for heterologous protein 34

production and it assimilates methanol efficiently via the xylulose-5-phosphate pathway. This 35

pathway is entirely localized in the peroxisomes and has striking similarities to the Calvin-36

Benson-Bassham (CBB) cycle, which is used by a plethora of organisms like plants to 37

assimilate CO2 and is likewise compartmentalized in chloroplasts. By metabolic engineering 38

the methanol assimilation pathway of P. pastoris was re-wired to a CO2 fixation pathway 39

resembling the CBB cycle. This new yeast strain efficiently assimilates CO2 into biomass and 40

utilizes it as its sole carbon source, which changes the lifestyle from heterotrophic to 41

autotrophic. 42

In total eight genes, including genes encoding for RuBisCO and phosphoribulokinase, were 43

integrated into the genome of P. pastoris, while three endogenous genes were deleted to 44

block methanol assimilation. The enzymes necessary for the synthetic CBB cycle were 45

targeted to the peroxisome. Methanol oxidation, which yields NADH, is employed for energy 46

generation defining the lifestyle as chemoorganoautotrophic. This work demonstrates that the 47

lifestyle of an organism can be changed from chemoorganoheterotrophic to 48


https://doi.org/10.1101/862599


3

chemoorganoautotrophic by metabolic engineering. The resulting strain can grow 49

exponentially and perform multiple cell doublings on CO2 as sole carbon source with a µmax 50

of 0.008 h-1. 51

Keywords 52

Pichia pastoris, synthetic biology, CO2 assimilation, Calvin cycle, CBB cycle, RuBisCO 53

54

1. Introduction 55

Autotrophic organisms have the capability to use inorganic CO2 as a carbon source to build 56

up their biomass. Inorganic carbon assimilation is essential for a closed carbon cycle on earth 57

and thus supplying heterotrophic organisms with organic carbon sources. The excessive use 58

of fossil resources by mankind led to a global imbalance of the carbon cycle leading to 59

increasing atmospheric CO2 concentrations and to global warming. Finding new ways to 60

reduce atmospheric CO2 requires a better understanding and utilization of the metabolic 61

pathways for assimilation of CO2 into biomass. Biotechnological production hosts are almost 62

exclusively heterotrophs and use feedstocks which compete with feed or food production. 63

One of the key tasks for creating sustainable biotechnological processes in the near future is 64

to use CO2 as a carbon feedstock and thereby reducing the atmospheric levels of this 65

greenhouse gas. The Calvin-Benson-Bassham (CBB) cycle 1 is the predominant of the six 66

naturally occurring CO2 fixation pathways 2,3. Its key enzyme ribulose-1,5-bisphosphate 67

carboxylase/oxygenase (RuBisCO) is considered to be the most abundant enzyme found in 68

the biosphere and fixates around 90% of the inorganic carbon converted into biomass 4. 69

Engineering efforts were made to equip heterotrophic model organisms with CBB cycle 70

genes including Escherichia coli and Saccharomyces cerevisiae. Expressing RuBisCO and 71

phosphoribulokinase (Prk) in E. coli led to a decreased exhaust of CO2 when growing on 72


https://doi.org/10.1101/862599


4

arabinose 5. An important step was achieved by splitting the carbon metabolism of E. coli 73

into modular subunits: one providing energy and reducing equivalents in the form of ATP 74

and NADH, and the other module carrying out the carbon assimilation. As an energy source 75

Antonovsky and coworkers used pyruvate to fuel a synthetic CBB cycle in E. coli enabling 76

“hemiautotrophic” growth 6. The term hemiautotrophic was introduced because only part of 77

the carbon assimilated originated from CO2 and the rest came from pyruvate. In a follow-up 78

study it was shown which mutations E. coli requires to stabilize the metabolic network in 79

order to host a non-native metabolic pathway as the CBB cycle 7. Implementing parts of the 80

CBB cycle in the yeast species S. cerevisiae 8–11 increased yields in ethanol production by 81

using CO2 as an additional electron acceptor to reoxidize NADH. In a recent study, the 82

assimilatory pathway of Methylobacterium extorquens AM1 was blocked by deleting three 83

native genes (ccrΔ, glyAΔ and ftfLΔ). RuBisCO and Prk were overexpressed, resulting in a 84

strain that can incorporate CO2 into biomass using methanol as energy source, but no 85

continuous growth on CO2 as sole carbon source was observed 12. So far, it was not possible 86

to construct a synthetic autotrophic organism which can readily grow on CO2 as a sole carbon 87

source to form its entire biomass. 88

The methylotrophic yeast Pichia pastoris (syn.: Komagataella phaffii) 13,14 is widely used as 89

a production host for heterologous proteins serving both the biopharmaceutical 15 as well as 90

the technical enzyme markets 16. It has gained increased interest as a chassis host for 91

metabolic engineering 17 and as a model organism for studying peroxisome biogenesis 18,19. 92

P. pastoris is capable of a methylotrophic lifestyle enabling it to use the C1 compound 93

methanol as its sole energy and carbon source. After its oxidation to formaldehyde, methanol 94

utilization is split into two branches: in the assimilatory branch methanol is fixated after 95

oxidation to formaldehyde to finally yield phosphosugars needed for biomass generation, 96

while in the dissimilatory pathway energy is produced in the form of NADH. Steps of the 97


https://doi.org/10.1101/862599


5

dissimilatory branch are carried out both in the peroxisome and in the cytosol, while the 98

assimilatory branch is entirely localized in peroxisomes 20. Upon growth on methanol, 99

peroxisomes are highly abundant within the cell and methanol utilization pathway associated 100

enzymes are predominately expressed (e.g. alcohol oxidase 1 (Aox1)). Powerful genetic tools 101

including CRISPR/Cas9 mediated techniques are available for P. pastoris 17,21,22 allowing to 102

re-build and integrate entire metabolic pathways into this host without the use of integrative 103

selection markers. In this work, we use P. pastoris as a chassis cell to de novo engineer a 104

synthetic CBB cycle and to test its capability to promote autotrophic growth on CO2. 105

