a program of itest (information technology experiences for students and teachers) funded by the...
TRANSCRIPT
A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation
Background Session #3 DNA & Protein Sequences
May 17, 2008
Background Session #3 DNA & Protein Sequences
May 17, 2008
Henrik KibakAssociate Professor of BiologyCalifornia State University, Monterey Bay
May 17th Workshop 2
Background for homework…Background for homework…Cytochrome c is a peripheral membrane
protein that “floats” on the inner mitochondrial membrane, shuttling electrons from Complex III to Complex IV of the Electron Transport Chain.
May 17th Workshop 4
Background for homework…Background for homework…
Using the amino acid single letter code, write the primary structure of the Cytochrome c found in your organism.
>gi|42560196|sp|P99999|CYC_HUMAN Cytochrome cMGDVEKGKKIFIMKCSQCHTVEKGGKHKTGPNLHGLFGRKTGQAPGYSYTAANKNKGIIWGEDTLMEYLENPKKYIPGTKMIFVGIKKKEERADLIAYLKKATNE
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&qty=1&c_start=1&list_uids=42560196&uids=&dopt=fasta&dispmax=5&sendto=&from=begin&to=end&extrafeatpresent=1&ef_CDD=8&ef_MGC=16&ef_HPRD=32&ef_STS=64&ef_tRNA=128&ef_microRNA=256&ef_Exon=512
May 17th Workshop 5
Background for homework…Background for homework…
Molecular weight = 11748.69 Residues = 105
Residue Number Mole%A = Ala 6 5.714 C = Cys 2 1.905 D = Asp 3 2.857 E = Glu 8 7.619 F = Phe 3 2.857 G = Gly 13 12.381 H = His 3 2.857 I = Ile 8 7.619 K = Lys 18 17.143 L = Leu 6 5.714 M = Met 4 3.810 N = Asn 5 4.762 P = Pro 4 3.810 Q = Gln 2 1.905 R = Arg 2 1.905 S = Ser 2 1.905 T = Thr 7 6.667 V = Val 3 2.857 W = Trp 1 0.952 Y = Tyr 5 4.762
Property Residues Number Mole%Non-polar (A+C+F+G+I+L+M+P+V+W+Y) 55 52.381Polar (D+E+H+K+N+Q+R+S+T) 50 47.619
In humans there are about 52% hydrophobic amino acids in Cytochrome c. How many in your organism???
May 17th Workshop 6
Background for homework…Background for homework…
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?view=gp&query_key=6&db=protein&dopt=GenPept&WebEnv=0HG83JukV9Q2uqf0xv_Qxhcv-KIa_I1CBqM3hBlgCpS3cE2lNXj-FwEEdz-%40D460633182E0E590_2646SID&WebEnvRq=1&term=&tool=query&qty=1
May 17th Workshop 7
Background for homework…Background for homework…You may use the NCBI website to obtain DNA and Protein sequence data.
http://ncbi.nlm.nih.gov
However, Cytochrome c is such a well-studied protein, that there is a vast number of other websites with good information.
May 17th Workshop 10
Background for homework…Background for homework…Working with sequences can be a nightmare or a
pleasure… depending upon whether you follow these rules:
1. Always work with single letter code and in Courier font!!!
2. Don’t make your sequence alignments too wide… 50 characters across is enough.
3. Color your sequences by species before you begin your multiple alignments… trust us!
Organism #1 ATGGGT------------GATGTTGAGAAAGGCAAGAAGATTT
Organism #2 ATGGGTATTCCTGCGGGTGATCCAGAAAAAGGAAAAAAGATTT
Organism #3 ATGTGAATTCAGGCCGGTTATCCTAAGAAAGGTGCTACACTTT