2. Results 106

The xylulose-monophosphate (XuMP) cycle is used as a template to engineer a synthetic 107

Calvin-Benson-Bassham (CBB) cycle into P. pastoris 108

109

Figure 1. Scheme for engineering chemoorganoautotrophy in Pichia pastoris. (a) Wild type P. 110

pastoris uses methanol (MetOH) for biomass generation in the assimilatory branch of the methanol 111

utilization by fixation of formaldehyde (FA) to xylulose-5-phosphate (Xu5P) which is regenerated 112

in the xylulose monophosphate (XuMP) cycle (purple pathway) and as an energy source in the 113

dissimilatory branch (pink pathway) by oxidation to carbon dioxide (CO 2) under formation of 114

NADH. (b) In an engineered strain methanol assimilation is blocked by deletion of 115

dihydroxyacetone synthase (DAS1 and DAS2) and a synthetic CO2 fixation pathway similar to a 116

Calvin-Benson-Bassham (CBB) cycle is integrated. RuBisCO carboxylates ribulose-1,5-117

bisphosphate (RuBP) which is regenerated in the synthetic CBB cycle; abbreviations: alcohol 118


https://doi.org/10.1101/862599


6

oxidase (Aox), formaldehyde dehydrogenase (Fld1), S-formylglutathione hydrolase (Fgh1), formate 119

dehydrogenase (Fdh1), ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), 120

dihydroxyacetone (DHA), glyceraldehyde-3-phosphate (GAP), 3-phosphoglycerate (3PGA), 121

glutathione (GSH), ribulose-1,5-bisphosphate (RuBP); A detailed depiction of the two pathways 122

including all involved enzymes is given in Supplementary Figure 1 . 123

124

The methanol assimilation pathway of P. pastoris is entirely localized in peroxisomes and 125

shares high similarity with the CBB cycle 20. In both pathways a C1 molecule is transferred to 126

a sugar phosphate generating a C-C bond. Methanol is oxidized by alcohol oxidase (Aox1 127

and Aox2 in P. pastoris) to formaldehyde. Subsequently, formaldehyde reacts with xylulose-128

5-phosphate (Xu5P) to dihydroxyacetone (DHA) and glyceraldehyde-3-phosphate (GAP) 129

catalyzed by dihydroxyacetone synthase (Das1 and Das2 in P. pastoris). Xu5P is regenerated 130

by pentose phosphate pathway (PPP) enzyme isoforms specifically enriched in peroxisomes 131

upon cultivation on methanol 20. In total, three mole of methanol are converted to one mole of 132

GAP, which can be used for biomass and energy generation. Likewise, in autotroph 133

organisms, CO2 is added to ribulose-1,5-bisphosphate (RuBP) to form 3-phosphoglycerate (3-134

PGA) in a carboxylation reaction catalyzed by RuBisCO. 3-PGA is then phosphorylated and 135

reduced to GAP. Remarkably, the XuMP cycle can be turned into a synthetic CBB cycle by 136

addition of six enzymatic steps (i.e. all biochemical reactions of the CBB cycle present). The 137

overall engineering strategy is visualized in Fig. 1. We considered a peroxisomal 138

compartmentalization of the synthetic CBB cycle as beneficial, comparable to native C1 139

fixation in plant chloroplasts and in the XuMP cycle. To achieve this localization, a C-140

terminal peroxisomal targeting signal (PTS1) 23 was fused to each of the six engineered CBB 141

enzymes. In a second control setup, all six heterologous genes were expressed in the cytosol 142

without a PTS1 signal. The CBB cycle is split into 3 phases: carboxylation, reduction and 143

regeneration 24. For the carboxylation reaction a RuBisCO form II from Thiobacillus 144


https://doi.org/10.1101/862599


7

denitrificans was integrated into the genome. The reduction phase to yield the triose 145

phosphates, glyceraldehyde phosphate (GAP) and dihydroxyacetone phosphate (DHAP) was 146

achieved by integration of the genes encoding for phosphoglycerate kinase (PGK1), 147

glyceraldehyde-3-phosphate dehydrogenase (TDH3) from Ogataea polymorpha and 148

triosephosphate isomerase (TPI1) from Ogataea parapolymorpha. The regeneration phase 149

was completed by the addition of TKL1 (encoding transketolase) from O. parapolymorpha 150

and PRK (encoding phosphoribulokinase) from Spinachia oleracea to the five enzymes from 151

the XuMP cycle (Fbp1, Fba1-2, Shb17, Rki1-2, Rpe1-2) already present in P. pastoris. For 152

each molecule of CO2 fixated by this synthetic CBB cycle, 3 molecules of adenosine 153

triphosphate (ATP) and 2 molecules of NADH are required. The energy is provided by 154

methanol oxidation. The oxidation of one mole methanol yields two mole NADH. In order to 155

separate the synthetic fixation machinery of CO2 from energy generation, we blocked the first 156

steps of the methanol assimilatory pathway by deleting Das1 and Das2. To assist RuBisCO 157

folding two molecular chaperones from E. coli (GroEL and GroES) were integrated into the 158

genome 8. Furthermore, AOX1 was deleted to reduce the formation rate of formaldehyde, 159

which can still be formed by AOX2 (encoding alcohol oxidase 2). In a nutshell, to enable a 160

functional CO2 assimilation cycle in P. pastoris, three native genes were deleted and eight 161

heterologous genes were integrated into the genome. Six of these genes are required for a 162

fully functional CBB cycle and are either targeted to the peroxisome or to the cytosol. Two 163

genes encode chaperones and are expressed in the cytosol. We generated these strains (listed 164

in supplementary Table 1) in a three-step transformation procedure by a CRISPR/Cas9 165

mediated workflow for genome engineering in P. pastoris (see Fig. 2). 166


https://doi.org/10.1101/862599


8

167

Figure 2. Engineering scheme for generation of P. pastoris strains with a synthetic CBB cycle. 168

(a-b) Plasmid construction: (a) Genes for the proposed synthetic CBB cycle including CBB – 169

specific (green – source are autotroph organisms), non-specific genes (blue – from Ogataea strains) 170

and chaperones (from Escherichia coli) were amplified by PCR (TDH3, PGK1, TPI1 and TKL1), or 171

synthesized (RuBisCO, PRK, GroEL and GroES, codon optimized). The C-terminal PTS1 tag 172

encoding for –SKL was added by PCR if needed. The entire gene names, source organisms and 173

protein identifiers are summarized in Supplementary Table 4. (b) Generation of linear donor DNA 174

templates and single guide RNA (sgRNA) / Cas9 plasmids; (c – e) Homologous recombination 175

(HR) mediated replacement of the native sequences by co – transformation of a linear donor 176

DNA with a sgRNA / Cas9 plasmid; replacement of (c) AOX1 by an expression cassette for TDH3, 177

PRK and PGK1, (d) DAS1 by RuBisCO, GroEL and GroES and (e) DAS2 by TKL1 and TPI1 was 178

done consecutively in three transformation steps and is drawn schematically. The strains lacking 179

one or more heterologous gene were constructed accordingly with altered donor DNA fragments. 180

All strains constructed by this workflow are listed in Supplementary Table 1. 181

182


https://doi.org/10.1101/862599


9

Peroxisomal targeting of the CBB cycle leads to a higher growth rate on CO2 compared 183

to a cytosolic localization 184

Strains expressing a cytosolic (CBBc+RuBisCO) and a peroxisomal (CBBp+RuBisCO) 185

version of the CBB cycle were obtained. In order to test the ability of these strains to grow on 186

CO2 as a carbon source, shake flask cultures were carried out in the presence of 5 % (v/v) 187

CO2 (Fig. 3). A strain having the same genetic setup as the CBBp+RuBisCO strain but 188

lacking RuBisCO (CBBpΔRuBisCO) served as a negative control. This strain showed no 189

growth over the entire cultivation phase, whereas the CBBc+RubisCO and CBBp+RuBisCO 190

strains were able to grow (Fig. 3). Furthermore, it was observed that the strains with a 191

peroxisomal CBB pathway (CBBp+RuBisCO) grew significantly faster increasing from 192

0.35 ± 0.00 to 0.8 ± 0.08 g L-1 CDW in 164 hours compared to the strains with a cytosolic 193

CBB cycle, which grew from 0.36 ± 0.02 to 0.5 ± 0.12 g L-1 CDW within the same 194

timeframe. 195

196

Figure 3. Peroxisomal targeting of the CBB pathway leads to increased growth. Cultivation of 197

strains with cytosolic (CBBc+RuBisCO) and peroxisomal (CBBp+RuBisCO) pathway expression; 198

Cell Dry Weight (CDW) values are calculated from OD 600 measurements (correlation: 1 OD600 unit 199

= 0.191 g L-1CDW), for CBBpΔRuBisCO the mean of two technical replicates including single 200

values is shown (blue line plus signs) , for CBBp+RuBisCO (black line) and CBBc+RuBisCO (pink 201

line) the means of at least three biological replicates (independent transformations) with single 202

values (black and pink signs) is shown. 203


https://doi.org/10.1101/862599


10

204

This experiment showed that strains expressing a complete CBB cycle can grow in the 205

presence of CO2 and methanol, which indicates that the integrated CBB cycle is functional 206

(Fig. 3). The superior growth behavior of the CBBp+RuBisCO strain confirmed that it is 207

beneficial to compartmentalize the CBB cycle by targeting it to the peroxisome and thereby 208

replacing the native XuMP cycle. As expected the negative control (CBBpΔRuBisCO) did 209

not grow on media containing methanol and CO2. In this strain, the deletion of DAS1 and 210

DAS2 prevents the methanol assimilation capability of P. pastoris and the RuBisCO is 211

missing to complete a full CBB cycle. These results confirm that a deletion of DAS1/DAS2 is 212

sufficient to block the assimilation of methanol into biomass. The transketolase 1 (Tkl1) 213

which is responsible for the conversion of GAP and S7P into R5P and Xu5P is a homolog of 214

Das1 and Das2. Thus, Tkl1 might exhibit also a promiscuous activity for the reaction 215

catalyzed by Das1/Das2, which is the conversion of formaldehyde and Xu5P to GAP and 216

DHAP. However, since CBBpΔRuBisCO were not able to grow when supplemented with 217

methanol, Tkl1 cannot substitute for Das1/Das2. 218

P. pastoris strains expressing a functional CBB cycle in the peroxisome require CO2 for 219

growth and biomass formation 220

In the following experiments the CO2 incorporation characteristics of the strains expressing a 221

peroxisomal CBB cycle (CBBp+RubisCO) together with the negative control strain having a 222

disrupted CBB cycle (CBBpΔRuBisCO) were tested in controlled bioreactor cultivations. 223

After accumulation of biomass in a batch phase on glycerol, CBBp+RuBisCO and 224

CBBpΔRuBisCO cells were fed with CO2 and/or methanol. Thereby, two different CO2 225

feeding regimes were used: in regime A, a set of both strains were first fed with methanol 226

only and 0% (v/v) CO2 in the inlet gas and after 135 hours the CO2 was increased to 5 % 227

(v/v). In regime B, a set of both strains was fed first with methanol and 5% CO2 and switched 228


https://doi.org/10.1101/862599


11

to 0% CO2 after 135 hours (Fig. 4). The bioreactors were operated at a high stirring- and 229

gasflow- rate (1000 rpm and 35 sL h-1 respectively) to blow out CO2 formed by methanol 230

oxidation. With these experimental settings, the CO2 concentration measured at the off-gas 231

analyzer was below the detection limit of 0.1 % (v/v) also in cultures oxidizing methanol. 232

Thus, a defined CO2 supply of the cells was controlled by changing the CO2 content of the 233

inlet gas flow. 234

235

Figure 4. Growth in enginered CBBp+RuBisCO (A and B) depends on the supply of CO 2 as a 236

carbon source. Biomass formation in engineered CBBp+RuBisCO (solid (regime A) and dashed 237

(regime B) black line) is shown compared to the control strain, which lack RuBisCO, GroEL and 238

GroES (CBBpΔRuBisCO solid (A) and dashed (B) blue line. Cells were cultivated in batch phase on 239

16.0 g L-1 glycerol to a CDW of ~ 10 g L-1 and then induced with 0.5 % methanol (v/v) and 1 % 240

CO2, afterwards methanol concentration was adjusted to 1 % (v/v) (arrows). After induction only 241

CBBp+RuBisCO B and CBBpΔRuBisCO B were co-fed with 5 % CO2. After 3 days and occurrence 242

of pronounced growth, the CO2 supply was set to 0 % for CBBp+RuBisCO B and 243

CBBpΔRuBisCO B and increased to 5 % for CBBp+RuBisCO A and CBBpΔRuBisCO A. Cell Dry 244

Weight (CDW) values were calculated from OD600 measurements (correlation: 1 OD600 unit = 0.191 245

g L-1 CDW). 246

247

The two strains (CBBp+RuBisCO and CBBpΔRuBisCO) growing under the CO2 feeding 248

regime A (Fig. 4) did not grow without the addition of CO2. After commencing to feed with 249


https://doi.org/10.1101/862599


12

CO2 the strain CBBp+RuBisCO began to grow with a biomass formation rate of 0.029 g L-250

1 h-1 CDW. No growth was detected for the control strain CBBpΔRuBisCO. In regime B (Fig. 251

4), where CO2 is fed in the first phase, the CBBp+RuBisCO strain could grow with a rate of 252

0.036 g L-1 h-1 CDW and again no growth was detected for the negative control strain 253

CBBpΔRuBisCO. In the second phase of this cultivation, where no CO2 was present in the 254

inlet gas supply, no growth was detected for both strains. These results demonstrate that the 255

CBBp+RuBisCO strains can take up and grow on CO2 as a carbon source and thus have a 256

functional CO2 assimilation pathway. As energy source methanol can be oxidized by all 257

strains (Supplementary Fig. 2). The control strains (CBBpΔRuBisCO) are lacking the 258

essential step of the CBB cycle catalyzed by RuBisCO and thus the energy generated by 259

methanol oxidation can only be used to sustain the energy requirements of cellular 260

maintenance. In accordance, the methanol oxidation rate in CBBpΔRuBisCO strains with 261

0.027 g (MetOH) g (CDW)-1 h-1 was lower compared to CBBp+RuBisCO strains which have 262

a methanol oxidation rate of 0.046 g (MetOH) g (CDW)-1 h-1 (Supplementary Fig. 2). The 263

CBBp+RuBisCO strains only grew in the presence of both methanol and CO2. Even after a 264

prolonged period on methanol as an energy carrier cells could start growing again, when CO2 265

is present in the inlet gas. Taken together these data demonstrate that the growth of the 266

engineered strains expressing a synthetic CBB cycle in the peroxisomes of P. pastoris is 267

dependent on the supply of CO2 as carbon source. 268

Incorporation of CO2 into biomass is verified by 13C labelling 269

The dependency of CBBp+RuBisCO cells on the supply of gaseous CO2 for growth was 270

shown in the previous experiment. However, to obtain further evidence that CO2 is taken up 271

and incorporated into biomass, a study in which the labelling of biomass with 13C and 12C is 272

measured by Elemental Analysis - Isotope Ratio Mass Spectrometry (EA-IRMS) was 273

designed. The biomass of the engineered cells (CBBp+RuBisCO and CBBpΔRuBisCO) was 274


https://doi.org/10.1101/862599


13

enriched with 13C carbon by batch cultivation on minimal medium containing fully labelled 275

13C glycerol as the sole carbon source (Fig. 5 a). The 13C content in the biomass samples was 276

measured by EA-IRMS. After the batch phase, the 13C enrichment reached 95 ± 0.5 % for the 277

cultivation with CBBpΔRuBisCO and 97 ± 0.3 % for the CBBp+RuBisCO (Fig. 5 c). 100% 278

13C labelling cannot be reached, due to 12C carried over from the inoculum and the trace 12C 279

contamination of the utilized 13C glycerol (13C enrichment >99 %). After the glycerol was 280

consumed, the feeding regime was shifted to gaseous CO2 with a natural isotopologue 281

distribution (98.901 12C, 1.109 % 13C) and to methanol either with a natural isotopologue 282

distribution or with 13C enrichment (>99 % 13C). 283

284

Figure 5. Labelling of engineered P. pastoris cells with 13C glycerol and 12C carbon dioxide. (a) 285

CBBpΔRuBisCO and CBBp+RuBisCO (three technical replicates) cells were enriched for 13C by 286

cultivation on fully labelled 13C glycerol as the sole carbon source to around 8.0 g L-1 CDW. White-287

to-black color schematically indicates the 13C [%] of the biomass; (b) After the batch phase the 288


https://doi.org/10.1101/862599


14

cells were fed with methanol (0.5 -1.0 % (v/v) and 5 % CO2 which led to growth in 289

CBBp+RuBisCO and no growth for the CBBpΔRuBisCO. 13C methanol was used for two reactors 290

containing CBBp+RuBisCO (black) and one reactor CBBpΔRuBisCO (blue), while 12C methanol 291

was used for one reactor with CBBp+RuBisCO (pink). Incorporation of 12CO2 leads to a decrease of 292

the total 13C content in the biomass. (c – d) Bar charts show total 13C content after the batch phase 293

(45 h) (c) and after 158 h of cultivation (d), open bars show calculated values and filled bars show 294

measured values obtained by EA-IRMS (error bars show s.e.m and for calculated values CDW 295

s.e.m. was included). 296

297

As expected, CBBp+RuBisCO strains grew under the conditions with a mean biomass 298

formation rate of 0.040 ± 0.003 g L-1 h-1 CDW, whereas CBBpΔRuBisCO strains showed no 299

growth but still consumed methanol. During growth on CO2 and methanol the cells carried 300

out approximately one cell doubling. Growth of the CBBp+RuBisCO strain was 301

accompanied with a reduction of the 13C content in the biomass (Fig. 5 d). After 158 hours 302

the 13C labelling content of the CBBp+RuBisCO fed with 12CO2 and 13C methanol reached 303

52 ± 0.3% or 48 ± 0.2% in a technical replicate. These data matched with the predicted values 304

based on the measurement of accumulated biomass. The non-growing CBBpΔRuBisCO 305

showed no change in the 13C labelling content over the entire cultivation period. In the fourth 306

experiment, the CBBp+RuBisCO was cultivated with 12CO2 and 12C methanol. Also in this 307

case the 13C labelling content decreased according to predicted values based on the biomass 308

measurements. All values obtained in this experiment are shown in Supplementary Table 2. 309

These data show that the carbon coming from CO2 is incorporated into the biomass of a strain 310

expressing a functional CBB cycle. The carbon from methanol is oxidized to CO2, but due to 311

the high gas-flow rate, it is efficiently removed from the bioreactor. The negative control 312

strain (CBBpΔRuBisCO), which can oxidize methanol but cannot incorporate CO2 into the 313

biomass, showed consequently no change in the overall 13C labelling pattern. Taken together 314


https://doi.org/10.1101/862599


15

these data confirm that a P. pastoris strain containing a functional CBB cycle can utilize CO2 315

as a sole carbon source and methanol as energy source. Per definitionem the lifestyle of this 316

strain can be described as chemoorganoautotrophic. 317

Multiple cell doublings are possible by CBBp+RuBisCO strains using CO2 as the sole 318

carbon source 319

In order to show that the chemoorganoautotrophic lifestyle of the engineered 320

CBBp+RuBisCO can be maintained for multiple cell doublings, the strain was inoculated 321

with a low cell density of 0.2 g L-1 CDW in a bioreactor and cultivated for 470 hours with a 322

constant supply of methanol and CO2. 323

324

Figure 6. Bioreactor cultivation of CBBp+RuBisCO and CBBpΔRuBisCO strains inoculated at 325

low cell density and grown in the presence of CO2. During cultivation, cells were fed with 5 % 326

CO2 and methanol. Values for a single cultivation are shown for CBBpΔRuBisCO cells. For 327

CBBp+RuBisCO cells (a - black, b - orange and c - green) CDW values of three biological 328

replicates are shown. The insert shows the logarithmic mean CDW value of these three individual 329

clones in purple (red dotted line shows linear fitting). 330

331

The growth profile is shown in Fig. 6. After induction, the cells quickly started to grow with 332

an initial growth rate of µ = 0.020 ± 0.0014 h-1 in the first 20 h after inoculation. In the 333

following the growth was reduced, but a continuous exponential growth phase between 100 334


https://doi.org/10.1101/862599


16

up to 235 hours with a µ of 0.008 ± 0.0001 h-1 and a doubling time of 92 ± 1.7 h was 335

observed. The higher initial growth rate could be attributed to the utilization of intracellular 336

storage compounds, enzymes and metabolites which were accumulated during growth on the 337

pre-medium. 338

Therefore, the growth rate achieved in the prolonged exponential phase is determined as the 339

µmax of the culture under the given batch conditions. Over the entire observed 450 h of 340

cultivation the cells performed a mean of 4.3 cell doublings. These data show that the 341

engineered CBBp+RuBisCO strain can perform multiple cell doublings growing with a 342

chemoorganoautotrophic lifestyle. The growth performance of the strains presented here is 343

comparable to autotrophic organisms (Supplementary Table 3). 344

3. Conclusion 345

In this work, we reengineer yeast metabolism to enable a synthetic chemoorganoautotrophic 346

lifestyle. Following a rational engineering strategy, a synthetic CBB cycle was introduced 347

into the methylotrophic yeast P. pastoris. This enables the cell to utilize CO2 as a carbon 348

source and to grow as an autotrophic organism. By splitting the metabolism into an energy 349

generation module and a carbon fixation module, it is possible to decouple energy generation 350

from carbon fixation 6,12. This modular design is crucial to demonstrate CO2 fixation by the 351

engineered P. pastoris strains. In our design, methanol is used as an electron donor and is 352

oxidized via formaldehyde to CO2 and NADH, which defines the lifestyle as 353

chemoorganoautotrophic. Via the respiratory chain ATP is generated. The assimilatory 354

pathway for methanol was blocked by deleting DAS1 and DAS2. The obtained strain has the 355

capability to perform multiple cell doublings on CO2 as sole carbon source. Our work 356

demonstrates that the lifestyle of an organism can be switched from a 357

chemoorganoheterotroph to a chemoorganoautotroph by metabolic engineering. 358


https://doi.org/10.1101/862599


17

The synthetic CBB cycle is localized to the peroxisomes by targeting of the enzymes via 359

PTS1 signals. This peroxisomal localization of the pathway enables superior growth on CO2 360

compared to a cytosolic localization. In contrast to E. coli, containing a cytosolic CBB 361

pathway 6, no laboratory evolution was necessary to enable a functional CBB cycle. 362

Engineering a CBB cycle into the yeast S. cerevisiae was shown to enable CO2 incorporation 363

into ethanol but not into biomass 8. By supplementing the native methanol utilization pathway 364

of P. pastoris, compartmentalization of the entire synthetic CBB cycle into the peroxisome 365

was achieved, which can explain why CO2 fixation in P. pastoris can be achieved 366

successfully, whereas it remains more challenging in other microorganisms. Thus P. pastoris 367

is a promising chassis cell to incorporate and test CO2 fixation pathways in vivo including 368

synthetic pathways like the malonyl-CoA-oxaloacetate-glyoxylate (MOG) pathway 25 or the 369

crotonyl–coenzyme A (CoA)/ethylmalonyl-CoA/hydroxybutyryl-CoA (CETCH) cycle 26. 370

371


https://doi.org/10.1101/862599


18

4. Materials and methods 372

Plasmid construction 373

All expression cassettes and sgRNA / hCas9 plasmids were constructed by Golden Gate 374

cloning 22,27,28. Three native genes of P. pastoris (AOX1, DAS1 and DAS2) were replaced by 375

the coding sequences of the genes listed in Supplementary Table 4. A CRISPR/Cas9 376

mediated homologous recombination (HR) directed system was used to construct the strains 377

29. Flanking regions needed for replacing the CDSs of AOX1, DAS1 and DAS2 were amplified 378

from CBS7435 wt genomic DNA (gDNA) (Promega, Wizard® Genomic DNA Purification 379

Kit) by PCR (NEB, Q5® High-Fidelity DNA Polymerase). The other promoters (PALD4, 380

PFDH1, PSHB17, PPDC1 and PRPP1B) and terminators (TIDP1, TRPB1t, TRPS2t, TRPS3t and TRPBS17Bt) 381

were prepared accordingly and derived from genomic DNA of strain CBS7435 382

(Supplementary Table 5). CDSs of TDH3 and PGK1 were amplified from gDNA from 383

Ogataea polymporpha (CBS 4732) and TKL1 and TPI1 from gDNA from Ogataea 384

parapolymorpha (CBS 11895) according to the procedure described above and a C-terminal 385

peroxisome targeting signal 1 (PTS1) 23encoding for SKL was added by amplification with 386

primers carrying the additional nucleotides. The sequences encoding Prk (Spinacia oleracea), 387

RuBisCO - cbbM (Thiobacillus denitrificans) and the chaperones GroEL and GroES (E. coli) 388

were codon optimized (GeneArt, Regensburg, Germany). Final plasmids were digested with 389

BpiI (BbsI), (ThermoFischer Scientific, USA) to obtain linear donor DNA templates used for 390

replacement of the three native loci. Specific single guide RNAs (sgRNAs) were designed 30 391

and cloned into CRISPi plasmids 29. The genomic recognition sites for targeting the different 392

loci with CRSIPR/Cas9 were CTAGGATATCAAACTCTTCG for AOX1, 393

TGGAGAATAATCGAACAAAA for DAS1 and CGACAAACTATAAGTAGATT for 394

DAS2. The final sgRNA / Cas9 plasmids were checked by enzymatic digestion and by Sanger 395

sequencing. 396


https://doi.org/10.1101/862599


19

Strain Construction 397

For cell engineering, Komagataella phaffii (Pichia pastoris) CBS7435 31,32 was used as a 398

host. Transformations were carried out as previously described 15,29,33. Primers listed in 399

Supplementary Table 6 were used for detection of the correct replacement events of AOX1, 400

DAS1 and DAS2 loci and correct integration was further verified by Sanger sequencing. All 401

strains used in this study are listed in Supplementary Table 1. 402

Cultivations in shake flask 403

Cultures were inoculated with a starting OD600 of 2.0 in YNB medium supplemented with 404

10 g L-1 (NH4)2SO4. The flasks were incubated in a CO2 controlled incubator (5% CO2) 405

shaking at 180 rpm at 30°C. The methanol concentration was adjusted up to 0.5 % (v/v) after 406

the batch phase for induction and from there on maintained at 1% (v/v). Cell growth (OD600 407

and Cell Dry Weight (CDW) measurements) and metabolite profiles (HPLC analysis) were 408

monitored 34. 409

Bioreactor Cultivations 410

Single colonies were picked and used for inoculation of 100 mL pre-cultures in YPD medium 411

(28°C o/n and 180 rpm). Bioreactors were inoculated with a starting OD600 of 1.0 or 0.19 g L-412

1 CDW. A defined medium consisting of citrate monohydrate (2 g L-1), glycerol (16 g L-1), 413

MgSO4 7H2O (0.5 g L-1), (NH4)2HPO4 (12.6 g L-1) KCL (0.9 g L-1) and biotin (0.0004 g L-1) 414

was used. For the labelling experiment a medium containing H3PO4 (19.3 g L-1), CaCl2 2H2O 415

(0.025 g L-1), MgSO4 7H2O (2.5 g L-1), KOH (2.0 g L-1), NaCl (0.22 g L-1), EDTA (0.6 g L-416

1), biotin (0.0004 g L-1) and fully labelled 13C glycerol (8.0 g L-1) was used. Both media were 417

supplemented with trace elements. For the continuous growth fermentation YNB medium 418

supplemented with 10 g L-1 (NH4)2SO4 was used. 419


https://doi.org/10.1101/862599


20

The bioreactor cultivations were carried out in 1.4 L DASGIP reactors (Eppendorf, 420

Germany). Cultivation temperature was controlled at 28 °C, pH at 5.0 by addition of 12.5 % 421

ammonium hydroxide or with 5 M NaOH and 2 M HCl in case of YNB medium. The 422

dissolved oxygen concentration was maintained above 20 % saturation. OD600 and cell dry 423

weight (CDW) measurements as well as HPLC analysis to routinely measure glycerol, 424

glucose, methanol and citrate concentrations 34 were carried out at every sample point. 425

Induction was done by the addition of 0.5% methanol (v/v). The CO2 in the inlet gas was set 426

to 1% during induction phase. After induction phase, the methanol concentration was 427

adjusted to 1 - 1.5% (v/v) by bolus feeding and the CO2 concentration was set to 5 % 428

throughout the cultivations. For the labelling experiment, the gas flow rate was set to 35 sL h-429

1 and the stirrer speed to 1000 rpm until the end of the fermentation. 430

Elemental Analysis - Isotope Ratio Mass Spectrometry (EA-IRMS) 431

For the measurement of the biomass 13C content, the samples were taken during fermentation 432

and processed at 4 °C. Volumes of cell suspension corresponding to approximately 0.5 mg of 433

dried biomass was firstly washed with 0.1 M HCL and then twice with RO-H2O. Until 434

analysis, the biomass samples were stored at -20 °C. The biomass material was homogenized 435

and weighed in tin capsules. The 13C/12C ratio was measured with an Isotope Ratio Mass 436

Spectrometer coupled to an Elemental Analyzer (EA-IRMS). EA-IRMS measurements were 437

carried out by Imprint Analytics, Neutal, Austria. 438

439


https://doi.org/10.1101/862599


21

5. Acknowledgements 440

This work has been supported by the Federal Ministry for Digital and Economic Affairs 441

(bmwd), the Federal Ministry for Transport, Innovation and Technology (bmvit), the Styrian 442

Business Promotion Agency SFG, the Standortagentur Tirol, Government of Lower Austria 443

and ZIT - Technology Agency of the City of Vienna through the COMET-Funding Program 444

managed by the Austrian Research Promotion Agency FFG. We also thank the Austrian 445

Science Fund (FWF W1224—Doctoral Program on Biomolecular Technology of Proteins—446

BioToP). The funding agencies had no influence on the conduct of this research. EQ BOKU 447

VIBT GmbH is acknowledged for providing fermentation equipment. We also kindly thank 448

Hannes Rußmayer for help during labelling experiments. 449

6. Author Contributions 450

DM conceived and initiated the project. DM, MGS, TG, MS, and BG designed the 451

experiments. TG carried out the experiments and together with MGS, MS and DM analyzed 452

the data. TG, MGS and DM wrote the manuscript. 453

7. Competing interests 454

The authors are inventors of a patent application (application number PCT/EP2018/064158.) 455

based on the results reported in this publication. 456

457


https://doi.org/10.1101/862599


22

8. References 458

1. Bassham, J. A. et al. The Path of Carbon in Photosynthesis. XXI. The Cyclic 459

Regeneration of Carbon Dioxide Acceptor 1. J. Am. Chem. Soc. 76, 1760–1770 460

(1954). 461

2. Berg, I. A. Ecological aspects of the distribution of different autotrophic CO2 fixation 462

pathways. Appl. Environ. Microbiol. 77, 1925–36 (2011). 463

3. Claassens, N. J., Sousa, D. Z., dos Santos, V. A. P. M., de Vos, W. M. & van der Oost, 464

J. Harnessing the power of microbial autotrophy. Nat. Rev. Microbiol. 14, 692–706 465

(2016). 466

4. Erb, T. J. & Zarzycki, J. A short history of RubisCO: the rise and fall (?) of Nature’s 467

predominant CO2 fixing enzyme. Curr. Opin. Biotechnol. 49, 100–107 (2018). 468

5. Zhuang, Z.-Y. & Li, S.-Y. Rubisco-based engineered Escherichia coli for in situ 469

carbon dioxide recycling. Bioresour. Technol. 150, 79–88 (2013). 470

6. Antonovsky, N. et al. Sugar Synthesis from CO2 in Escherichia coli. Cell 166, 115–471

125 (2016). 472

7. Herz, E. et al. The genetic basis for the adaptation of E. coli to sugar synthesis from 473

CO2. Nat. Commun. 8, 1705 (2017). 474

8. Guadalupe-Medina, V. et al. Carbon dioxide fixation by Calvin-Cycle enzymes 475

improves ethanol yield in yeast. Biotechnol. Biofuels 6, 125 (2013). 476

9. Li, Y.-J. et al. Engineered yeast with a CO2-fixation pathway to improve the bio-477

ethanol production from xylose-mixed sugars. Sci. Rep. 7, 43875 (2017). 478

10. Xia, P.-F. et al. Recycling Carbon Dioxide during Xylose Fermentation by Engineered 479

Saccharomyces cerevisiae. ACS Synth. Biol. 6, 276–283 (2017). 480


https://doi.org/10.1101/862599


23

11. Papapetridis, I. et al. Optimizing anaerobic growth rate and fermentation kinetics in 481

Saccharomyces cerevisiae strains expressing Calvin-cycle enzymes for improved 482

ethanol yield. Biotechnol. Biofuels 11, 17 (2018). 483

12. Schada von Borzyskowski, L. et al. An engineered Calvin-Benson-Bassham cycle for 484

carbon dioxide fixation in Methylobacterium extorquens AM1. Metab. Eng. 47, 423–485

433 (2018). 486

13. Phaff, H. J., Miller, M. W. & Shifrine, M. The taxonomy of yeasts isolated from 487

Drosophila in the Yosemite region of California. Antonie Van Leeuwenhoek 22, 145–488

161 (1956). 489

14. Kurtzman, C. P. Description of Komagataella phaffii sp. nov. and the transfer of 490

Pichia pseudopastoris to the methylotrophic yeast genus Komagataella. Int. J. Syst. 491

Evol. Microbiol. 55, 973–976 (2005). 492

15. Gasser, B. et al. Pichia pastoris: protein production host and model organism for 493

biomedical research. Future Microbiol. 8, 191–208 (2013). 494

16. Liu, L. et al. How to achieve high-level expression of microbial enzymes. 495

Bioengineered 4, 212–223 (2013). 496

17. Peña, D. A., Gasser, B., Zanghellini, J., Steiger, M. G. & Mattanovich, D. Metabolic 497

engineering of Pichia pastoris. Metab. Eng. (2018). 498

doi:10.1016/J.YMBEN.2018.04.017 499

18. Agrawal, G., Shang, H. H., Xia, Z.-J. & Subramani, S. Functional regions of the 500

peroxin Pex19 necessary for peroxisome biogenesis. J. Biol. Chem. 292, 11547–11560 501

(2017). 502

19. Ma, C., Agrawal, G. & Subramani, S. Peroxisome assembly: matrix and membrane 503


https://doi.org/10.1101/862599


24

protein biogenesis. J. Cell Biol. 193, 7–16 (2011). 504

20. Rußmayer, H. et al. Systems-level organization of yeast methylotrophic lifestyle. BMC 505

Biol. 13, 80 (2015). 506

21. Weninger, A., Hatzl, A.-M., Schmid, C., Vogl, T. & Glieder, A. Combinatorial 507

optimization of CRISPR/Cas9 expression enables precision genome engineering in the 508

methylotrophic yeast Pichia pastoris. J. Biotechnol. (2016). 509

doi:10.1016/j.jbiotec.2016.03.027 510

22. Prielhofer, R. et al. GoldenPiCS: a Golden Gate-derived modular cloning system for 511

applied synthetic biology in the yeast Pichia pastoris. BMC Syst. Biol. 11, 123 (2017). 512

23. Lee, P. C. Peroxisome targeting of lycopene pathway enzymes in Pichia pastoris. 513

Methods Mol. Biol. 898, 161–9 (2012). 514

24. Raines, C. A., Lloyd, J. C. & Dyer, T. A. New insights into the structure and function 515

of sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme. 516

J. Exp. Bot. 50, 1–8 (1999). 517

25. Bar-Even, A., Noor, E., Lewis, N. E. & Milo, R. Design and analysis of synthetic 518

carbon fixation pathways. Proc. Natl. Acad. Sci. 107, 8889–8894 (2010). 519

26. Schwander, T., Schada von Borzyskowski, L., Burgener, S., Cortina, N. S. & Erb, T. J. 520

A synthetic pathway for the fixation of carbon dioxide in vitro. Science (80-. ). 354, 521

900–904 (2016). 522

27. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden gate shuffling: a one-523

pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4, e5553 524

(2009). 525

28. Sarkari, P., Marx, H., Blumhoff, M. L., Mattanovich, D. & Steiger, M. G. An efficient 526


https://doi.org/10.1101/862599


25

tool for metabolic pathway construction and gene integration for Aspergillus niger. 527

Bioresour. Technol. 245, 1327–1333 (2017). 528

29. Gassler, T., Heistinger, L., Mattanovich, D., Gasser, B. & Prielhofer, R. in Methods 529

Mol Biol. 1923, (in press) (2018). 530

30. Gao, Y. & Zhao, Y. Self-processing of ribozyme-flanked RNAs into guide RNAs in 531

vitro and in vivo for CRISPR-mediated genome editing. J. Integr. Plant Biol. 56, 343–532

349 (2014). 533

31. Küberl, A. et al. High-quality genome sequence of Pichia pastoris CBS7435. J. 534

Biotechnol. 154, 312–320 (2011). 535

32. Valli, M. et al. Curation of the genome annotation of Pichia pastoris ( Komagataella 536

phaffii ) CBS7435 from gene level to protein function. FEMS Yeast Res. 16, fow051 537

(2016). 538

33. Cregg, J. M. & Russell, K. A. in Pichia Protocols 27–40 (Humana Press). 539

doi:10.1385/0-89603-421-6:27 540

34. Blumhoff, M. L., Steiger, M. G., Mattanovich, D. & Sauer, M. Targeting enzymes to 541

the right compartment: Metabolic engineering for itaconic acid production by 542

Aspergillus niger. Metab. Eng. 19, 26–32 (2013). 543

544


https://doi.org/10.1101/862599


a synthetic calvin cycle enables autotrophic growth in yeast · 4 73. arabinose 5.an important step...

Documents